FedInvent™ Patents
Patent Details for Tuesday, May 29, 2007
This page was updated on Sunday, March 26, 2023 at 08:42 PM GMT
Department of Health and Human Services (HHS)
| US 07223228 | Timm et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | GT Urological, LLC (Minneapolis, Minnesota) |
| INVENTOR(S) | Gerald W. Timm (Minneapolis, Minnesota); David W. Anderson (Brooklyn Park, Minnesota) |
| ABSTRACT | A urethral occlusive assembly includes an implant component and external component. The implant component includes a flexible bridge member connecting two opposed implant supports. The implant component is implanted about a dorsal surface of an animal urethra. An external component is disposed external to and proximate the animal urethra. The external component operatively communicates with the implant component to transmit a compressive load on the urethra. By communication between the implant and external components, either the implant component or the external component actively compresses the urethra against the flexible bridge member, thereby effecting urinary continence. |
| FILED | Thursday, May 05, 2005 |
| APPL NO | 11/122827 |
| ART UNIT | 3735 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Surgery 6/30 |
| VIEW PATENT | @ USPTO: Full Text PDF |
07223246 — Diagnosis of the presence of cochlear hydrops using observed auditory brainstem responses
| US 07223246 | Don |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | House Ear Institute (Los Angeles, California) |
| INVENTOR(S) | Manuel Don (Anaheim, California) |
| ABSTRACT | A procedure for diagnosing cochlear hydrops is based, in part, on an analysis of the patient's auditory brainstem response (ABR) to stimuli. The patient's ABR to a broadband click stimulus is recorded. A plurality of masked ABR's are also recorded, wherein the stimulus is masked by high-pass noise with a plurality of high-pass cut-off frequencies. The latency difference between the wave V component in the unmasked click alone response and the undermasked wave V component of a low cut-off frequency high-pass response is then calculated. If an undermasked component is not present, the normal wave V component is used. The measured latency difference is combined with another measure, such as the wave V amplitude ratio. A distribution of the combined measure is then plotted for the population and a threshold established for diagnosing cochlear hydrops. Alternatively, the joint distribution of the individual measures may be used in situations where the individual measures are known to be independent. |
| FILED | Monday, June 07, 2004 |
| APPL NO | 10/863559 |
| ART UNIT | 3736 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Surgery 6/559 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223366 | Hauan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Carnegie Mellon University (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Steinar Hauan (Pittsburgh, Pennsylvania); John J. Neumann, Jr. (Pittsburgh, Pennsylvania); Todd M. Przybycien (Pittsburgh, Pennsylvania); Michael Bartkovsky (Peckville, Pennsylvania); Kaigham J. Gabriel (Pittsburgh, Pennsylvania) |
| ABSTRACT | A micro-electro-mechanical system (MEMS) device is described having a membrane which can be induced to resonate and the frequency of its resonance can be monitored. Chemical moieties can be attached to the membrane, and these moieties can be selected such that they have an affinity for molecules of interest, especially biological molecules of interest. When molecules of interest bind to the moieties they increase the mass of the membrane and thereby change the frequency of the membrane's resonance. By monitoring the resonance one can obtain an indication of the presence of the molecules of interest and in some circumstances an indication of the approximate concentration of these molecules. In addition, several types of moieties having affinities for several different molecules of interest can be placed on the membrane in such a way that the sensor can detect the presence of several different types of molecules of interest and distinguish which ones may be present and which ones may be absent. |
| FILED | Thursday, November 06, 2003 |
| APPL NO | 10/702709 |
| ART UNIT | 1743 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemical apparatus and process disinfecting, deodorizing, preserving, or sterilizing 422/68.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223390 | Brown |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Research Development Foundation (Carson City, Nevada) |
| INVENTOR(S) | Dennis T. Brown (Raleigh, North Carolina) |
| ABSTRACT | Cleavage site for the protease furin is inserted between domains of a membrane glycoprotein. Upon cleavage by furin in the trans-Golgi network, the protein is separated into individual membrane-free domain that retains its native conformation. This protocol can be used to produce virus membrane protein domains for structural analysis and for trials as vaccines. |
| FILED | Friday, May 07, 2004 |
| APPL NO | 10/841787 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 424/93.200 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223395 | Muller et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Cornell Research Foundation, Inc. (Ithaca, New York) |
| INVENTOR(S) | William A. Muller (Port Washington, New York); Alan R. Schenkel (Ft. Collins, Colorado) |
| ABSTRACT | The present invention provides methods and compositions for modulating transendothelial migration (TEM) of leukocytes. In particular, inhibition of TEM can provide a potent therapeutic approach to treating inflammatory conditions. The invention specifically relates to the discovery that CD99 mediates TEM, because blocking CD99 on either endothelial cells or monocytes bloks migration 80-90%. In conjunction with PECAM inhibitors, TEM blockade approaches 100%. CD99 is involved in a step in TEM that is distal to the step controlled by PECAM. |
| FILED | Tuesday, March 13, 2001 |
| APPL NO | 10/221758 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 424/144.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223406 | Lue et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Tom F. Lue (Hillsborough, California); Ching-Shwun Lin (San Mateo, California); Yuet W. Kan (San Francisco, California); Peter Carroll (San Francisco, California) |
| ABSTRACT | The invention provides a method for preventing or treating male erectile dysfunction or female sexual arousal disorder by administering an effective amount of one or more factors from a group of factors including vascular endothelial growth factor, brain-derived neurotrophic factor, basic fibroblast growth factor, neurotrophin-3, neurotrophin-4, or angiopoietin-1, wherein the factor is a full length protein or a nucleic acid encoding the factor, or a functional derivative or fragment thereof, or an agent that enhances production and/or male erection or female sexual arousal stimulating function of the factor(s). Combinations, kits, and combinatorial methods are also provided. |
| FILED | Thursday, May 23, 2002 |
| APPL NO | 10/155785 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 424/198.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223535 | Fields et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Centers for Disease Control (Atlanta, Georgia) |
| INVENTOR(S) | Howard A. Fields (Marietta, Georgia); Yury E. Khudyakov (Duluth, Georgia) |
| ABSTRACT | Synthetic peptides immunoreactive with hepatitis A virus (HAV) antibodies are provided. The peptides are useful as laboratory reagents to detect or quantify HAV antibodies in biological samples in clinical or research-based assays and for inducing an immune response to HAV when administered to a human or animal. The peptides contain antigenic epitopes, modified antigenic epitopes or combinations of epitopes of the major structural capsid polypeptides or non-structural polypeptides of HAV and contain one or more molecules of the amino acid glutamine (Q) at the carboxyl end of the peptide, which enhances immunoreactivity and immunogenicity, particularly IgM antibody reactivity. |
| FILED | Tuesday, December 16, 2003 |
| APPL NO | 10/738443 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/5 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223548 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | City of Hope (Duarte, California) |
| INVENTOR(S) | Shiuan Chen (Arcadia, California); Dujin Zhou (Duarte, California) |
| ABSTRACT | The invention relates to assays for screening for chemicals which affect the binding between proteins comprising an SH3 binding motif (such as Proline-rich Nuclear Receptor Co-regulatory protein (PNRC)) and nuclear receptor proteins. Compounds which affect the binding of PNRC to nuclear receptors can affect the expression of genes whose expression is under the control of nuclear receptors to which PNRC binds. PNRC interacts with the orphan receptors SF1 and ERRα1 in a ligand-independent manner and interacts with the ligand-binding domains of nuclear receptors such as ER, AR, PR, TR, BAR, and RXR in a ligand-dependent manner. A 23-amino acid region in the carboxy-terminal proline-rich region which contains an SH3-binding motif is sufficient for the interaction with nuclear receptors. |
| FILED | Friday, January 14, 2005 |
| APPL NO | 11/035096 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/7.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223552 | Hazen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Cleveland Clinic Foundation (Cleveland, Ohio) |
| INVENTOR(S) | Stanley Hazen (Pepper Pike, Ohio); Renliang Zhang (Cleveland, Ohio) |
| ABSTRACT | Diagnostic tests for characterizing an individual's risk of developing or having a cardiovascular disease. In one embodiment the present diagnostic test comprises determining the level of myeloperoxidase (MPO) activity in a bodily sample obtained from the individual or test subject. In another embodiment, the diagnostic test comprises determining the level of MPO mass in a bodily sample obtained from the test subject. In another embodiment, the diagnostic test comprises determining the level of one or more select MPO-generated oxidation products in a bodily sample obtained from the test subject. The select MPO-generated oxidation products are dityrosine, nitrotyrosine, methionine sulphoxide or an MPO-generated lipid peroxidation products. Levels of MPO activity, MPO mass, or the select MPO-generated oxidation product in bodily samples from the test subject are then compared to a predetermined value that is derived from measurements of MPO activity, MPO mass, or the select MPO-generated oxidation product in comparable bodily samples obtained from the general population or a select population of human subjects. Such comparison characterizes the test subject's risk of developing CVD. |
| FILED | Wednesday, January 02, 2002 |
| APPL NO | 10/039753 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/7.240 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223563 | Econs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Advanced Research and Technology Institute (Indianapolis, Indiana); Ludwig-Maximilians-Universitat Muchen (Munich, Germany) |
| INVENTOR(S) | Michael Econs (Indianapolis, Indiana); Ken White (Carmel, Indiana); Tim Matthias Strom (Munich, Germany); Thomas Meitinger (Munich, Germany) |
| ABSTRACT | The invention relates to novel nucleic acids encoding a fibroblast growth factor-23(FGF23) and proteins encoded thereby, mutations in which are associated with autosomal dominant rickets (ADHR). The invention further relates to methods of diagnosing and treating hypophosphatemic and hyperphosphatemic disorders comprising inhibiting or stimulating, respectively, the biological activity of FGF23 in a patient. The invention also relates to methods of treating osteoporosis, dermatomyositis, and coronary artery disease comprising stimulating the biological activity of FGF23 in a patient. |
| FILED | Tuesday, July 10, 2001 |
| APPL NO | 09/901938 |
| ART UNIT | 1647 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/69.400 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223583 | Gruber et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Emory University (Atlanta, Georgia) |
| INVENTOR(S) | Andras Gruber (Decatur, Georgia); Stephen R. Hanson (Stone Mountain, Georgia); Enrico De Cera (Ladue, Missouri) |
| ABSTRACT | The present invention relates to novel antithrombotic variants of thrombin or fragments thereof that are capable of proteolytically activating protein C, but which are substantially free of fibrinogen cleavage activity. The present invention further relates to variant polypeptides that may be cleaved to yield active thrombin variants. The present invention also relates to methods of inhibiting thrombus formation in an animal or human subject by delivering an antithrombotic variant thrombin of the present invention to the blood of the subject. The present invention relates also to methods that use the novel variant thrombins for determining the level of protein C activation in a blood sample, or the thrombogenic potential of a patient. |
| FILED | Friday, October 31, 2003 |
| APPL NO | 10/699393 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/226 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223584 | Dietzschold et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Thomas Jefferson University (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Bernhard Dietzschold (Newton Square, Pennsylvania); D. Craig Hooper (Medford, New Jersey); Matthias J. Schnell (Harleysville, Pennsylvania) |
| ABSTRACT | Live rabies virus vaccines comprising a recombinant rabies virus genome which overexpresses the rabies virus G protein increase apoptotic activity in infected cells, and enhance the generation of anti-rabies immunity in a subject. |
| FILED | Thursday, October 10, 2002 |
| APPL NO | 10/268197 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/235.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223596 | Helfand et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Stuart Charles Helfand (Madison, Wisconsin); Nasim Akhtar (Madison, Wisconsin); Erin Beth Dickerson (Madison, Wisconsin); Marcia Lillian Padilla (Madison, Wisconsin) |
