FedInvent™ Patents
Patent Details for Tuesday, March 05, 2019
This page was updated on Monday, March 27, 2023 at 05:44 AM GMT
Department of Health and Human Services (HHS)
| US 10219492 | Bao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Xiaoyong Bao (Galveston, Texas); Yong Sun Lee (League City, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Xiaoyong Bao (Galveston, Texas); Yong Sun Lee (League City, Texas) |
| ABSTRACT | Provided herein are methods for altering respiratory syncytial virus (RSV) replication in a cell using oligonucleotides derived from tRNAs, also referred to as tRFs (tRNA-derived RNA Fragments). The oligonucleotides may be used to decrease or increase replication of RSV. Also provided herein are methods for treating a subject having or at risk of having an RSV infection, and animal models for evaluating viral and host factors in RSV pathogenesis. |
| FILED | Friday, November 21, 2014 |
| APPL NO | 14/550399 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 67/0271 (20130101) Original (OR) Class Preparations for Medical, Dental, or Toilet Purposes A61K 31/713 (20130101) A61K 45/06 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) C12N 2310/11 (20130101) C12N 2310/315 (20130101) C12N 2310/321 (20130101) C12N 2310/321 (20130101) C12N 2310/3521 (20130101) C12N 2760/18511 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219505 | Barrera et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia) |
| INVENTOR(S) | Roberto Barrera (Guaynabo, Puerto Rico); Andrew J. Mackay (San Juan, Puerto Rico); Manuel Amador (Guaynabo, Puerto Rico) |
| ABSTRACT | Improved devices for the capture, detection, or quantification of insect vectors such as gravid female insects, are provided. The devices include surface coloration, design, and dimension that improved their ability to attract and/or capture target insect vectors. The traps are used in process for detection or control of insect vectors in indoor and outdoor environments. |
| FILED | Thursday, December 10, 2015 |
| APPL NO | 14/965230 |
| ART UNIT | 3647 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Catching, Trapping or Scaring of Animals; Apparatus for the Destruction of Noxious Animals or Noxious Plants A01M 1/00 (20130101) A01M 1/02 (20130101) A01M 1/04 (20130101) A01M 1/10 (20130101) A01M 1/14 (20130101) A01M 1/026 (20130101) Original (OR) Class A01M 1/106 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219729 | Kintz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Profusa, Inc. (South San Francisco, California) |
| ASSIGNEE(S) | Profusa, Inc. (South San Francisco, California) |
| INVENTOR(S) | Gregory J. Kintz (Santa Cruz, California); William A. McMillan (La Honda, California); Natalie A. Wisniewski (San Francisco, California) |
| ABSTRACT | Some embodiments described herein relate to an apparatus including a light source configured to transmit an excitation optical signal to an implanted sensor and a detector configured to detect an analyte-dependent optical signal emitted from an implanted sensor. The apparatus can include a lens configured to focus at least a portion of the analyte-dependent optical signal onto the detector. |
| FILED | Friday, June 06, 2014 |
| APPL NO | 14/297787 |
| ART UNIT | 3735 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0017 (20130101) A61B 5/1459 (20130101) Original (OR) Class A61B 5/14532 (20130101) A61B 2562/043 (20130101) A61B 2562/0233 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219815 | Maxwell et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Adam Maxwell (Ann Arbor, Michigan); Zhen Xu (Ann Arbor, Michigan); Hitinder S. Gurm (Ann Arbor, Michigan); Charles A. Cain (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Adam Maxwell (Ann Arbor, Michigan); Zhen Xu (Ann Arbor, Michigan); Hitinder S. Gurm (Ann Arbor, Michigan); Charles A. Cain (Ann Arbor, Michigan) |
| ABSTRACT | Methods for performing non-invasive thrombolysis with ultrasound using, in some embodiments, one or more ultrasound transducers to focus or place a high intensity ultrasound beam onto a blood clot (thrombus) or other vascular inclusion or occlusion (e.g., clot in the dialysis graft, deep vein thrombosis, superficial vein thrombosis, arterial embolus, bypass graft thrombosis or embolization, pulmonary embolus) which would be ablated (eroded, mechanically fractionated, liquefied, or dissolved) by ultrasound energy. The process can employ one or more mechanisms, such as of cavitational, sonochemical, mechanical fractionation, or thermal processes depending on the acoustic parameters selected. This general process, including the examples of application set forth herein, is henceforth referred to as “Thrombolysis.” |
| FILED | Friday, January 23, 2009 |
| APPL NO | 12/358549 |
| ART UNIT | 3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/055 (20130101) A61B 5/0536 (20130101) A61B 8/00 (20130101) A61B 8/08 (20130101) A61B 8/485 (20130101) A61B 17/2258 (20130101) A61B 17/22004 (20130101) Original (OR) Class A61B 2017/00154 (20130101) A61B 2017/00172 (20130101) A61B 2017/00778 (20130101) A61B 2017/22001 (20130101) A61B 2017/22008 (20130101) A61B 2017/22088 (20130101) A61B 2017/22089 (20130101) A61B 2090/378 (20160201) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 37/0092 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219832 | Bagwell et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Actuated Medical, Inc. (Bellefonte, Pennsylvania) |