| ABSTRACT | An immortalized hemangiosarcoma cell line of malignant canine endothelial cells which possesses surface expression characteristics and growth factor and cytokine expression profiles typical of nonmalignant activated endothelial cells is provided. In vitro and in vivo models for angiogenesis produced from this cell line as well as methods for identifying antiangiogenic agents using these models are also provided. |
| FILED | Friday, September 05, 2003 |
| APPL NO | 10/655727 |
| ART UNIT | 1651 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/350 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223599 | Davidson |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Trustees of Columbia University in the City of New York (New York, New York) |
| INVENTOR(S) | Mercy M. Davidson (New York, New York) |
| ABSTRACT | The present invention provides an immortalized human cardiomyocyte cell line. The present invention further provides a method for preparing a human immortalized cell line derived from a post-mitotic primary cell culture. |
| FILED | Wednesday, June 28, 2000 |
| APPL NO | 09/604876 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/449 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223606 | Nedospasov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Andrei Nedospasov (Moscow, Russian Federation); Nataliya Beda (Moscow, Russian Federation); Tatiana Pimenova (Moscow, Russian Federation); Emil Martin (Houston, Texas); Ferid Murad (Houston, Texas) |
| ABSTRACT | Methods and compositions are disclosed for quantifying and/or identifying a nitroderivative compound, or a residue thereof, and are applicable for assessing in vivo nitrative stress and for aiding in diagnosis of mammalian pathologies such as asthma, atherosclerosis, Alzheimer's disease, inflammation, ischemia, Parkinson's disease, and cancer. A preferred method comprises a) providing a sample containing the nitroderivative compound, or residue thereof, in the form of a diazo compound or residue thereof; b) azo-coupling the diazo compound, or residue thereof, to a target compound capable of producing a signal, to yield an azo-coupled compound; c) isolating the nitroderivative compound, or residue thereof, or the azo-coupled compound; d) quantitating and/or detecting the signal, to yield a quantitation and/or detection result; and e) determining from the quantitation and/or detection result the identity and/or concentration of the nitroderivative compound, or residue thereof, in the sample. |
| FILED | Wednesday, June 08, 2005 |
| APPL NO | 11/147552 |
| ART UNIT | 1743 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemistry: Analytical and immunological testing 436/106 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223731 | Lawler |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Beth Israel Deaconess Medical Center, Inc. (Boston, Massachusetts) |
| INVENTOR(S) | John W. Lawler (Swampscott, Massachusetts) |
| ABSTRACT | Thrombospondin-1 (TSP-1) is a potent inhibitor of tumor growth and angiogenesis. To elucidate the molecular mechanisms that are involved in the inhibition of tumor growth by the type 1 repeats (TSRs), recombinant versions of these motifs have been produced and have been assayed for their ability to inhibit the growth of experimental B16F10 and Lewis lung carcinomas. Recombinant proteins that contain all three TSRs (3TSR) or the second TSR with (TSR2+RFK) or without (TSR2) the transforming growth factor beta (TGFβ) activating sequence (RFK) have been expressed in Drosophila S2 cells. A recombinant protein containing all three type 1 repeats of TSP-2 and a recombinant protein containing the second TSR with the RFK sequence altered to QFK have also been produced. The data indicate that the TSRs inhibit tumor growth by inhibition of angiogenesis and regulation of tumor cell growth and apoptosis. The regulation of tumor cell growth and apoptosis is RFK-dependent while the inhibition of angiogenesis is not. The invention relates to polypeptides based on the amino acid sequence of human TSP-1 type 1 repeats. The polypeptides, variants, fragments and mutants thereof can be made by recombinant methods or can be made by chemical synthesis. The polypeptides can be formulated into pharmaceutical compositions and used in methods of therapy to reduce tumor growth. |
| FILED | Friday, May 25, 2001 |
| APPL NO | 10/296733 |
| ART UNIT | 1643 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/12 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223741 | Krieg |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | University of Iowa Research Foundation (Iowa City, Iowa) |
| INVENTOR(S) | Arthur M. Krieg (Wellesley, Massachusetts) |
| ABSTRACT | Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful a synthetic adjuvant. |
| FILED | Monday, July 14, 2003 |
| APPL NO | 10/619279 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/44 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223747 | Pettit et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Arizona Board of Regents Acting for and on Behalf of Arizona State University (Tempe, Arizona) |
| INVENTOR(S) | George R. Pettit (Paradise Valley, Arizona); Mathew D. Minardi (Mather, California); Heidi J. Rosenberg (Tempe, Arizona) |
| ABSTRACT | The invention relates to novel compounds denominated halocombstatins. The halocombstatins are derivatives of combretastatin A-3, and include compounds that exhibit cancer growth cell inhibition against a panel of human cancer cell lines and the murine P388 leukemia, as well as activity as inhibitors of tubulin polymerization and inhibitors of the binding of colchicine to tubulin. |
| FILED | Friday, September 24, 2004 |
| APPL NO | 10/948926 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/145 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223759 | Zhou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Anadys Pharmaceuticals, Inc. (San Diego, California) |
| INVENTOR(S) | Yuefen Zhou (San Diego, California); Dionisios Vourloumis (San Diego, California); Vlad E. Gregor (Del Mar, California); Geoffrey C. Winters (Coquitlam, Canada); Thomas Hermann (Cardiff By The Sea, California); Benjamin Ayida (Spring Valley, California); Zhongxiang Sun (San Diego, California); Douglas Murphy (San Diego, California); Klaus B. Simonsen (Frederiksberg, Denmark) |
| ABSTRACT | The invention relates to antibacterial 3,5-diaminopiperidine-substituted aromatic and heteroaromatic compounds and pharmaceutical compositions thereof. This invention also relates to a method of using such compounds in the treatment of bacterial infections in mammals, especially humans. |
| FILED | Wednesday, September 15, 2004 |
| APPL NO | 10/940615 |
| ART UNIT | 1625 — Organic Chemistry |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/245 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223787 | Brown et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| INVENTOR(S) | Michael S. Brown (Dallas, Texas); Jin Ye (Dallas, Texas); Chunfu Wang (Dallas, Texas); Rhea Sumpter, Jr. (Dallas, Texas); Joseph L. Goldstein (Dallas, Texas); Michael Gale, Jr. (Dallas, Texas) |
| ABSTRACT | Permissiveness of human cells to replication of susceptible pathogenic human viruses is reduced by treating the cells with a selective inhibitor of prenylation of a host cell protein. Target viruses, especially Flaviviridae, are predetermined to lack a CXXX box and prenylated viral protein, and to be replication-dependent on host protein prenylation. The general method comprises (a) contacting human cells subject to infection by the virus with an effective amount of a selective inhibitor of a prenylation enzyme of the cells; and (b) confirming a resultant reduction in permissiveness of the cells to replication of the virus. Targeted enzymes include prenyl biosynthetic enzyme like HMG CoA reductase farnesyl and/or geranylgeranyl transferase enzymes. |
| FILED | Tuesday, October 21, 2003 |
| APPL NO | 10/690891 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/423 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223836 | Marston et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Department of Health and Human Services, Centers for Disease Control and Prevention (Washington, District of Columbia) |
| INVENTOR(S) | Eric L. Marston (Atlanta, Georgia); Jackie S. Sampson (College Park, Georgia); George M. Carlone (Stone Mountain, Georgia); Edwin W. Ades (Atlanta, Georgia) |
| ABSTRACT | Peptides are disclosed that include SEQ ID NO:1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or a conservative variant or mimic thereof, wherein the conservative variant or mimic specifically binds an antibody that specifically binds SEQ ID NO:1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID or NO:6. These peptides are of use in generating an immune response against C. pneumoniae, or in preventing infection with against C. pneumoniae. |
| FILED | Friday, May 31, 2002 |
| APPL NO | 10/479503 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Natural resins or derivatives; peptides or proteins; lignins or reaction products thereof 530/300 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223844 | Dimitrov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | United States of America, Represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia); Scripps Research Institute (La Jolla, California) |
| INVENTOR(S) | Dimiter S. Dimitrov (Rockville, Maryland); Maxime Moulard (Auriol, France); Xiadong Xiao (Frederick, Maryland); Yuuei Shu (Rockville, Maryland); Sanjay K. Phogat (Frederick, Maryland); Mei-Yun Zhang (Frederick, Maryland); Dennis Burton (La Jolla, California) |
| ABSTRACT | The present invention features antibodies and antibody fragments that specifically bind a CD4-inducible HIV gp120 epitope that is enhanced by binding a co-receptor for HIV, such as CCR5 or CXCR4, and pharmaceutical compositions comprising the antibodies or antibody fragments. The invention also features nucleic acids encoding the antibodies or antibody fragments, pharmaceutical compositions comprising the nucleic acids encoding the antibodies or antibody fragments, vectors comprising the nucleic acids, and cells comprising the vectors. The invention further features methods of identifying antibodies or antibody fragments with broadly neutralizing activity against HIV. The invention also features methods of inhibiting HIV entry into cells and methods of inhibiting replication of HIV in mammals, using the antibodies and nucleic acids of the invention. |
| FILED | Wednesday, October 16, 2002 |
| APPL NO | 10/492729 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Natural resins or derivatives; peptides or proteins; lignins or reaction products thereof 530/391.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223845 | Cummings et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Board of Regents of the University of Oklahoma (Norman, Oklahoma) |
| INVENTOR(S) | Richard D. Cummings (Edmond, Oklahoma); Rodger P. McEver (Oklahoma City, Oklahoma) |
| ABSTRACT | A new class of synthetic glycosulfopeptides (GSPs) which have one or more sulfated tyrosine residues and a glycan linked to the peptide, the glycan preferably including a sialyl Lewisx group or a sialyl Lewisa group. In a preferred version the GSPs have an O-glycan comprising a β1,6 linkage to a GalNAc. The present invention further contemplates in vitro methods of the synthesis of these GSPs without the use of the cells and methods of their use in vivo as powerful anti-inflammatory antithrombotic, or anti-metastatic compounds. The invention also contemplates a method of synthesizing oligosaccharides by cleaving the glycan from the GSP. |
| FILED | Wednesday, May 04, 2005 |
| APPL NO | 11/121731 |
| ART UNIT | 1656 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Natural resins or derivatives; peptides or proteins; lignins or reaction products thereof 530/395 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223853 | Reichsman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Department of Health and Human Services. (Washington, District of Columbia); The University of Massachusetts (Amherst, Massachusetts) |
| INVENTOR(S) | Frieda Reichsman (Shutesburg, Massachusetts); Aykut Üren (Rockville, Maryland); Jeffrey S. Rubin (Potomac, Maryland); Susan Cumberledge (Amherst, Massachusetts) |
| ABSTRACT | The invention stems from the discovery that sFRP and fragments thereof can bind to members of the Wnt family of proteins and cause an increase in Wnt biological activity. Furthermore, fragments of sFRP that do not contain the CRD domain are shown to bind to Wnt proteins and modulate Wnt biological activity. Accordingly, the invention provides these sFRP fragments and variants of these fragments, as well as vectors and host cells containing nucleic acid sequences encoding the sFRP fragments and variants. |
| FILED | Monday, April 28, 2003 |
| APPL NO | 10/425586 |
| ART UNIT | 1646 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Organic compounds 536/23.500 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223856 | Troy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Trustees of Columbia University in the City of New York (New York, New York) |
| INVENTOR(S) | Carol M. Troy (Hastings-on-Hudson, New York); Michael L. Shelanski (Brooklyn, New York) |
| ABSTRACT | The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ effective to inhibit death of the cell. |
| FILED | Friday, June 28, 2002 |
| APPL NO | 10/185084 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Organic compounds 536/24.500 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223864 | Kalyanaraman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | MCW Research Foundation, Inc. (Milwaukee, Wisconsin) |
| INVENTOR(S) | Balaraman Kalyanaraman (Wauwatosa, Wisconsin); Hongtao Zhao (Milwaukee, Wisconsin) |
| ABSTRACT | The inventors have purified the fluorescent product in the hydroethidine-based supeorxide detection assays and further identified the product as 2-hydroxyethidium. Methods for synthesizing 2-hydroxyethidium and for detecting and quantifying superoxide are provided. |
| FILED | Thursday, April 08, 2004 |
| APPL NO | 10/820599 |
| ART UNIT | 1657 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Organic compounds 546/79 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223969 | Schultz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Ionwerks, Inc. (Houston, Texas) |