| ASSIGNEE(S) | Actuated Medical, Inc. (Bellefonte, Pennsylvania) |
| INVENTOR(S) | Roger B. Bagwell (Bellefonte, Pennsylvania); Ryan S. Clement (State College, Pennsylvania); Andrew J. Meehan (Warriors Mark, Pennsylvania); Casey A. Scruggs (Middleburg, Pennsylvania); Ryan M. Sheehan (Pittsburgh, Pennsylvania); Maureen L. Mulvihill (Bellefonte, Pennsylvania) |
| ABSTRACT | A device for penetrating tissue is provided that has a driving actuator with a body and motor shaft that is reciprocated. A coupler is attached to the motor shaft, and a key engages the driving actuator and coupler and limits rotational motion of the motor shaft and permits linear motion of the motor shaft. A penetrating member is carried by the coupler, and linear motion of the motor shaft is translated to the penetrating member to linearly reciprocate the penetrating member. |
| FILED | Friday, October 24, 2014 |
| APPL NO | 14/522681 |
| ART UNIT | 3791 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 10/025 (20130101) A61B 17/3401 (20130101) A61B 17/3415 (20130101) A61B 17/3476 (20130101) Original (OR) Class A61B 17/3496 (20130101) A61B 17/320068 (20130101) A61B 2017/00115 (20130101) A61B 2017/00123 (20130101) A61B 2090/064 (20160201) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/3287 (20130101) A61M 25/0084 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220001 | Schwendeman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Michigan (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Steven P. Schwendeman (Superior Township, Michigan); Kashappa-Goud Desai (Ann Arbor, Michigan) |
| ABSTRACT | Methods and compositions are provided that load and encapsulate an agent, such as a protein, in a porous self-healing polymer. A delivery system includes a porous self-healing polymer, an ionic affinity trap within the pores of the self-healing polymer, and an agent associated with the ionic affinity trap. Methods of encapsulating an agent in a polymer include providing a porous self-healing polymer comprising an ionic affinity trap within the pores. The polymer is incubated with an agent having an affinity for the ionic affinity trap. At least a portion of the pores in the polymer are then healed. Active encapsulation of macromolecules at low concentrations may be achieved due to affinity of the agent for the ionic affinity trap within the pores. |
| FILED | Tuesday, January 06, 2015 |
| APPL NO | 14/590237 |
| ART UNIT | 1613 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/1647 (20130101) A61K 9/1694 (20130101) Original (OR) Class A61K 38/09 (20130101) A61K 38/38 (20130101) A61K 38/47 (20130101) A61K 38/385 (20130101) A61K 39/08 (20130101) A61K 47/482 (20130101) A61K 47/48015 (20130101) A61K 47/48853 (20130101) A61K 47/48915 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220002 | Vetro et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS OF THE UNIVERSITY OF NEBRASKA (Lincoln, Nebraska) |
| ASSIGNEE(S) | BOARD OF REGENTS OF THE UNIVERSITY OF NEBRASKA (Lincoln, Nebraska) |
| INVENTOR(S) | Joseph A. Vetro (Logan, Iowa); Sam D. Sanderson (Omaha, Nebraska) |
| ABSTRACT | Controlled-release formulations of carboxy-terminal C5a analogs (such as sustained-release formulations of the analogs), and their use in methods for treating and preventing an infection or a disease such as cancer, for directly killing microorganisms, for vaccine preparation, for inducing an immune response and for targeting antigen-presenting cells and other cells bearing a C5a receptor, are provided. |
| FILED | Friday, November 30, 2012 |
| APPL NO | 14/362040 |
| ART UNIT | 1675 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/48 (20130101) Original (OR) Class A61K 9/5031 (20130101) A61K 38/08 (20130101) A61K 38/1725 (20130101) A61K 39/0005 (20130101) A61K 2039/505 (20130101) Peptides C07K 16/18 (20130101) C07K 16/28 (20130101) C07K 2317/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220009 | Nicolls et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California); THE UNITED STATES OF AMERICA AS REPRESENTED BY THE DEPARTMENT OF VETERANS AFFAIRS (Washington, District of Columbia); THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California); The Johns Hopkins University (Baltimore, Maryland); The United States of America as Represented by the Department of Veterans Affairs (Washington, District of Columbia) |
| INVENTOR(S) | Mark R. Nicolls (Palo Alto, California); Jayakumar Rajadas (Cupertino, California); Geoffrey C. Gurtner (Woodside, California); Xinguo Jiang (Palo Alto, California); Gundeep Dhillon (Stanford, California); Gregg L. Semenza (Reisterstown, Maryland) |
| ABSTRACT | Formulations and methods are provided for improving the function, i.e. clinical outcome, of solid organ transplants. Lung transplantation is of particular interest. In the methods of the invention, a nanoparticle formulation comprising an effective dose of an iron chelator active agent in nanoparticle form, including without limitation, deferoxamine (DFO), deferasirox (DFX), and deferiprone (DFP), etc. suspended in a carrier compatible with the tissue of interest, is topically applied to the surface of tissues at the site of anastomosis. The nanoparticles are comprised of the active agent and a pharmaceutically acceptable stabilizer. |
| FILED | Friday, August 30, 2013 |
| APPL NO | 14/424994 |
| ART UNIT | 1619 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5123 (20130101) A61K 9/5138 (20130101) A61K 9/5146 (20130101) A61K 9/5161 (20130101) A61K 9/5169 (20130101) A61K 31/164 (20130101) Original (OR) Class A61K 31/436 (20130101) A61K 31/4196 (20130101) A61K 31/4412 (20130101) A61K 45/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220028 | Greig et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia) |
| INVENTOR(S) | Nigel H. Greig (Phoenix, Maryland); Weiming Luo (Baltimore, Maryland); David Tweedie (Joppa, Maryland); Harold W. Holloway (Middle River, Maryland); Qian-Sheng Yu (Lutherville, Maryland); Edward J. Goetzl (San Francisco, California) |
| ABSTRACT | A compound, or a pharmaceutically acceptable salt or ester thereof, having a structure of: wherein A, B and D are each oxygen or sulfur, provided that least one of A, B and D is sulfur; and R1-R8 are each independently hydrogen, hydroxyl, acyl, substituted acyl, acyloxy, substituted acyloxy, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, aryl, substituted aryl, amino, substituted amino, halogen, heterocycloalkyl, substituted heterocycloalkyl, heteroaryl, substituted heteroaryl, or a thio-containing group. |
| FILED | Monday, March 13, 2017 |
| APPL NO | 15/457156 |
| ART UNIT | 1621 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/454 (20130101) Original (OR) Class Heterocyclic Compounds C07D 401/04 (20130101) Technologies for Adaptation to Climate Change Y02A 50/411 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220034 | Zlotnick et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Indiana University Research and Technology Corp. (Indianapolis, Indiana) |
| ASSIGNEE(S) | Indiana University Research and Technology Corporation (Indianapolis, Indiana) |
| INVENTOR(S) | Adam Zlotnick (Bloomington, Indiana); Lichun Li (Bloomington, Indiana); William W. Turner, Jr. (Bloomington, Indiana); Samson Francis (Bloomington, Indiana) |
| ABSTRACT | Novel assembly effector compounds having a therapeutic effect against hepatitis B viral (HBV) infection are disclosed. Assembly effector molecules described herein can lead to defective viral assembly and also may affect other viral activities associated with chronic HBV infection. Also disclosed is a process to synthesize disclosed compounds, method of treatment of HBV by administration of disclosed compounds, and use of these compounds in the manufacture of medicaments against HBV. |
| FILED | Thursday, October 16, 2014 |
| APPL NO | 15/030378 |
| ART UNIT | 1628 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/506 (20130101) Original (OR) Class Heterocyclic Compounds C07D 239/47 (20130101) C07D 239/48 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220051 | Bellacosa et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Institute for Cancer Research (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | Institute For Cancer Research (, None) |
| INVENTOR(S) | Alfonso Bellacosa (Philadelphia, Pennsylvania); Timothy Yen (Haverford, Pennsylvania); Neil Beeharry (Philadelphia, Pennsylvania); Mitchell Smith (Elkins Park, Pennsylvania); Rossella Tricarico (Philadelphia, Pennsylvania); Vikram Bhattacharjee (Philadelphia, Pennsylvania); Pietro Mancuso (Philadelphia, Pennsylvania) |
| ABSTRACT | The invention provides methods for enhancing the cytotoxicity of DNA damage in cancer cells that express thymine DNA glycosylase, and treating tumors accordingly. The methods comprise inhibiting the expression or biologic activity of thymine DNA glycosylase, and inducing DNA damage in the cancer cells. DNA damage may be induced by administration of bendamustine or gemcitabine to the cancer cells. |
| FILED | Thursday, November 13, 2014 |
| APPL NO | 14/540428 |
| ART UNIT | 1629 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/122 (20130101) A61K 31/277 (20130101) A61K 31/546 (20130101) A61K 31/4184 (20130101) A61K 31/4184 (20130101) A61K 31/7068 (20130101) Original (OR) Class A61K 31/7068 (20130101) A61K 31/7088 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1137 (20130101) C12N 2310/14 (20130101) C12N 2320/31 (20130101) Enzymes C12Y 302/02029 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220069 | Hussain et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland) |
| ASSIGNEE(S) | The Johns Hopkins University (Baltimore, Maryland) |
| INVENTOR(S) | Mehboob Hussain (Baltimore, Maryland); Prosenjit Mondal (Baltimore, Maryland); Woo-Jin Song (Baltimore, Maryland) |
| ABSTRACT | The present invention relates to the field of diabetes mellitus. More specifically, the present invention provides compositions and methods useful for treating diabetes. In another embodiment, a method for treating type 2 diabetes mellitus or pre-diabetes in a patient comprises administering to the patient an effective amount of inhibitor of kisspeptin 1 and/or proteolytic derivatives thereof. |