| INVENTOR(S) | J. Albert Schultz (Houston, Texas); Valeri Raznikov (Moscow, Russian Federation); Thomas F. Egan (Houston, Texas); Michael V. Ugarov (Houston, Texas); Agnès Tempez (Houston, Texas) |
| ABSTRACT | Improved ion focusing for an ion mobility drift cell allows for improved throughput for subsequent detection such as mass detection. Improved focusing is realized by the use of alternating regions of high and low electric fields in the ion mobility drift cell. |
| FILED | Monday, January 30, 2006 |
| APPL NO | 11/342716 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Radiant energy 250/290 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223981 | Capote et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Aguila Technologies Inc. (San Marcos, California) |
| INVENTOR(S) | M. Albert Capote (Carlsbad, California); Howard A. Lenos (Murrieta, California) |
| ABSTRACT | A radiation detector assembly has a semiconductor detector array substrate of CdZnTe or CdTe, having a plurality of detector cell pads on a first surface thereof, the pads having a contact metallization and a solder barrier metallization. An interposer card has planar dimensions no larger than planar dimensions of the semiconductor detector array substrate, a plurality of interconnect pads on a first surface thereof, at least one readout semiconductor chip and at least one connector on a second surface thereof, each having planar dimensions no larger than the planar dimensions of the interposer card. Solder columns extend from contacts on the interposer first surface to the plurality of pads on the semiconductor detector array substrate first surface, the solder columns having at least one solder having a melting point or liquidus less than 120 degrees C. An encapsulant is disposed between the interposer circuit card first surface and the semiconductor detector array substrate first surface, encapsulating the solder columns, the encapsulant curing at a temperature no greater than 120 degrees C. |
| FILED | Wednesday, December 03, 2003 |
| APPL NO | 10/725442 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Radiant energy 250/370.130 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224300 | Dai et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Second Sight Medical Products, Inc. (Sylmar, California) |
| INVENTOR(S) | Rongqing Dai (Castaic, California); James S. Little (Saugus, California); Kea-Tiong Tang (Temple City, California) |
| ABSTRACT | The present invention provides a DAC constructed from a series of floating gate devices which are programmable to a series of predetermined values. Addressing one or more of the programmed floating gate devices, will select from a wide variety of analog outputs. Reprogramming the floating gate devices, can provide a different variety of analog outputs. For example, the floating gate devices can be preprogrammed to a different range of outputs matching a range of perceptible signals. |
| FILED | Monday, December 02, 2002 |
| APPL NO | 10/308438 |
| ART UNIT | 2819 — Semiconductors/Memory |
| CURRENT CPC | Coded data generation or conversion 341/136 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224301 | Dai et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Second Sight Medical Products, Inc. (Sylmar, California) |
| INVENTOR(S) | Rongqing Dai (Castaic, California); James S. Little (Saugus, California); Kea-Tiong Tang (Temple City, California) |
| ABSTRACT | The present invention provides a DAC constructed from a series of floating gate devices which are programmable to a series of predetermined values. Addressing one or more of the programmed floating gate devices, will select from a wide variety of analog outputs. Reprogramming the floating gate devices, can provide a different variety of analog outputs. For example, the floating gate devices can be preprogrammed to a different range of outputs matching a range of perceptible signals. |
| FILED | Tuesday, June 13, 2006 |
| APPL NO | 11/452022 |
| ART UNIT | 2819 — Semiconductors/Memory |
| CURRENT CPC | Coded data generation or conversion 341/136 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224827 | Acar et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| INVENTOR(S) | Burak Acar (Bebek, Turkey); Christopher F. Beaulieu (Los Altos, California); David S. Paik (Palo Alto, California); Sandy A. Napel (Menlo Park, California); R. Brooke Jeffrey (Los Altos Hills, California) |
| ABSTRACT | An automatic method for the registration of prone and supine computed tomographic colonography data is provided. The method improves the radiologist's overall interpretation efficiency as well as provides a basis for combining supine/prone computer-aided detection results automatically. The method includes determining (centralized) paths or axes of the colon from which relatively stationary points of the colon are matched for both supine and prone positions. Stretching and/or shrinking of either the supine or prone path perform registration of these points. The matching and registration occurs in an iterative and recursive manner and is considered finished based on one or more decision criteria. |
| FILED | Friday, September 26, 2003 |
| APPL NO | 10/673089 |
| ART UNIT | 2624 — Selective Visual Display Systems |
| CURRENT CPC | Image analysis 382/131 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225027 | Zeng et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Fan-Gang Zeng (Irvine, California); Kai-Bao Nie (Irvine, California) |
| ABSTRACT | A method of improving sound quality of audio signals that are digitally processed includes steps of extracting amplitude and frequency modulations from one or more narrow bands of the audio signal, and filtering and compressing those modulations to produce amplitude and frequency modulated audio signals that are digitally processed to provide an acoustic signal similar to the original audio signal. The methods may be used in auditory prostheses and telecommunication systems. |
| FILED | Tuesday, August 27, 2002 |
| APPL NO | 10/229397 |
| ART UNIT | 3762 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Surgery: Light, thermal, and electrical application 67/57 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225129 | Massaro et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Dominic W. Massaro (Santa Cruz, California); Michael M. Cohen (Santa Cruz, California); Jonas Beskow (Stockholm, Sweden) |
| ABSTRACT | A method of modeling speech distinctions within computer-animated talking heads that utilize the manipulation of speech production articulators for selected speech segments. Graphical representations of voice characteristics and speech production characteristics are generated in response to said speech segment. By way of example, breath images are generated such as particle-cloud images, and particle-stream images to represent the voiced characteristics such as the presence of stops and fricatives, respectively. The coloring on exterior portions of the talking head is displayed in response to selected voice characteristics such as nasality. The external physiology of the talking head is modulated, such as by changing the width and movement of the nose, the position of the eyebrows, and movement of the throat in response to the voiced speech characteristics such as pitch, nasality, and voicebox vibration, respectively. The invention also describes modeling a talking head on the facial image of a particular individual. |
| FILED | Thursday, September 20, 2001 |
| APPL NO | 09/960248 |
| ART UNIT | 2626 — Selective Visual Display Systems |
| CURRENT CPC | Data processing: Speech signal processing, linguistics, language translation, and audio compression/decompression 74/261 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Defense (DOD)
| US 07222525 | Jones |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Dennis J. Jones (Shoals, Indiana) |
| ABSTRACT | A skin and tissue simulant including a gelatin composite block and an ether based cast polyurethane sheet. The gelatin composite block acting as the tissue simulant. The sheet acting as the skin simulant, the sheet disposed over a portion of the gelatin composite block. |
| FILED | Tuesday, November 30, 2004 |
| APPL NO | 11/001612 |
| ART UNIT | 2856 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring and testing 073/167 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07222823 | Thomas et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | ATA Engineering, Inc. (San Diego, California) |
| INVENTOR(S) | Gareth Rhys Thomas (Del Mar, California); Cynthia Marie Fadick (Encinitas, California) |
| ABSTRACT | A payload adapter consists of a body that when hollow includes a plurality of stiffeners—radial and/or circumferential—or alternatively a core for carrying shear loads. The body may include a first annular face sheet, a second annular face sheet and a plurality of stiffeners connecting between the first annular face sheet and the second annular face sheet. The combination of the annular hollow body and the plurality of stiffeners or the same face sheets combined with an in-filled core results in an axial frequency and a lateral (pitch) frequency for the payload adapter that provides superior vibration isolation. Constrained layer damping is incorporated into the design for additional vibration attenuation. |
| FILED | Tuesday, July 06, 2004 |
| APPL NO | 10/886214 |
| ART UNIT | 3643 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Aeronautics and astronautics 244/173.200 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07222903 | Tardiff |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | USA as Represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Marc Tardiff (Lowell, Massachusetts) |
| ABSTRACT | The present invention is directed to a spreader bar. The spreader bar has an elongate central member having a hollow interior, and a pair of elongate end members wherein each elongate end member is partially disposed within the hollow interior of the central elongate member so that a first portion of the elongate end member is within the hollow interior of the elongate central member and a second portion of the elongate end member is external to the hollow interior. The second portion of each elongate end member extends to a distal end. The spreader bar has a pair of sling guides wherein each sling guide is attached to the distal end of a corresponding elongate end member. |
| FILED | Wednesday, March 10, 2004 |
| APPL NO | 10/802083 |
| ART UNIT | 3652 — Material and Article Handling |
| CURRENT CPC | Handling: Hand and hoist-line implements 294/81.210 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223432 | Cholli et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | University of Massachusettes Lowell (Lowell, Massachusetts); United States of America, as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Ashok L. Cholli (Chelmsford, Massachusetts); Vijayendra Kumar (Lowell, Massachusetts); Jayant Kumar (Westford, Massachusetts); Virinder Singh Parmar (Lowell, Massachusetts); Lynne Ann Samuelson (Marlborough, Massachusetts); Ferdinando F. Bruno (Andover, Massachusetts) |
| ABSTRACT | Antioxidant polymers of the present invention comprise repeat units that include one or both of Structural Formulas (I) and (II): wherein: R is —H or a substituted or unsubstituted alkyl, acyl or aryl group; Ring A is substituted with at least one tert-butyl group or substituted or unsubstituted n-alkoxycarbonyl group; Ring B is substituted with at least one —H and at least one tert-butyl group or substituted or unsubstituted n-alkoxycarbonyl group; Rings A and B are each optionally substituted with one or more groups selected from the group consisting of —OH, —NH, —SH, a substituted or unsubstituted alkyl or aryl group, and a substituted or unsubstituted alkoxycarbonyl group; n is an integer equal to or greater than 2; and p is an integer equal to or greater than 0. The invention also includes methods of using and preparing these polymers. |
| FILED | Friday, April 04, 2003 |
| APPL NO | 10/408679 |
| ART UNIT | 1761 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Food or edible material: Processes, compositions, and products 426/541 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223438 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Lei Fu (Evanston, Illinois); Xiaogang Liu (Evanston, Illinois); Vinayak P. Dravid (Glenview, Illinois) |
| ABSTRACT | A direct-write method for fabricating magnetic nanostructures, including hard magnetic nanostructures of barium hexaferrite, BaFe, based on nanolithographic printing and a sol-gel process. This method utilizes a conventional atomic force microscope tip, coated with a magnetic material precursor solution, to generate patterns that can be post-treated at elevated temperature to generate magnetic features consisting of barium ferrite in its hexagonal magnetoplumbite (M-type) structure. Features ranging from several hundred nm down to below 100 nm were generated and studied using AFM, magnetic force microscopy, and X-ray photoelectron spectroscopy. The approach offers a new way for patterning functional inorganic magnetic nanostructures with deliberate control over feature size and shape, as well as interfeature distance and location. |
| FILED | Wednesday, September 17, 2003 |
| APPL NO | 10/663976 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Coating processes 427/127 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223465 | Subramanian et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | General Electric Company (Schenectady, New York) |
| INVENTOR(S) | Suresh Subramanian (Mason, Ohio); James Dale Steibel (Mason, Ohio); Douglas Melton Carper (Trenton, Ohio) |
| ABSTRACT | The present invention is a ceramic matrix composite turbine engine component, wherein the component has a region of expected higher interlaminate stress during normal engine operation. The component includes both coated fiber tows and uncoated fiber tows arranged together into a preselected form, wherein the uncoated fiber tows are located at predetermined regions of expected high interlaminate stress. The invention further includes method of manufacturing a CMC such as a composite turbine engine component, wherein the component has a region of expected higher interlaminate stress during engine operation. |
| FILED | Wednesday, December 29, 2004 |
| APPL NO | 11/025510 |
| ART UNIT | 1774 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Stock material or miscellaneous articles 428/293.400 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223545 | Liu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| INVENTOR(S) | David R. Liu (Lexington, Massachusetts); Zev J. Gartner (Somerville, Massachusetts); Matthew W. Kanan (Cambridge, Massachusetts) |
| ABSTRACT | Nature evolves biological molecules such as proteins through iterated rounds of diversification, selection, and amplification. The present invention provides methods, compositions, and systems for synthesizing, selecting, amplifying, and evolving non-natural molecules based on nucleic acid templates. The sequence of a nucleic acid template is used to direct the synthesis of non-natural molecules such as unnatural polymers and small molecules. Using this method combinatorial libraries of these molecules can be prepared and screened. Upon selection of a molecule, its encoding nucleic acid template may be amplified and/or evolved to yield the same molecule or related molecules for re-screening. The inventive methods and compositions of the present invention allow for the amplification and evolution of non-natural molecules in a manner analogous to the amplification of natural biopolymer such as polynucleotides and protein. |
| FILED | Friday, September 24, 2004 |
| APPL NO | 10/949163 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/6 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223550 | Dhanasekaran et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Temple University-of the Commonwealth System of Higher Education (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Natarajan Dhanasekaran (Bryn Mawr, Pennsylvania); John R. Jenkins (Vicarage Hill, United Kingdom) |
| ABSTRACT | A biosensor for the identification of olfactants, including chemical and biological agents, prefumery, explosives and pharmaceuticals. The biosensors comprise robust eukaryotic cells, such as yeast, into which at least one exogenous olfactory signaling pathway has been genetically integrated to detect molecules of interest. |
| FILED | Friday, February 08, 2002 |
| APPL NO | 10/467223 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/7.210 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223628 | Bocian et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | David F. Bocian (Riverside, California); Jonathan Lindsey (Raleigh, North Carolina); Zhiming Liu (Riverside, California); Amir A. Yasseri (Riverside, California); Veen Misra (Raleigh, North Carolina); Qian Zhao (Urbana, Illinois); Qiliang Li (Raleigh, North Carolina); Shyam Surthi (Raleigh, North Carolina); Robert S. Loewe (Morrisville, North Carolina) |
| ABSTRACT | This invention provides a new procedure for attaching molecules to semiconductor surfaces, in particular silicon. The molecules, which include, but are not limited to porphyrins and ferrocenes, have been previously shown to be attractive candidates for molecular-based information storage. The new attachment procedure is simple, can be completed in short times, requires minimal amounts of material, is compatible with diverse molecular functional groups, and in some instances affords unprecedented attachment motifs. These features greatly enhance the integration of the molecular materials into the processing steps that are needed to create hybrid molecular/semiconductor information storage devices. |
| FILED | Friday, December 19, 2003 |
| APPL NO | 10/742596 |
| ART UNIT | 2891 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor device manufacturing: Process 438/99 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223851 | Terlesky et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | General Dynamics Advanced Information Systems, Inc. (Fairfax, Virginia) |
| INVENTOR(S) | Kathy Terlesky (Charlottesville, Virginia); Chris Earle (Ruckersville, Virginia) |
| ABSTRACT | The present invention relates to a nucleic acid binding polymer which has affinity for nucleic acid molecules such as DNA, RNA, or hybrids thereof. The polymer is comprised of a nucleic acid binding backbone linked to a nucleic acid binding agent, preferably by a linking moiety. The polymer can be used to isolate and purify nucleic acid molecules from a variety of sample types including but not limited to clinical and environmental. |
| FILED | Thursday, February 06, 2003 |
| APPL NO | 10/359084 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Organic compounds 536/23.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223979 | Crain, Jr. et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Aerospace Corporation (El Segundo, California) |
| INVENTOR(S) | William R. Crain, Jr. (Manhattan Beach, California); Dan J. Mabry (El Segundo, California); John Bernard Blake (Santa Monica, California); Norman Katz (Palos Verdes Estates, California) |
| ABSTRACT | An improved radiation dosimeter device in an improved radiation dosimeter system provides a DC analog output voltage that is proportional to the total ionizing dose accumulated as a function of time at the location of the dosimeter in a host spacecraft, so as to operate in a system bus voltage range common to spacecraft systems with the output being compatible with conventional spacecraft analog inputs, while the total dose is measured precisely by continually monitoring the energy deposited in a silicon test mass accumulating charge including charge contribution prior to radiation threshold detection for improved measurement of the total accumulated charge with the dosimeters being daisy-chained and distributed about the spacecraft for providing a spacecraft dose profile about the spacecraft using the improved radiation dosimeter system. |
| FILED | Monday, January 30, 2006 |
| APPL NO | 11/342998 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Radiant energy 250/370.70 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224039 | McGuire et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | International Technology Center (Raleigh, North Carolina) |
| INVENTOR(S) | Gary E. McGuire (Chapel Hill, North Carolina); Olga Alexander Shenderova (Raleigh, North Carolina) |
| ABSTRACT | In accordance with certain embodiments consistent with the present invention, diamond nanoparticles are mixed with polymers. This mixture is expected to provide improved properties in interlayer dielectrics used in integrated circuit applications. This abstract is not to be considered limiting, since other embodiments may deviate from the features described in this abstract. |
| FILED | Wednesday, September 08, 2004 |
| APPL NO | 10/936743 |
| ART UNIT | 2823 — Semiconductors/Memory |
| CURRENT CPC | Active solid-state devices 257/532 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224106 | Pei et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | SRI International (Menlo Park, California) |
| INVENTOR(S) | Qibing Pei (Fremont, California); Ronald E. Pelrine (Boulder, Colorado); Roy D. Kornbluh (Palo Alto, California) |
| ABSTRACT | The present invention relates to transducers, their use and fabrication. The transducers convert between mechanical and electrical energy. Some transducers of the present invention include a pre-strained polymer. The pre-strain improves the conversion between electrical and mechanical energy. The present invention also relates to devices including an electroactive polymer to convert between electrical and mechanical energy. The present invention further relates to compliant electrodes that conform to the shape of a polymer included in a transducer. The present invention provides methods for fabricating electromechanical devices including one or more electroactive polymers. |
| FILED | Wednesday, January 18, 2006 |
| APPL NO | 11/335030 |
| ART UNIT | 2834 — Electrical Circuits and Systems |
| CURRENT CPC | Electrical generator or motor structure 310/800 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224322 | Ghaleb et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Sam Ghaleb (Ridgecrest, California); Floyd A. Kinder (Ridgecrest, California) |
| ABSTRACT | A phased array balloon antenna having an inner membrane coupled to an outer membrane and a phased array antenna connected to an inner membrane. The phased array antenna transmits an energy towards a reflective film on the outer membrane, reflecting the energy outwards and illuminating an area smaller than that illuminated by the phased array alone. |
| FILED | Thursday, June 30, 2005 |
| APPL NO | 11/177649 |
| ART UNIT | 2821 — Semiconductors/Memory |
| CURRENT CPC | Communications: Radio wave antennas 343/915 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224463 | Zumberge et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Mark A. Zumberge (San Diego, California); Jonathan Berger (San Diego, California); Robert L. Parker (San Diego, California); Matthew Dzieciuch (La Jolla, California) |
| ABSTRACT | Techniques and devices for digitally resolving quadrature fringe signals from interferometers such as optical interferometers and interferometer-based sensing devices. In one implementation, two quadrature fringe signals from an interferometer which causes two signals in two signal paths to interfere with each other are sampled to obtain digital data samples from the two quadrature fringe signals. The digital data samples are used to perform a linear least square fitting to establish coefficients for an ellipse traced by the two quadrature fringe signals as a phase difference between the two signal paths changes. A pair of digital data samples are respectively obtained from the two quadrature signals at a given moment and are used to compute a corresponding phase difference between the two signal paths of the interferometer from established coefficients of the ellipse. The coefficient for the ellipse can be updated over time. This digital processing allows for real time processing. |
| FILED | Wednesday, January 05, 2005 |
| APPL NO | 11/030596 |
| ART UNIT | 2877 — Optics |
| CURRENT CPC | Optics: Measuring and testing 356/450 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224464 | Manning |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | |
| INVENTOR(S) | Christopher J. Manning (Troy, Idaho) |
| ABSTRACT | A novel tilt-compensated interferometer geometry is described. The design uses tilt- and shear-compensation optics to simultaneously maintain high throughput and precise interferometric alignment, even in the presence of non-ideal scanning motions. The tilt-compensation mechanism consists of a novel beamsplitter/reflector assembly that produces two anti-parallel beams. A variety of enhancements to the basic design are described, providing a family of related interferometer designs. These interferometers have applications in spectrometry, spectral imaging and metrology. |
| FILED | Thursday, August 02, 2001 |
| APPL NO | 09/922363 |
| ART UNIT | 2877 — Optics |
| CURRENT CPC | Optics: Measuring and testing 356/451 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224508 | Chalfant, III et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Space Photonics, Inc. (Fayetteville, Arkansas) |
| INVENTOR(S) | Chuck H. Chalfant, III (Fayetteville, Arkansas); Fred J. Orlando (West Melbourne, Florida); Jeffrey T. Gregory (Mountainburg, Arkansas); Chad B. O'Neal (Ruston, Louisiana) |
| ABSTRACT | A MEMS-based optical steering apparatus for free space optical transmitters, receivers, and transceivers is disclosed. The MEMS device comprises actuators linked to an optic fiber, the actuators operable to maneuver the optical fiber in the X-Y plane at the focal point of the transmitter, receiver, or transceiver. The MEMS device may thus be used to replace gimbals for beam steering applications. |
| FILED | Monday, September 12, 2005 |
| APPL NO | 11/224473 |
| ART UNIT | 2873 — Printing/Measuring and Testing |
| CURRENT CPC | Optical: Systems and elements 359/290 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224516 | Fisher |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | ITT Manufacturing Enterprises, Inc. (Wilmington, Delaware) |
| INVENTOR(S) | Donald Scott Fisher (Spring Valley Township, Ohio) |
| ABSTRACT | A multimode fiber receiver includes a multimode collimator, a multimode fiber optic amplifier and a detector. The collimator receives incoming signals and provides the signals to the amplifier. The amplifier includes plural amplification stages, a limiter, a tunable narrow band filter and a microcontroller. The amplification stages each include a gain element and a noise filter. The limiter receives the amplified signals and limits the energy of those signals. The optical signals subsequently traverse the narrow band filter including an adjustable pass band to provide desired signals to the detector. The microcontroller measures the energy of the incoming and output signals to control the limiter, amplification stages and/or narrow band filter in order to produce signals within the dynamic range of a particular application. The multimode fiber optic amplifier and/or receiver of the present invention is preferably utilized within an optical communication unit. |
| FILED | Tuesday, August 02, 2005 |
| APPL NO | 11/194762 |
| ART UNIT | 3663 — Computerized Vehicle Controls and Navigation, Radio Wave, Optical and Acoustic Wave Communication, Robotics, and Nuclear Systems |
| CURRENT CPC | Optical: Systems and elements 359/337.200 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224708 | Sin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Aerospace Corporation (El Segundo, California) |
| INVENTOR(S) | Yongkun Sin (Torrance, California); Nathan Presser (West Hollywood, California) |
| ABSTRACT | Platinum (Pt) thin film heaters are deposited by a focused ion beam for semiconductor manufacturing of thermally tunable distributed feedback lasers. An exemplar 1.3 μm InGaAsP/InP laser is integrated with a tuning element having a wide wavelength tuning range of 4.9 nm, that is, 857 GHz, with a small heater current of 13.0 mA. |
| FILED | Monday, August 30, 2004 |
| APPL NO | 10/929860 |
| ART UNIT | 2828 — Semiconductors/Memory |
| CURRENT CPC | Coherent light generators 372/34 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224744 | Giannakis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Regents of the University of Minnesota (Minneapolis, Minnesota) |