| FILED | Thursday, January 22, 2015 |
| APPL NO | 15/113450 |
| ART UNIT | 1676 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/4412 (20130101) A61K 38/08 (20130101) A61K 38/16 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) C12N 2310/11 (20130101) C12N 2310/14 (20130101) C12N 2310/141 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220070 | Fort et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Michigan (Ann Arbor, Michigan); Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | The Regents of the University of Michigan (Ann Arbor, Michigan); Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | Patrice E. Fort (Ann Arbor, Michigan); Kevin Schey (Nashville, Tennessee) |
| ABSTRACT | This invention relates to αA-crystallin protein modulating compounds (e.g., phosphomimetic peptides), compositions comprising such modulating compounds, and their use as therapeutics for the treatment and prevention of conditions involving neurodegeneration and neuroinflammation. |
| FILED | Monday, September 18, 2017 |
| APPL NO | 15/707596 |
| ART UNIT | 1675 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0048 (20130101) A61K 31/57 (20130101) A61K 38/16 (20130101) Original (OR) Class Peptides C07K 4/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220073 | Rapraeger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Alan C. Rapraeger (Madison, Wisconsin); DeannaLee M. Beauvais (Madison, Wisconsin) |
| ABSTRACT | The present invention provides a peptide derived from the extracellular domain of syndecan-1 that inhibits angiogenesis. |
| FILED | Thursday, November 10, 2016 |
| APPL NO | 15/347934 |
| ART UNIT | 1658 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/1709 (20130101) Original (OR) Class A61K 45/06 (20130101) Peptides C07K 7/06 (20130101) C07K 7/08 (20130101) C07K 14/705 (20130101) C07K 14/4725 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220078 | Carney et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Darrell Carney (Dickinson, Texas); Carla Kantara (Dickinson, Texas); Stephanie Moya (Dickinson, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Darrell Carney (Dickinson, Texas); Carla Kantara (Dickinson, Texas); Stephanie Moya (Dickinson, Texas) |
| ABSTRACT | Provided herein are methods for using a thrombin peptide derivative to treat a medulloblastoma. In one embodiment, the method includes administering to a subject having a medulloblastoma an effective amount of a thrombin peptide derivative, and exposing cells of the medulloblastoma of the subject to a cancer treatment after administering the thrombin peptide derivative to the subject. An example of a cancer treatment is radiation therapy. In one embodiment, viability of cells of the medulloblastoma is decreased compared to viability of cells of the medulloblastoma before the administering and the exposing. The cells of the medulloblastoma having decreased viability can be cancer stem cells. In one embodiment, shrinkage of the medulloblastoma in the subject is increased compared to shrinkage of the medulloblastoma before the administering and the exposing. |
| FILED | Thursday, June 11, 2015 |
| APPL NO | 14/736735 |
| ART UNIT | 1654 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/4833 (20130101) Original (OR) Class A61K 41/0038 (20130101) Enzymes C12Y 304/21005 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220081 | Ware et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LA JOLLA INSTITUTE FOR ALLERGY AND IMMUNOLOGY (La Jolla, California) |
| ASSIGNEE(S) | LA JOLLA INSTITUTE FOR ALLERGY AND IMMUNOLOGY (La Jolla, California) |
| INVENTOR(S) | Carl F. Ware (Solana Beach, California); Timothy C. Cheung (Wollstonecraft, Australia); Marcos Steinberg (San Diego, California) |
| ABSTRACT | The invention provides HVEM cis complexes which include, for example, HVEM/BTLA, HVEM/CD160 and HVEM/gD cis complexes. The invention provides ligands and agents that bind to HVEM cis complexes, such as antibodies. The invention further provides methods of use of the HVEM cis complexes, and the ligands and agents (e.g., LIGHT polypeptide sequence) that bind to the HVEM cis complexes. |
| FILED | Friday, February 07, 2014 |
| APPL NO | 14/175892 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/0005 (20130101) Original (OR) Class Peptides C07K 16/2803 (20130101) C07K 16/2818 (20130101) C07K 16/2878 (20130101) C07K 2317/73 (20130101) C07K 2317/74 (20130101) C07K 2317/75 (20130101) C07K 2317/76 (20130101) C07K 2319/30 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 2333/70578 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220084 | Ficht et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Texas A and M University System (College Station, Texas) |
| ASSIGNEE(S) | THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas) |
| INVENTOR(S) | Thomas A. Ficht (College Station, Texas); Allison Ficht (College Station, Texas); Renee Tsolis (Davis, California); Leslie Garry Adams (College Station, Texas) |
| ABSTRACT | Methods and compositions for the treatment of Brucella induced diseases and disorders are disclosed herein. In preferred embodiments, the invention relates to vaccines. In additional embodiments, the invention relates to formulations capable of releasing said vaccines at a controlled rate of release in vivo. In further embodiments, the invention relates to modified strains of the bacteria Brucella melitensis and Brucella abortus. In still further embodiments, the invention relates to compositions that do not induce clinical symptoms or splenomegaly in a subject receiving said compositions. |
| FILED | Tuesday, December 15, 2015 |
| APPL NO | 14/969882 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/098 (20130101) Original (OR) Class A61K 2039/54 (20130101) A61K 2039/522 (20130101) A61K 2039/541 (20130101) A61K 2039/622 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56911 (20130101) G01N 2333/23 (20130101) G01N 2469/20 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220089 | Hsiao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| INVENTOR(S) | Elaine Hsiao (Rowland Heights, California); Sarkis K Mazmanian (Porter Ranch, California); Paul H Patterson (Altadena, California); Sara McBride (Pasadena, California) |
| ABSTRACT | Disclosed herein are compositions, systems, and methods for diagnosing and treatment of subjects suffering from anxiety, autism spectrum disorder (ASD), or a pathological condition with one or more of the symptoms of ASD. |
| FILED | Wednesday, August 28, 2013 |
| APPL NO | 14/012769 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/74 (20130101) A61K 35/741 (20130101) A61K 39/3955 (20130101) Original (OR) Class A61K 2039/505 (20130101) Peptides C07K 16/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) G01N 2800/28 (20130101) G01N 2800/7076 (20130101) G01N 2800/7085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220091 | Sabbatino et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The General Hospital Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Francesco Sabbatino (Boston, Massachusetts); Yangyang Wang (Malden, Massachusetts); Xinhui Wang (Boston, Massachusetts); Steven Isakoff (Brookline, Massachusetts); Cristina Ferrone (Boston, Massachusetts); Joe Schwab (Boston, Massachusetts); Soldano Ferrone (Boston, Massachusetts) |
| ABSTRACT | Methods for treating cancer using a combination of an inhibitor of the sonic hedgehog signaling pathway (e.g., LDE225) with radiation and a tumor antigen-specific monoclonal antibody (e.g., heat shock protein (HSP) glucose regulated protein of 94000 daltons (Grp94)-specific mAb W9, or chondroitin sulfate proteoglycan 4 (CSPG4)-targeted mAbs), or with a BRAF inhibitor, e.g., in BRAF inhibitor resistant cancers. |
| FILED | Thursday, April 03, 2014 |
| APPL NO | 14/782260 |
| ART UNIT | 1642 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/437 (20130101) A61K 31/437 (20130101) A61K 31/5377 (20130101) A61K 31/5377 (20130101) A61K 39/39558 (20130101) Original (OR) Class A61K 45/06 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 2740/15043 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220099 | Movassaghi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Mohammad Movassaghi (Arlington, Massachusetts); Justin Kim (Sunland, California); Paul J. Hergenrother (Champaign, Illinois); Karen Morrison (West Sacramento, California); Nicolas Boyer (Somerville, Massachusetts) |
| ABSTRACT | The synthesis of various pyrazino[1′,2′:1,5]pyrrolo[2,3-b]-indole-1,4-dione analogs has been successfully implemented in the present application. From these efforts, compounds having the structure of Formula I-c: or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein R1, R2, R4-R8, R3′, R6′, and n are as defined herein, are provided. These biologically active derivatives have been further used to prepare cell-specific drug conjugates effective in treating various diseases including cancer. |
| FILED | Tuesday, May 10, 2016 |
| APPL NO | 15/150786 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/6803 (20170801) A61K 47/48384 (20130101) Original (OR) Class Heterocyclic Compounds C07D 487/14 (20130101) C07D 513/22 (20130101) Peptides C07K 5/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220103 | Zabow et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Depart. of Health and Human Services (Washington, District of Columbia); THE UNITED STATES OF AMERICA, REPRESENTED BY THE SECRETARY OF COMMERCE (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia); The United States of America, as represented by the Secretary of Commerce (Washington, District of Columbia) |
| INVENTOR(S) | Gary Zabow (Boulder, Colorado); Stephen Dodd (Rockville, Maryland); Alan Koretsky (Bethesda, Maryland); John Moreland (Louisville, Colorado) |
| ABSTRACT | The present invention relates to a magnetic resonance structure with a cavity or a reserved space that provides contrast and the additional ability to frequency-shift the spectral signature of the NMR-susceptible nuclei such as water protons by a discrete and controllable characteristic frequency shift that is unique to each MRS design. The invention also relates to nearly uniform solid magnetic resonance T2* contrast agents that have a significantly higher magnetic moment compared to similarly-sized existing MRI contrast agents. |