| INVENTOR(S) | Georgios B. Giannakis (Minnetonka, Minnesota); Xiaoli Ma (St. Paul, Minnesota) |
| ABSTRACT | Space-time multipath (STM) coding techniques are described for frequency-selective channels, respectively. The described STM coded system guarantees full space-multipath diversity, and achieves large coding gains with high bandwidth efficiency. The techniques utilize a linearly coding technique, and incorporates subchannel grouping for application of the linear coding techniques. As a result, the techniques enable desirable tradeoffs between performance and complexity. |
| FILED | Monday, April 21, 2003 |
| APPL NO | 10/420352 |
| ART UNIT | 2611 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Pulse or digital communications 375/267 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224845 | Russo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | BAE Systems Information And Electric Systems Integration Inc. (Nashua, New Hampshire) |
| INVENTOR(S) | Leonard E. Russo (Nashua, New Hampshire); Jose L. Paredes (Edo Merida, Venezuela); Gonzalo R. Arce (Newark, Delaware) |
| ABSTRACT | A new approach to multispectral image compression where the intra- and cross-band correlations are jointly exploited in a surprisingly simple yet very effective manner. The key component of the algorithm is a bijection mapping of the original multispectral image into a virtual 2 dimensional scalar image. By optimally mapping the multispectral image set into a single 2 dimensional array and by subsequently applying a scalar image coding algorithm, the spatial correlation and the spectral correlation of the multispectral data set are jointly exploited. Based on the statistical characteristics of the multispectral data, the bijection mapping can be optimized to minimize the distortion introduced by the compression algorithm. The optimization reduces to the maximization of a function of the second-order statistics of the multispectral data. At high compression rates, the new algorithm outperforms traditional compression algorithms whenever the cross-band correlation is high and it yields comparable performance at low compression rates. |
| FILED | Friday, February 28, 2003 |
| APPL NO | 10/376491 |
| ART UNIT | 2624 — Selective Visual Display Systems |
| CURRENT CPC | Image analysis 382/240 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224869 | Cole et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | James H. Cole (Great Falls, Virginia); Robert P. Moeller (Ft. Washington, Maryland); Marta M. Howerton (Fairfax Station, Virginia) |
| ABSTRACT | An electro-optic modulator includes a substrate, at least two parallel optical waveguides, at least one ground plane, at least one active electrode with at least two lower portions of the active electrode, and an upper portion connected to the lower portions, the lower portions spaced apart from each other, each of the two lower portions of the active electrode extending over one of the optical waveguides. An electro-optic phase modulator having at least one optical waveguide and at least one active electrode formed on a face of the substrate, the active electrode having a wider upper portion and a narrower lower portion, the lower portions of the active electrode aligned with and extending over one of the optical waveguides. A bridge electrode has at least one narrower lower portion, and a wider upper portion, the lower portion for being arranged over an optical waveguide formed in a substrate. |
| FILED | Monday, March 14, 2005 |
| APPL NO | 11/080974 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical waveguides 385/40 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224873 | Bird et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Crystal Fibre A/S (Birkerod, Denmark) |
| INVENTOR(S) | David Michael Bird (Bath, United Kingdom); John Mark Pottage (North East Lincolnshire, United Kingdom); Timothy Adam Birks (Bath, United Kingdom); Matthew James Banham (Bath, United Kingdom) |
| ABSTRACT | Photonic crystal fibers that guide light by virtue of a photonic band gap. Fibers that are formed from materials having higher refractive indices than silica are provided using an optical waveguide including a core with a relatively low refractive index and a photonic band gap structure that can substantially confine light to the core. The structure includes elongate regions of relatively low refractive index interspersed with elongate regions of relatively high refractive index, with the band gap residing above the fifth photonic band of the band gap structure. |
| FILED | Thursday, September 09, 2004 |
| APPL NO | 10/936825 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical waveguides 385/125 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224878 | Wessels et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Bruce W. Wessels (Evanston, Illinois); Pingsheng Tang (Medford, Oregon); David J. Towner (Portland, Oregon); Anthony L. Meier (Chicago, Illinois) |
| ABSTRACT | Electro-optic modulator devices and related waveguide components comprising BaTiO3 films. |
| FILED | Monday, November 14, 2005 |
| APPL NO | 11/273152 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical waveguides 385/130 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225258 | Orcutt et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | General Dynamics Corporation (Scottsdale, Arizona) |
| INVENTOR(S) | Edward K. Orcutt (Cave Creek, Arizona); Randall K. Bahr (Scottsdale, Arizona); Carl M. Willis (Mesa, Arizona) |
| ABSTRACT | The present invention provides a network connectivity system and method that facilitate the design of a network connectivity plan where the availability of link resources is limited and varies with the time. The preferred system and methods can be used to provide a network connection plan that fully connects such a network, where possible, while efficiently allocating the link resources used to implement the network connection plan. The network connectivity system and method develops the network connection plan by choosing links based on link resource availability and link duration. Thus, the network connectivity system and method creates a connection plan that, if possible, keeps full connectivity in the network, compensating for changes over time in the availability of links. The network connectivity system thus provides the ability to efficiently connect dynamic networks in a way that facilitates the routing of data to between nodes in the communication network. |
| FILED | Monday, September 09, 2002 |
| APPL NO | 10/238171 |
| ART UNIT | 2154 — Data Bases & File Management |
| CURRENT CPC | Electrical computers and digital processing systems: Multicomputer data transferring 79/226 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225343 | Honig et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Trustees of Columbia University in the City of New York (New York, New York) |
| INVENTOR(S) | Andrew Honig (East Windsor, New Jersey); Andrew Howard (Lansdale, Pennsylvania); Eleazar Eskin (Santa Monica, California); Salvatore J. Stolfo (Ridgewood, New Jersey) |
| ABSTRACT | A system and methods for detecting intrusions in the operation of a computer system comprises a sensor configured to gather information regarding the operation of the computer system, to format the information in a data record having a predetermined format, and to transmit the data in the predetermined data format. A data warehouse is configured to receive the data record from the sensor in the predetermined data format and to store the data in a database. A detection model generator is configured to request data records from the data warehouse in the predetermined data format, to generate an intrusion detection model based on said data records, and to transmit the intrusion detection model to the data warehouse according to the predetermined data format. A detector is configured to receive a data record in the predetermined data format from the sensor and to classify the data record in real-time as one of normal operation and an attack based on said intrusion detection model. A data analysis engine is configured to request data records from the data warehouse according to the predetermined data format and to perform a data processing function on the data records. |
| FILED | Monday, January 27, 2003 |
| APPL NO | 10/352342 |
| ART UNIT | 2132 — Memory Access and Control |
| CURRENT CPC | Electrical computers and digital processing systems: Support 713/194 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225420 | Cress |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Honeywell International Inc. (Morristown, New Jersey) |
| INVENTOR(S) | David S. Cress (Plymouth, Minnesota) |
| ABSTRACT | A system and method are disclosed for measuring signal crosstalk in an electronic circuit device or Integrated Circuit (IC) device, correlating the results with modeled information, and accurately identifying one or more levels of coupling noise in the device. For example, a system is disclosed that provides data on levels of crosstalk between conductive lines in a device. The system uses programmable victim and aggressor lines, programmable drive capability, and programmable loading through one or more known crosstalk structures to compare an output signal with a reference signal and accurately identify one or more levels of coupling noise in the device. |
| FILED | Thursday, February 10, 2005 |
| APPL NO | 11/054806 |
| ART UNIT | 2825 — Semiconductors/Memory |
| CURRENT CPC | Computer-aided design and analysis of circuits and semiconductor masks 716/6 |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Science Foundation (NSF)
| US 07223327 | Schlenoff et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Florida State University Research Foundation, Inc. (Tallahassee, Florida) |
| INVENTOR(S) | Joseph B. Schlenoff (Tallahassee, Florida); Stephen T. Dubas (Marseilles, France) |
| ABSTRACT | A releaseable membrane structure for producing a free membrane containing a substrate, a release stratum on the substrate and a membrane stratum on the release stratum. The release stratum and the membrane stratum contain oppositely-charged polyelectrolytes that are associated. The oppositely-charged polyelectrolytes of the release stratum are selected to dissociate upon application of stimulus whereas those of the membrane stratum are selected to remain associated upon application of the stimulus. Thus, when the stimulus is applied the polyelectrolytes in release stratum dissociate and the membrane stratum is released from the substrate and is a free membrane. |
| FILED | Tuesday, April 16, 2002 |
| APPL NO | 10/475236 |
| ART UNIT | 1746 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemistry: Electrical and wave energy 24/633 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223359 | Torkelson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | John Torkelson (Skokle, Illinois); Andrew Lebovitz (Des Plaines, Illinois); Kosmas Kasimatis (Chicago, Illinois); Klementina Khait (Skokle, Illinois) |
| ABSTRACT | A method of producing a polymer-clay nanocomposite comprises providing a supply of polymer-clay mixture, exfoliating the mixture through solid-state shear pulverization in the presence of cooling sufficient to maintain the extruded mixture in the solid state during the pulverization, and discharging the resulting exfoliated mixture. The invention is also directed to a method of producing a polymer hybrid nanocomposite, wherein a component is dispersed throughout a polymer matrix by solid-state shear pulverization of a polymer mixed with the second component. |
| FILED | Wednesday, November 05, 2003 |
| APPL NO | 10/701067 |
| ART UNIT | 1714 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Plastic and nonmetallic article shaping or treating: Processes 264/211.210 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223432 | Cholli et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | University of Massachusettes Lowell (Lowell, Massachusetts); United States of America, as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Ashok L. Cholli (Chelmsford, Massachusetts); Vijayendra Kumar (Lowell, Massachusetts); Jayant Kumar (Westford, Massachusetts); Virinder Singh Parmar (Lowell, Massachusetts); Lynne Ann Samuelson (Marlborough, Massachusetts); Ferdinando F. Bruno (Andover, Massachusetts) |
| ABSTRACT | Antioxidant polymers of the present invention comprise repeat units that include one or both of Structural Formulas (I) and (II): wherein: R is —H or a substituted or unsubstituted alkyl, acyl or aryl group; Ring A is substituted with at least one tert-butyl group or substituted or unsubstituted n-alkoxycarbonyl group; Ring B is substituted with at least one —H and at least one tert-butyl group or substituted or unsubstituted n-alkoxycarbonyl group; Rings A and B are each optionally substituted with one or more groups selected from the group consisting of —OH, —NH, —SH, a substituted or unsubstituted alkyl or aryl group, and a substituted or unsubstituted alkoxycarbonyl group; n is an integer equal to or greater than 2; and p is an integer equal to or greater than 0. The invention also includes methods of using and preparing these polymers. |
| FILED | Friday, April 04, 2003 |
| APPL NO | 10/408679 |
| ART UNIT | 1761 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Food or edible material: Processes, compositions, and products 426/541 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223438 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Lei Fu (Evanston, Illinois); Xiaogang Liu (Evanston, Illinois); Vinayak P. Dravid (Glenview, Illinois) |
| ABSTRACT | A direct-write method for fabricating magnetic nanostructures, including hard magnetic nanostructures of barium hexaferrite, BaFe, based on nanolithographic printing and a sol-gel process. This method utilizes a conventional atomic force microscope tip, coated with a magnetic material precursor solution, to generate patterns that can be post-treated at elevated temperature to generate magnetic features consisting of barium ferrite in its hexagonal magnetoplumbite (M-type) structure. Features ranging from several hundred nm down to below 100 nm were generated and studied using AFM, magnetic force microscopy, and X-ray photoelectron spectroscopy. The approach offers a new way for patterning functional inorganic magnetic nanostructures with deliberate control over feature size and shape, as well as interfeature distance and location. |
| FILED | Wednesday, September 17, 2003 |
| APPL NO | 10/663976 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Coating processes 427/127 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223544 | Luo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Cornell Research Foundation, Inc. (Ithaca, New York) |
| INVENTOR(S) | Dan Luo (Ithaca, New York); Yougen Li (Ithaca, New York) |
| ABSTRACT | The present invention relates to the design and use of nucleic acid molecules to create novel materials. The present invention further relates to the use of DNA as a bulding block for DNA-materials that are of high yield and purity and that can be incorporated into larger structures. |
| FILED | Friday, June 25, 2004 |
| APPL NO | 10/877697 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/6 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223567 | Ka-Yiu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Rice University (Houston, Texas) |
| INVENTOR(S) | San Ka-Yiu (Houston, Texas); George N. Bennett (Houston, Texas); Ailen Sanchez (Houston, Texas) |
| ABSTRACT | The invention relates to a mutant strain of bacteria, which either lacks or contains mutant genes for several key metabolic enzymes, and which produces high amounts of succinic acid under anaerobic conditions. |
| FILED | Monday, August 29, 2005 |
| APPL NO | 11/214309 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/71.200 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223571 | DeAngelis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Board of Regents of the Universtiy of Oklahoma (Norman, Oklahoma) |
| INVENTOR(S) | Paul L. DeAngelis (Edmond, Oklahoma); Wei Jing (Edmond, Oklahoma) |
| ABSTRACT | The present invention relates to methodology for polymer grafting by a polysaccharide synthase and, more particularly, polymer grafting using the hyaluronate or chondroitin or heparin/heparosan synthases from Pasteurella, in order to create a variety of glycosaminoglycan oligosaccharides having a natural or chimeric or hybrid sugar structure with a targeted size that are substantially monodisperse in size. |
| FILED | Friday, August 15, 2003 |
| APPL NO | 10/642248 |
| ART UNIT | 1656 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/97 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223588 | Liao |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Texas A and M University System (College Station, Texas) |
| INVENTOR(S) | James C. Liao (Los Angeles, California) |
| ABSTRACT | Genetic elements comprising expression vectors and a gene coding for phosphoenol pyruvate synthase is utilized to enhance diversion of carbon resources into the common aromatic pathway and pathways branching therefrom. The overexpression of phosphoenol pyruvate synthase increases DAHP production to near theoretical yields. |
| FILED | Thursday, November 07, 2002 |
| APPL NO | 10/289788 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/252.330 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223879 | Buchwald et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Stephen L. Buchwald (Newton, Massachusetts); Xiaohua Huang (Cambridge, Massachusetts); Danilo Zim (Campinas, Brazil) |
| ABSTRACT | One aspect of the present invention relates to ligands for transition metals. A second aspect of the present invention relates to the use of catalysts comprising these ligands in transition metal-catalyzed carbon-heteroatom and carbon-carbon bond-forming reactions. The subject methods provide improvements in many features of the transition metal-catalyzed reactions, including the range of suitable substrates, reaction conditions, and efficiency. |
| FILED | Tuesday, December 09, 2003 |
| APPL NO | 10/731702 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Organic compounds 556/13 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224744 | Giannakis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Regents of the University of Minnesota (Minneapolis, Minnesota) |
| INVENTOR(S) | Georgios B. Giannakis (Minnetonka, Minnesota); Xiaoli Ma (St. Paul, Minnesota) |
| ABSTRACT | Space-time multipath (STM) coding techniques are described for frequency-selective channels, respectively. The described STM coded system guarantees full space-multipath diversity, and achieves large coding gains with high bandwidth efficiency. The techniques utilize a linearly coding technique, and incorporates subchannel grouping for application of the linear coding techniques. As a result, the techniques enable desirable tradeoffs between performance and complexity. |
| FILED | Monday, April 21, 2003 |
| APPL NO | 10/420352 |
| ART UNIT | 2611 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Pulse or digital communications 375/267 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224868 | Watts et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Michael R. Watts (Hingham, Massachusetts); Steven G. Johnson (St. Charles, Illinois); Hermann A. Haus (Lexington, Massachusetts); John D. Joannopoulos (Belmont, Massachusetts) |
| ABSTRACT | The present invention provides a micro-resonator including a plurality of waveguides forming optic junctions therebetween, with adjacent waveguides having different core permittivities and different cladding permittivities. Adjacent waveguides are mode-matched through adjustments of the core permittivities and the cladding permittivities of the waveguides to reduce or eliminate junction radiation, thereby providing high performance. |
| FILED | Thursday, October 24, 2002 |
| APPL NO | 10/279777 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Optical waveguides 385/39 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224878 | Wessels et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Bruce W. Wessels (Evanston, Illinois); Pingsheng Tang (Medford, Oregon); David J. Towner (Portland, Oregon); Anthony L. Meier (Chicago, Illinois) |
| ABSTRACT | Electro-optic modulator devices and related waveguide components comprising BaTiO3 films. |
| FILED | Monday, November 14, 2005 |
| APPL NO | 11/273152 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical waveguides 385/130 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225129 | Massaro et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Dominic W. Massaro (Santa Cruz, California); Michael M. Cohen (Santa Cruz, California); Jonas Beskow (Stockholm, Sweden) |
| ABSTRACT | A method of modeling speech distinctions within computer-animated talking heads that utilize the manipulation of speech production articulators for selected speech segments. Graphical representations of voice characteristics and speech production characteristics are generated in response to said speech segment. By way of example, breath images are generated such as particle-cloud images, and particle-stream images to represent the voiced characteristics such as the presence of stops and fricatives, respectively. The coloring on exterior portions of the talking head is displayed in response to selected voice characteristics such as nasality. The external physiology of the talking head is modulated, such as by changing the width and movement of the nose, the position of the eyebrows, and movement of the throat in response to the voiced speech characteristics such as pitch, nasality, and voicebox vibration, respectively. The invention also describes modeling a talking head on the facial image of a particular individual. |
| FILED | Thursday, September 20, 2001 |
| APPL NO | 09/960248 |
| ART UNIT | 2626 — Selective Visual Display Systems |
| CURRENT CPC | Data processing: Speech signal processing, linguistics, language translation, and audio compression/decompression 74/261 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07225217 | Willson, Jr. et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Alan N. Willson, Jr. (Pasadena, California); Zhan Yu (Sunnyvale, California); Larry S. Wasserman (Grenada Hills, California) |
| ABSTRACT | An enhanced Booth-encoded adder-array multiplier where the low transition probability partial-products are generated and the adder array has been reorganized to reduce power dissipation when the Booth-encoded input has a large dynamic range. The architecture does not require extra circuits or routing overhead. Power dissipation is reduced by ordering the sequence of partial-product additions such that an increasing sequence of “transition probabilities” is encountered. |
| FILED | Wednesday, October 09, 2002 |
| APPL NO | 10/268602 |
| ART UNIT | 2193 — Interprocess Communication and Software Development |
| CURRENT CPC | Electrical computers: Arithmetic processing and calculating 78/630 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Energy (DOE)
| US 07222406 | Chou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Battelle Memorial Institute (Richland, Washington) |
| INVENTOR(S) | Yeong-Shyung Chou (Richland, Washington); Kerry D. Meinhardt (Kennewick, Washington); Jeffry W. Stevenson (Richland, Washington) |
| ABSTRACT | Multi-layer seals are provided that find advantageous use for reducing leakage of gases between adjacent components of electrochemical devices. Multi-layer seals of the invention include a gasket body defining first and second opposing surfaces and a compliant interlayer positioned adjacent each of the first and second surfaces. Also provided are methods for making and using the multi-layer seals, and electrochemical devices including said seals. |
| FILED | Friday, April 26, 2002 |
| APPL NO | 10/134072 |
| ART UNIT | 3726 — Manufacturing Devices & Processes, Machine Tools & Hand Tools Group Art Units |
| CURRENT CPC | Metal working 029/434 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07222647 | Bingham et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Battelle Energy Alliance, LLC (Idaho Falls, Idaho) |
| INVENTOR(S) | Dennis A. Bingham (Idaho Falls, Idaho); Michael L. Clark (Menan, Idaho); Bruce M. Wilding (Idaho Falls, Idaho); Gary L. Palmer (Shelley, Idaho) |
| ABSTRACT | A fueling facility and method for dispensing liquid natural gas (LNG), compressed natural gas (CNG) or both on-demand. The fueling facility may include a source of LNG, such as cryogenic storage vessel. A low volume high pressure pump is coupled to the source of LNG to produce a stream of pressurized LNG. The stream of pressurized LNG may be selectively directed through an LNG flow path or to a CNG flow path which includes a vaporizer configured to produce CNG from the pressurized LNG. A portion of the CNG may be drawn from the CNG flow path and introduced into the CNG flow path to control the temperature of LNG flowing therethrough. Similarly, a portion of the LNG may be drawn from the LNG flow path and introduced into the CNG flow path to control the temperature of CNG flowing therethrough. |
| FILED | Wednesday, February 02, 2005 |
| APPL NO | 11/050032 |
| ART UNIT | 3771 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Fluent material handling, with receiver or receiver coacting means 141/82 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07222969 | Veligdan |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Brookhaven Science Associates (Upton, New York) |
| INVENTOR(S) | James T. Veligdan (Manorville, New York) |
| ABSTRACT | A video image is displayed from an optical panel by splitting the image into a plurality of image components, and then projecting the image components through corresponding portions of the panel to collectively form the image. Depth of the display is correspondingly reduced. |
| FILED | Friday, May 27, 2005 |
| APPL NO | 11/139243 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Optics: Image projectors 353/37 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223474 | Shelnutt et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Sandia Corporation (Albuquerque, New Mexico) |
| INVENTOR(S) | John A. Shelnutt (Tijeras, New Mexico); Craig J. Medforth (Winters, California); Zhongchun Wang (Albuquerque, New Mexico) |
| ABSTRACT | Heteroporphyrin nanotubes, metal nanostructures, and metal/porphyrin-nanotube composite nanostructures formed using the nanotubes as photocatalysts and structural templates, and the methods for forming the nanotubes and composites. |
| FILED | Thursday, May 25, 2006 |
| APPL NO | 11/440484 |
| ART UNIT | 1773 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Stock material or miscellaneous articles 428/403 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223575 | Zhang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Midwest Research Institute (Kansas City, Missouri) |
| INVENTOR(S) | Min Zhang (Lakewood, Colorado); Yat-Chen Chou (Golden, Colorado); William Howe (Golden, Colorado); Christine Eddy (Golden, Colorado); Kent Evans (Littleton, Colorado); Ali Mohagheghi (Northglenn, Colorado) |
| ABSTRACT | Disclosed in the present invention is a Zymomonas integrant and derivatives of these integrants that posses the ability to ferment pentose into ethanol. The genetic sequences encoding for the pentose-fermenting enzymes are integrated into the Zymomonas in a two-integration event of homologous recombination and transposition. Each operon includes more than one pentose-reducing enzyme encoding sequence. The integrant in some embodiments includes enzyme sequences encoding xylose isomerase, xylulokinase, transketolase and transketolase. The Zymomonas integrants are highly stable, and retain activity for producing the pentose-fermenting enzyme for between 80 to 160 generations. The integrants are also resistant to acetate inhibition, as the integrants demonstrate efficient ethanol production even in the presence of 8 up to 16 grams acetate per liter media. These stably integrated sequences provide a unique Zymomonas that may then be used for the efficient conversion of pentose sugars (xylose, arabinose) to ethanol. Method of using the Zymomonas integrants and derivatives thereof in production of ethanol from cellulosic feedstock is also disclosed. The invention also provides a method for preparing a Zymomonas integrant as part of the present invention. The host Zymomonas strain found particularly useful in the creation of these compositions and methods is Zymomonas mobilis 31821. |
| FILED | Saturday, April 27, 2002 |