| FILED | Monday, June 15, 2015 |
| APPL NO | 14/739813 |
| ART UNIT | 1618 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/055 (20130101) A61B 5/0515 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 49/18 (20130101) A61K 49/1818 (20130101) Original (OR) Class Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) B82Y 30/00 (20130101) Measuring Electric Variables; Measuring Magnetic Variables G01R 33/281 (20130101) G01R 33/563 (20130101) G01R 33/5601 (20130101) G01R 33/5635 (20130101) G01R 33/56325 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/2982 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220117 | Zhang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Kang Zhang (San Diego, California); Jiagang Zhao (San Diego, California); Adah Almutairi (La Jolla, California) |
| ABSTRACT | The invention provides an in vitro method for producing isolated mammalian primitive retinal stem cells (pRSCs) comprising: (a) culturing isolated embryonic stem cells (ESCs) from a mammal in a cell culture medium that is free of feeder cells, feeder-conditioned medium or serum so as to produce and grow a culture of the isolated ESCs; and (b) contacting the culture of the isolated ESCs so grown with one or more of an inhibitor for Wnt or TGF-β/BMP signaling so as to differentiate the isolated ESCs of (a) into primitive retinal stem cells thereby producing isolated mammalian pRSCs. |
| FILED | Thursday, October 09, 2014 |
| APPL NO | 15/028618 |
| ART UNIT | 1632 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0046 (20130101) A61K 35/30 (20130101) A61K 35/30 (20130101) A61K 35/545 (20130101) A61K 35/545 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 27/24 (20130101) A61L 27/26 (20130101) A61L 27/26 (20130101) A61L 27/26 (20130101) A61L 27/52 (20130101) A61L 27/54 (20130101) A61L 27/3804 (20130101) A61L 27/3834 (20130101) Original (OR) Class A61L 27/3839 (20130101) A61L 2300/64 (20130101) A61L 2430/16 (20130101) Compositions of Macromolecular Compounds C08L 1/00 (20130101) C08L 5/08 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/062 (20130101) C12N 5/0621 (20130101) C12N 5/0623 (20130101) C12N 2500/33 (20130101) C12N 2500/38 (20130101) C12N 2500/90 (20130101) C12N 2501/15 (20130101) C12N 2501/16 (20130101) C12N 2501/39 (20130101) C12N 2501/42 (20130101) C12N 2501/115 (20130101) C12N 2501/155 (20130101) C12N 2501/165 (20130101) C12N 2501/395 (20130101) C12N 2501/415 (20130101) C12N 2501/727 (20130101) C12N 2501/999 (20130101) C12N 2506/02 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220124 | Rylander et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Christopher Rylander (Blacksburg, Virginia); Mehmet A. Kosoglu (Fairfax, Virginia); Robert L. Hood (Blacksburg, Virginia); John L. Robertson (Floyd, Virginia); John H. Rossmeisl (Blacksburg, Virginia); David C. Grant (Blacksburg, Virginia); Marissa N. Rylander (Blacksburg, Virginia) |
| ASSIGNEE(S) | VIRGINIA TECH INTELLECTUAL PROPERTIES, INC. (Blacksburg, Virginia) |
| INVENTOR(S) | Christopher Rylander (Blacksburg, Virginia); Mehmet A. Kosoglu (Fairfax, Virginia); Robert L. Hood (Blacksburg, Virginia); John L. Robertson (Floyd, Virginia); John H. Rossmeisl (Blacksburg, Virginia); David C. Grant (Blacksburg, Virginia); Marissa N. Rylander (Blacksburg, Virginia) |
| ABSTRACT | The present invention relates to the field of optical imaging and therapeutics. More particularly, embodiments of the present invention provide minimally-invasive Fiberoptic Microneedle Devices (FMDs) for light-based therapeutics, which physically penetrate tissue and deliver light directly into the target area below the skin surface. Embodiments of the invention enable depth-selective and deep photothermal therapeutics and include methods of treating cancer, methods of re-shaping or removing adipose tissue, and methods of delivering drugs or co-delivering drugs and energy to selected tissue. |
| FILED | Tuesday, February 28, 2012 |
| APPL NO | 14/002058 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 18/20 (20130101) A61B 18/22 (20130101) A61B 2018/208 (20130101) A61B 2018/00452 (20130101) A61B 2018/00464 (20130101) A61B 2018/00476 (20130101) A61B 2018/2005 (20130101) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 1/008 (20130101) Original (OR) Class A61M 5/158 (20130101) A61M 2202/08 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 5/062 (20130101) A61N 2005/063 (20130101) A61N 2005/0612 (20130101) Rotary-piston, or Oscillating-piston, Positive-displacement Machines for Liquids; Rotary-piston, or Oscillating-piston, Positive-displacement Pumps F04C 2270/0421 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220202 | Neysmith et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Second Sight Medical Products, Inc. (Sylmar, California) |
| ASSIGNEE(S) | Second Sight Medical Products, Inc. (Sylmar, California) |
| INVENTOR(S) | Jordan Neysmith (Mountain View, California); Robert Greenberg (Los Angeles, California); James Little (Arvada, Colorado); Brian Mech (Santa Clarita, California); Neil Talbot (La Crescenta, California); Qingfang Yao (Valencia, California); David Zhou (Saugus, California) |
| ABSTRACT | A flexible circuit electrode array with more than one layer of metal traces comprising: a polymer base layer; more than one layer of metal traces, separated by polymer layers, deposited on the polymer base layer, including electrodes suitable to stimulate neural tissue; and a polymer top layer deposited on the polymer base layer and the metal traces. Polymer materials are useful as electrode array bodies for neural stimulation. They are particularly useful for retinal stimulation to create artificial vision, cochlear stimulation to create artificial hearing, or cortical stimulation many purposes. The pressure applied against the retina, or other neural tissue, by an electrode array is critical. Too little pressure causes increased electrical resistance, along with electric field dispersion. Too much pressure may block blood flow. |
| FILED | Tuesday, May 02, 2017 |
| APPL NO | 15/585093 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/0541 (20130101) A61N 1/0543 (20130101) Original (OR) Class A61N 1/36046 (20130101) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 1/09 (20130101) H05K 1/028 (20130101) H05K 1/111 (20130101) H05K 1/115 (20130101) H05K 1/118 (20130101) H05K 1/0353 (20130101) H05K 3/06 (20130101) H05K 3/0014 (20130101) H05K 3/0017 (20130101) H05K 3/22 (20130101) H05K 3/0041 (20130101) H05K 3/188 (20130101) H05K 3/388 (20130101) H05K 3/4644 (20130101) H05K 2201/0129 (20130101) H05K 2201/0133 (20130101) H05K 2201/0141 (20130101) H05K 2201/0154 (20130101) Technical Subjects Covered by Former US Classification Y10T 29/49156 (20150115) Y10T 29/49158 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220205 | Bhadra et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Case Western Reserve University (Cleveland, Ohio) |
| ASSIGNEE(S) | CASE WESTERN RESERVE UNIVERSITY (Cleveland, Ohio) |
| INVENTOR(S) | Narendra Bhadra (Chesterland, Ohio); Kenneth J. Gustafson (Shaker Heights, Ohio); Jaime L. McCoin (Pittsburgh, Pennsylvania) |
| ABSTRACT | One aspect of the present disclosure relates to a system for electrical stimulation. A waveform generator can be configured to generate an electrical waveform. An electrode can be electrically coupled to the waveform generator and configured to deliver the electrical waveform to a nerve to reduce at least one reflex that affects a bodily function. |
| FILED | Thursday, December 15, 2016 |
| APPL NO | 15/380779 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/36007 (20130101) Original (OR) Class A61N 1/36014 (20130101) A61N 1/36017 (20130101) A61N 1/36057 (20130101) A61N 1/36171 (20130101) A61N 1/36178 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220387 | Granier et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The General Hospital Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Robert Granier (Boston, Massachusetts); Ramin Haghgooie (Arlington, Massachusetts); Ken Kotz (Auburndale, Massachusetts); Anne C. Petrofsky (Sudbury, Massachusetts); Ronald G. Tompkins (Boston, Massachusetts) |
| ABSTRACT | A modular analytic system includes a base, at least one fluid sample processing module configured to be removably attached to the base, at least one fluid sample analysis module configured to be removably attached to the base, a fluid actuation module positioned on the base, a fluidic network comprising multiple fluidic channels, in which the fluid actuation module is arranged to control transport of a fluid sample between the at least one sample processing module and the at least one sample analysis module through the fluidic network, and an electronic processor, in which the electronic processor is configured to control operation of the fluid actuation module and receive measurement data from the at least one fluid sample analysis module. |
| FILED | Friday, December 05, 2014 |
| APPL NO | 15/101061 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/50273 (20130101) B01L 3/502715 (20130101) Original (OR) Class B01L 3/502738 (20130101) B01L 2200/027 (20130101) B01L 2200/028 (20130101) B01L 2200/0689 (20130101) B01L 2300/0627 (20130101) B01L 2300/0816 (20130101) B01L 2300/0832 (20130101) B01L 2300/0861 (20130101) B01L 2400/0487 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/1434 (20130101) G01N 21/01 (20130101) G01N 21/532 (20130101) G01N 21/6486 (20130101) G01N 35/00029 (20130101) G01N 35/00871 (20130101) G01N 2015/0065 (20130101) G01N 2015/1006 (20130101) G01N 2021/6493 (20130101) G01N 2035/00158 (20130101) G01N 2035/00326 (20130101) G01N 2035/00356 (20130101) G01N 2035/00881 (20130101) G01N 2201/062 (20130101) G01N 2201/06113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221140 | Amaravadi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Ravi K. Amaravadi (Media, Pennsylvania); Jeffrey Winkler (Wynnewood, Pennsylvania) |
| ABSTRACT | The invention provides novel asymmetric and symmetric bisaminoquinolmes and related compounds, methods of treatment and syntheses. The novel compounds exhibit effective anticancer activity and are useful in the treatment of a variety of autophagy-related disorders. |
| FILED | Friday, August 07, 2015 |
| APPL NO | 15/502330 |