| APPL NO | 10/134655 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/161 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223608 | Gopalsami et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | U Chicago Argonne LLC (Chicago, Illinois) |
| INVENTOR(S) | Nachappa Gopalsami (Naperville, Illinois); Apostolos C. Raptis (Downers Grove, Illinois) |
| ABSTRACT | A dielectric sensing method and apparatus are provided for detection and classification of chemical and biological materials. Resonance patterns of a sample within a resonator are detected for identifying a shift in resonance frequency and a change of line width before and after introduction of the sample. The identified shift in resonance frequency and change of line width are used for determining a complex dielectric constant of the sample for the material detection and classification. A degree of selectivity at any excitation frequency is enabled for the dielectric sensing method from the manner in which the complex dielectric constant of a material affects the resonance pattern of the resonator with respect to shift in resonance frequency and the change in line width. By selecting the excitation frequencies to generally correspond to one of the resonance frequencies of the sample material under test, the degree of selectivity and the sensitivity of detection are enhanced. |
| FILED | Friday, August 08, 2003 |
| APPL NO | 10/637127 |
| ART UNIT | 1743 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemistry: Analytical and immunological testing 436/149 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223713 | Alonso et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas); Centro de Investigacion en Materiales Avanzados, S.C. (Chihuahua, Mexico) |
| INVENTOR(S) | Gabriel Alonso (Chihuahua, Mexico); Russell R. Chianelli (El Paso, Texas); Sergio Fuentes (Ensenada, Mexico); Brenda Torres (El Paso, Texas) |
| ABSTRACT | The present invention provides methods of synthesizing molybdenum disulfide (MoS2) and carbon-containing molybdenum disulfide (MoS2-xCx) catalysts that exhibit improved catalytic activity for hydrotreating reactions involving hydrodesulfurization, hydrodenitrogenation, and hydrogenation. The present invention also concerns the resulting catalysts. Furthermore, the invention concerns the promotion of these catalysts with Co, Ni, Fe, and/or Ru sulfides to create catalysts with greater activity, for hydrotreating reactions, than conventional catalysts such as cobalt molybdate on alumina support. |
| FILED | Wednesday, April 07, 2004 |
| APPL NO | 10/819893 |
| ART UNIT | 1755 — Semiconductors/Memory |
| CURRENT CPC | Catalyst, solid sorbent, or support therefor: Product or process of making 52/177 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223726 | Oda et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Michael N. Oda (Benicia, California); Trudy M. Forte (Berkeley, California) |
| ABSTRACT | Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization. |
| FILED | Tuesday, January 14, 2003 |
| APPL NO | 10/342965 |
| ART UNIT | 1654 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/2 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224041 | Sherohman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | John W. Sherohman (Livermore, California); Arthur W. Coombs, III (Patterson, California); Jick Hong Yee (Livermore, California); Kuang Jen J. Wu (Cupertino, California) |
| ABSTRACT | For the first time, an aluminum antimonide (AlSb) single crystal substrate is utilized to lattice-match to overlying semiconductor layers. The AlSb substrate establishes a new design and fabrication approach to construct high-speed, low-power electronic devices while establishing inter-device isolation. Such lattice matching between the substrate and overlying semiconductor layers minimizes the formation of defects, such as threaded dislocations, which can decrease the production yield and operational life-time of 6.1-Å family heterostructure devices. |
| FILED | Friday, May 28, 2004 |
| APPL NO | 10/856175 |
| ART UNIT | 2811 — Semiconductors/Memory |
| CURRENT CPC | Active solid-state devices 257/613 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224288 | Hall et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | IntelliServ, Inc. (Provo, Utah) |
| INVENTOR(S) | David R. Hall (Provo, Utah); Joe Fox (Provo, Utah) |
| ABSTRACT | A repeater is disclosed in one embodiment of the present invention as including a cylindrical housing, characterized by a proximal end and a distal end, and having a substantially cylindrical wall, the cylindrical wall defining a central bore passing therethrough. The cylindrical housing is formed to define at least one recess in the cylindrical wall, into which a repeater is inserted. The cylindrical housing also includes an annular recess formed into at least one of the proximal end and the distal end. An annular transmission element, operably connected to the repeater, is located in the annular recess. In selected embodiments, the annular transmission element inductively converts electrical energy to magnetic energy. In other embodiments, the annular transmission element includes an electrical contact to transmit electrical energy directly to another contact. |
| FILED | Wednesday, July 02, 2003 |
| APPL NO | 10/613549 |
| ART UNIT | 2612 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Communications: Electrical 340/853.700 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224475 | Robertson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Battelle Energy Alliance, LLC (Idaho Falls, Idaho) |
| INVENTOR(S) | Eric P Robertson (Idaho Falls, Idaho); Richard L. Christiansen (Littleton, Colorado) |
| ABSTRACT | A method of optically determining a change in magnitude of at least one dimensional characteristic of a sample in response to a selected chamber environment. A magnitude of at least one dimension of the at least one sample may be optically determined subsequent to altering the at least one environmental condition within the chamber. A maximum change in dimension of the at least one sample may be predicted. A dimensional measurement apparatus for indicating a change in at least one dimension of at least one sample. The dimensional measurement apparatus may include a housing with a chamber configured for accommodating pressure changes and an optical perception device for measuring a dimension of at least one sample disposed in the chamber. Methods of simulating injection of a gas into a subterranean formation, injecting gas into a subterranean formation, and producing methane from a coal bed are also disclosed. |
| FILED | Thursday, April 29, 2004 |
| APPL NO | 10/835761 |
| ART UNIT | 2856 — Printing/Measuring and Testing |
| CURRENT CPC | Optics: Measuring and testing 356/625 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224905 | Ruggiero |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Anthony J. Ruggiero (Livermore, California) |
| ABSTRACT | A system and method of remotely extracting information from a communications station by interrogation with a low power beam. Nonlinear phase conjugation of the low power beam results in a high power encoded return beam that automatically tracks the input beam and is corrected for atmospheric distortion. Intracavity nondegenerate four wave mixing is used in a broad area semiconductor laser in the communications station to produce the return beam. |
| FILED | Friday, April 06, 2001 |
| APPL NO | 09/827454 |
| ART UNIT | 2613 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Optical communications 398/170 |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Aeronautics and Space Administration (NASA)
| US 07223366 | Hauan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Carnegie Mellon University (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Steinar Hauan (Pittsburgh, Pennsylvania); John J. Neumann, Jr. (Pittsburgh, Pennsylvania); Todd M. Przybycien (Pittsburgh, Pennsylvania); Michael Bartkovsky (Peckville, Pennsylvania); Kaigham J. Gabriel (Pittsburgh, Pennsylvania) |
| ABSTRACT | A micro-electro-mechanical system (MEMS) device is described having a membrane which can be induced to resonate and the frequency of its resonance can be monitored. Chemical moieties can be attached to the membrane, and these moieties can be selected such that they have an affinity for molecules of interest, especially biological molecules of interest. When molecules of interest bind to the moieties they increase the mass of the membrane and thereby change the frequency of the membrane's resonance. By monitoring the resonance one can obtain an indication of the presence of the molecules of interest and in some circumstances an indication of the approximate concentration of these molecules. In addition, several types of moieties having affinities for several different molecules of interest can be placed on the membrane in such a way that the sensor can detect the presence of several different types of molecules of interest and distinguish which ones may be present and which ones may be absent. |
| FILED | Thursday, November 06, 2003 |
| APPL NO | 10/702709 |
| ART UNIT | 1743 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemical apparatus and process disinfecting, deodorizing, preserving, or sterilizing 422/68.100 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224464 | Manning |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | |
| INVENTOR(S) | Christopher J. Manning (Troy, Idaho) |
| ABSTRACT | A novel tilt-compensated interferometer geometry is described. The design uses tilt- and shear-compensation optics to simultaneously maintain high throughput and precise interferometric alignment, even in the presence of non-ideal scanning motions. The tilt-compensation mechanism consists of a novel beamsplitter/reflector assembly that produces two anti-parallel beams. A variety of enhancements to the basic design are described, providing a family of related interferometer designs. These interferometers have applications in spectrometry, spectral imaging and metrology. |
| FILED | Thursday, August 02, 2001 |
| APPL NO | 09/922363 |
| ART UNIT | 2877 — Optics |
| CURRENT CPC | Optics: Measuring and testing 356/451 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224772 | Jacobs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | University of Florida Research Foundation, Inc. (Gainesville, Florida) |
| INVENTOR(S) | Alan M. Jacobs (Gainesville, Florida); Edward T. Dugan (Gainesville, Florida); Daniel Shedlock (Gainesville, Florida) |
| ABSTRACT | A reconfigurable collimated radiation detector, system and related method includes at least one collimated radiation detector. The detector has an adjustable collimator assembly including at least one feature, such as a fin, optically coupled thereto. Adjustments to the adjustable collimator selects particular directions of travel of scattered radiation emitted from an irradiated object which reach the detector. The collimated detector is preferably a collimated detector array, where the collimators are independently adjustable. The independent motion capability provides the capability to focus the image by selection of the desired scatter field components. When an array of reconfigurable collimated detectors is provided, separate image data can be obtained from each of the detectors and the respective images cross-correlated and combined to form an enhanced image. |
| FILED | Tuesday, July 20, 2004 |
| APPL NO | 10/896243 |
| ART UNIT | 2882 — Optics |
| CURRENT CPC | X-ray or gamma ray systems or devices 378/150 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Agriculture (USDA)
| US 07223567 | Ka-Yiu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Rice University (Houston, Texas) |
| INVENTOR(S) | San Ka-Yiu (Houston, Texas); George N. Bennett (Houston, Texas); Ailen Sanchez (Houston, Texas) |
| ABSTRACT | The invention relates to a mutant strain of bacteria, which either lacks or contains mutant genes for several key metabolic enzymes, and which produces high amounts of succinic acid under anaerobic conditions. |
| FILED | Monday, August 29, 2005 |
| APPL NO | 11/214309 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/71.200 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07223901 | MacKenzie et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Sally MacKenzie (Lincoln, Nebraska); Zarir Vaghchhipawala (Ardmore, Oklahoma) |
| ABSTRACT | The subject invention relates to nematode responsive domains obtained from soybean promoters for phosphoribosylformylglycinamidine ribonucleotide (FGAM) synthase paralogs. The nematode responsive domains can be used in promoters that are linked to heterologous DNA. Such constructs can be expressed in transfected or transformed soybean and used in the control of nematode infection of soybean. |
| FILED | Monday, March 28, 2005 |
| APPL NO | 11/091668 |
| ART UNIT | 1638 — Organic Chemistry |
| CURRENT CPC | Multicellular living organisms and unmodified parts thereof and related processes 8/279 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Commerce (DOC)
| US 07223488 | Huang |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Plug Power Inc. (Latham, New York) |
| INVENTOR(S) | Wayne W. Huang (Latham, New York) |
| ABSTRACT | A simplified PEM fuel cell system is integrated with a fuel processor and an exhaust gas oxidizer to ensure clean emissions. The fuel cell has an operating temperature of 100–200° C., and utilizes reformate fuel having a carbon monoxide level greater than 1000 parts per million. |
| FILED | Tuesday, May 04, 2004 |
| APPL NO | 10/838559 |
| ART UNIT | 1745 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Chemistry: Electrical current producing apparatus, product, and process 429/17 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224035 | Skidmore et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Zyvex Corporation (Richardson, Texas) |
| INVENTOR(S) | George D. Skidmore (Plano, Texas); Gregory A. Magel (Dallas, Texas); Charles G. Roberts (McKinney, Texas) |
| ABSTRACT | Fabricating electrical isolation properties into a MEMS device is described. One embodiment comprises a main substrate layer of a high-resistivity semiconductor material, such as high-resistivity silicon. The high-resistivity substrate is then controllably doped to provide a region of high-conductivity in the main substrate. Electrical isolation is achieved in such an embodiment by patterning the high-conductivity region either by masking the main substrate during the doping or etching through the doped, high-conductivity region in order to form regions of high conductivity. Effective isolation results from confinement of electrical currents to the lowest-resistance path. An alternative embodiment employs the fabrication of pn junctions and the use of reverse biasing to enhance the electrical isolation. A further embodiment comprises a main substrate layer of low-resistivity semiconductor material with a layer of insulator deposited thereon. High-conductivity or low-resistivity material is then grown on top of the insulator to create electrically isolated conductors. |
| FILED | Monday, October 07, 2002 |
| APPL NO | 10/266724 |
| ART UNIT | 2826 — Semiconductors/Memory |
| CURRENT CPC | Active solid-state devices 257/414 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Non-Profit Organization (NPO)
| US 07223588 | Liao |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | The Texas A and M University System (College Station, Texas) |
| INVENTOR(S) | James C. Liao (Los Angeles, California) |
| ABSTRACT | Genetic elements comprising expression vectors and a gene coding for phosphoenol pyruvate synthase is utilized to enhance diversion of carbon resources into the common aromatic pathway and pathways branching therefrom. The overexpression of phosphoenol pyruvate synthase increases DAHP production to near theoretical yields. |
| FILED | Thursday, November 07, 2002 |
| APPL NO | 10/289788 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Chemistry: Molecular biology and microbiology 435/252.330 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Small Business Administration (SBA)
| US 07223228 | Timm et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | GT Urological, LLC (Minneapolis, Minnesota) |
| INVENTOR(S) | Gerald W. Timm (Minneapolis, Minnesota); David W. Anderson (Brooklyn Park, Minnesota) |
| ABSTRACT | A urethral occlusive assembly includes an implant component and external component. The implant component includes a flexible bridge member connecting two opposed implant supports. The implant component is implanted about a dorsal surface of an animal urethra. An external component is disposed external to and proximate the animal urethra. The external component operatively communicates with the implant component to transmit a compressive load on the urethra. By communication between the implant and external components, either the implant component or the external component actively compresses the urethra against the flexible bridge member, thereby effecting urinary continence. |
| FILED | Thursday, May 05, 2005 |
| APPL NO | 11/122827 |
| ART UNIT | 3735 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Surgery 6/30 |
| VIEW PATENT | @ USPTO: Full Text PDF |
U.S. State Government
| US 07223747 | Pettit et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Arizona Board of Regents Acting for and on Behalf of Arizona State University (Tempe, Arizona) |
| INVENTOR(S) | George R. Pettit (Paradise Valley, Arizona); Mathew D. Minardi (Mather, California); Heidi J. Rosenberg (Tempe, Arizona) |
| ABSTRACT | The invention relates to novel compounds denominated halocombstatins. The halocombstatins are derivatives of combretastatin A-3, and include compounds that exhibit cancer growth cell inhibition against a panel of human cancer cell lines and the murine P388 leukemia, as well as activity as inhibitors of tubulin polymerization and inhibitors of the binding of colchicine to tubulin. |
| FILED | Friday, September 24, 2004 |
| APPL NO | 10/948926 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Drug, bio-affecting and body treating compositions 514/145 |
| VIEW PATENT | @ USPTO: Full Text PDF |
Government Rights Acknowledged
| US 07223846 | Vale, Jr. et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Research Development Foundation (Carson City, Nevada) |
| INVENTOR(S) | Wylie Walker Vale, Jr. (La Jolla, California); Teresa M Reyes (Encinitas, California); Paul E Sawchenko (Carlsbad, California); Jean E F Rivier (La Jolla, California); Kathy A Lewis (San Diego, California); John B Hogenesch (Encinitas, California); Joan M Vaughan (San Diego, California); Marilyn H Perrin (La Jolla, California) |
| ABSTRACT | A human urocortin-related peptide with significant sequence homology to the CRF neuropeptide family was identified. A mouse cDNA was isolated from whole brain poly (A+) RNA that encodes a predicted 38 amino acid peptide protein designated herein as urocortin II. Both human URP and mouse Ucn II are structurally related to the other known mammalian family members, CRF and urocortin (Ucn). These peptides are involved in the regulation of the hypothalamic-pituitary-adrenal axis under basal and stress conditions, suggesting a similar role for URP and Ucn II. Synthesized Ucn-II and URP peptide binds with higher affinity to CRF-R2 than to CRF-R1 Ucn II and human URP appear to be involved in the regulation of body temperature and appetite and may play a role in other stress related phenomenon. These findings identify Ucn II and human URP as a new members of the CRF family of neuropeptides, which are expressed centrally and bind to CRF-R2. |
| FILED | Monday, October 25, 2004 |
| APPL NO | 10/973092 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemistry: Natural resins or derivatives; peptides or proteins; lignins or reaction products thereof 530/399 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224743 | Holmes et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | Northrop Grumman Corporation (Los Angeles, California) |
| INVENTOR(S) | Michael J. Holmes (Long Beach, California); Scott W. Enserink (Long Beach, California); Jeffrey P. Long (Woburn, Massachusetts) |
| ABSTRACT | A method and apparatus for decoding trellis-coded digital data. Digital data samples that have been convolutionally encoded by trellis-coded modulation (TCM) for purposes of forward error correction require a computationally intensive Viterbi decoder for best performance. A technique known as pragmatic trellis-code modulation (PTCM) reduces decoder complexity but at the expense of degraded performance in some situations. This disclosure provides a solution that retains the reduced complexity of PTCM, but uses a full trellis approach that yields significantly better performance in terms of bit error rate (BER). |
| FILED | Thursday, April 24, 2003 |
| APPL NO | 10/422083 |
| ART UNIT | 2611 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Pulse or digital communications 375/265 |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 07224757 | Capofreddi |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | |
| ASSIGNEE(S) | HRL Laboratories, LLC (Malibu, California) |
| INVENTOR(S) | Peter D. Capofreddi (San Francisco, California) |
| ABSTRACT | A delta-sigma modulator that provides improved SNR performance in applications such as low-power mobile wireless communications and high frequency radar applications is disclosed. Multiple comparators 10, each comprising a sequence of three latches 20, 22, 24, connect the modulator's input filter circuit 12 to the modulator's output interfaces 14, providing quantization of the integrated, filtered signal provided by the filter circuit 12. A clock signal having a cycle period Tc enables a first latch 20 connected to the signal input of each comparator 10 to provide a digital signal to the signal input of a second latch 22. The second latch 22 supplies a digital signal to a third latch 24 in the sequence, in response to the signal received from the first latch 20, by a lagged clock signal derived from the given clock signal Tc by providing a first lag time TL where Tc/2≧TL>0. A third latch in the sequence is enabled by a clock signal having a second lag time TS=Tc/2+TE, and the delay TE<<Tc/2. When TL=Tc/2 the inverted clock signal supplied to the second latch is delayed and supplied to the third latch. When TL=TE the delayed clock signal supplied to the second latch is inverted and supplied to the third latch. |
| FILED | Wednesday, March 12, 2003 |
| APPL NO | 10/387330 |
| ART UNIT | 2611 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Pulse or digital communications 375/354 |
| VIEW PATENT | @ USPTO: Full Text PDF |
How To Use This Page
THE FEDINVENT PATENT DETAILS PAGE
Each week, FedInvent analyzes newly granted patents and published patent applications whose origins lead back to funding by the US Federal Government. The FedInvent Patent Details page is a companion to the weekly FedInvents Patents Report.
This week's information is published in the FedInvent Patents report for Tuesday, May 29, 2007.
The FedInvent Weekly Patent Details Page contains a subset of patent information to provide a deeper dive into the week’s taxpayer-funded patents to help the reader better understand where a patent fits in the federal innovation ecosphere.
HOW IS THE INFORMATION ORGANIZED?
Patents are organized by the funding agency. Within each group, the patents are organized in numeric order. A patent funded by more than one agency will appear in the section of each of the agencies that funded the research and development that resulted in the invention. This approach gives the reader a complete view of the department or agency activity for the week.
WHAT INFORMATION WILL I FIND?
THE PANEL
There is a panel for each patent that contains the patent number and the title of the patent. When you click the panel, it opens to reveal the following information:
FUNDED BY
The agencies that funded the grants, contracts, or other research agreements that resulted in the patent. FedInvent includes as much information on the source of the funding as possible. The information is presented in a hierarchy going from the Federal Department down to the agencies, subagencies, and offices that funded the work. Here are two examples:
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Army Research Office (ARO)
We do our best to provide detailed information about the funding. In some cases, the patent only reports limited information on the origins of the funding. FedInvents presents what it can confirm. We add the patents without the information required by the Bayh-Dole Act to our list of patents worthy of further investigation.
APPLICANT(S) and ASSIGNEES
FedInvent includes both the Applicants and the Assignees because having both provides more information about where the inventive work was done and by what organizations. Many organizations — universities, corporations, and federal agencies — standardize the Assignee/Owner information by the time a patent is granted. In the case of federal patents, many of the patents use the agency headquarters information for patent assignment.
Showing just the headquarters address would make Washington, DC the epicenter of all taxpayer-funded research and development. Providing both the applicant information and the assignee information provides a more accurate picture of where important taxpayer funded innovation is happening in America. Here are two examples from two different patents:
APPLICANT: U.S. Army Research Laboratory, Adelphi, MD
ASSIGNEE: The United States of America as represented by the Secretary of the Army Washington, DC
APPLICANT: Optech Ventures, LLC (Torrance, California)
ASSIGNEE(S): The Regents of the University of California (Oakland, California); Optech Ventures, LLC (Torrance, California)
INVENTOR(S)
The inventors appear in the same order as they appear on the patent. FedInvents presents the names in first name/last name order because they are easier to read than the last name/first name order of the names on the USPTO patent documents.
ABSTRACT
The abstract as it appears on the patent.
FILED
The date of the patent application including the day of the week.
APPL NO
This is the patent application serial number. If you’d like to learn more about how application serial numbers work you can go to the Lists Page.
ART UNIT
Patent data includes the Art Unit where a patent was examined. (The Art Unit isn’t available for published patent applications.) The Art Unit provides insight into what group of patent examiners prosecuted the patent application and the subject matter that the examiners work on. For example:
3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices
You can learn more about ART UNITS on the FedInvent Patents Weekly panel called About Tech Center or you can find information on the FedInvent Lists Page.
CURRENT CPC
Current CPC provides a list of the Cooperative Patent Classification symbols assigned to the patent. These are the CPC symbols assigned at the time the patent was granted.
The FedInvent Project is a patent classification maximalist endeavor or put another way, we believe that more you understand about patent classification the more you'll learn about the nature of the invention and the types of work that the federal government is funding.
The symbol presented in BOLD is the symbol identified as the "first" classification which is the most relevant classification on the patent. The date that follows the symbol is the date of the most recent revision to the art classed there.
- A61B 1/149 (20130101)
- A61B 1/71 (20130101)
- A61B 1/105 (20130101)
The CPC symbols match the classifications found on the PDF version of the patent. Over time, the classifications on the full-text version of the patent change to reflect how USPTO organizes patent art to support its examiners. The two sets of CPCs don’t always match.
VIEW PATENT
As of June 2021, we include two ways to view a patent at USPTO. FedInvent provides a link to the Full-Text Version of the patent and a link to the PDF version of the patent.
HOW DO I FIND A SPECIFIC PATENT ON A PAGE?
You can use the Command F or Control F to find a specific patent you are interested in.
HOW DO I GET HERE?
You navigate to the details of a patent by clicking the information icon that follows a patent on the FedInvent Patents Weekly Report.
You can also reach this page using the weekly page link that looks like this:
https://wayfinder.digital/fedinvent/patents-2007/fedinvent-patents-20070529.html
Just update the date portion of the URL. Tuesdays for patents. Thursdays for pre-grant publication of patent applications.
Download a copy of the How To Use This Page