| ART UNIT | 1625 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/436 (20130101) A61K 31/506 (20130101) A61K 31/517 (20130101) A61K 31/519 (20130101) A61K 31/704 (20130101) A61K 31/4375 (20130101) A61K 31/4545 (20130101) A61K 31/4706 (20130101) A61K 31/4706 (20130101) A61K 31/4709 (20130101) A61K 31/4709 (20130101) A61K 31/4745 (20130101) A61K 31/4995 (20130101) A61K 31/7056 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Heterocyclic Compounds C07D 215/46 (20130101) Original (OR) Class C07D 401/12 (20130101) Technologies for Adaptation to Climate Change Y02A 50/411 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221143 | Wagner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Carl Wagner (Scottsdale, Arizona); Peter Jurutka (Scottsdale, Arizona); Pamela Marshall (Scottsdale, Arizona) |
| ABSTRACT | The invention provides alkyl benzene compounds. The compounds are useful for treating conditions including Alzheimer's disease, Parkinson's disease, diabetes, cancer, inflammation, hyperresponsiveness, allergic conditions, asthma, and psychotic disorders such as schizophrenia. The compounds are also useful to lower IL-4, IL-5, or IL-15 levels in an animal. |
| FILED | Tuesday, March 01, 2016 |
| APPL NO | 15/550259 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Acyclic or Carbocyclic Compounds C07C 229/60 (20130101) C07C 2601/02 (20170501) Heterocyclic Compounds C07D 213/79 (20130101) C07D 213/80 (20130101) C07D 237/24 (20130101) C07D 239/42 (20130101) Original (OR) Class C07D 241/28 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221151 | Hegde |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Children's Hospital Medical Center (Cincinnati, Ohio) |
| ASSIGNEE(S) | CHILDREN'S HOSPITAL MEDICAL CENTER (Cincinnati, Ohio) |
| INVENTOR(S) | Rashmi Hegde (Cincinnati, Ohio) |
| ABSTRACT | Inhibitors of EYA tyrosine phosphatase are provided herein, as well as pharmaceutical compositions and methods relating thereto. |
| FILED | Wednesday, July 12, 2017 |
| APPL NO | 15/648349 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 307/80 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221169 | Hung et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BROAD INSTITUTE, INC. (Cambridge, Massachusetts); The General Hospital Corporation (Boston, Massachusetts); The Brigham and Women'ts Hospital, Inc. (Boston, Massachusetts) |
| ASSIGNEE(S) | The Broad Institute, Inc. (Cambridge, Massachusetts); The General Hospital Corporation (Boston, Massachusetts); The Brigham and Women's Hospital, Inc. (Boston, Massachusetts) |
| INVENTOR(S) | Deborah Hung (Cambridge, Massachusetts); Michael Serrano-Wu (Belmont, Massachusetts); Sarah Grant (Boston, Massachusetts); Tomohiko Kawate (Cambridge, Massachusetts) |
| ABSTRACT | Disclosed ore substituted aminothiazoles, which can be used for, among other things, the treatment of tuberculosis, pharmaceutical compositions containing the same, and methods of using the same. |
| FILED | Thursday, March 23, 2017 |
| APPL NO | 15/467432 |
| ART UNIT | 1625 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 277/50 (20130101) C07D 417/04 (20130101) C07D 417/12 (20130101) C07D 417/14 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221170 | Kamenecka et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Eolas Therapeutics, Inc. (Carlsbad, California) |
| ASSIGNEE(S) | Eolas Therapeutics, Inc. (Carlsbad, California) |
| INVENTOR(S) | Theodore M. Kamenecka (Palm Beach Gardens, Florida); Yuanjun He (Palm Beach Gardens, Florida) |
| ABSTRACT | The present application relates to certain difluoropyrrolidine compounds, pharmaceutical compositions containing them, and methods of using them, including methods for treating substance addiction, panic disorder, anxiety, post-traumatic stress disorder, pain, depression, seasonal affective disorder, an eating disorder, or hypertension. |
| FILED | Thursday, August 13, 2015 |
| APPL NO | 15/503131 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 401/14 (20130101) C07D 403/14 (20130101) C07D 417/14 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221171 | Gestwicki et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Jason E. Gestwicki (Moss Beach, California); Xiaokai Li (Ankeny, Iowa) |
| ABSTRACT | Provided herein are compounds of formula (I) which are, inter alia, useful allosteric inhibitors of Hsp70. The compounds and methods provided are useful for the treatment of cancer, infectious and neurodegenerative diseases. |
| FILED | Monday, January 11, 2016 |
| APPL NO | 15/536869 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 277/64 (20130101) C07D 417/14 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221175 | Conn et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | P. Jeffrey Conn (Nashville, Tennessee); Craig W. Lindsley (Brentwood, Tennessee); Kyle A. Emmitte (Aledo, Texas); Changho Han (Nashville, Tennessee); Julie L. Engers (Brentwood, Tennessee); Aaron M. Bender (Spring Hill, Tennessee) |
| ABSTRACT | Substituted pyrrolopyridine, imidazopyridine and triazolopyridine compounds having a formula are positive allosteric modulators of the muscarinic acetylcholine receptor M1 (mAChR M1) and the compounds and their pharmaceutical compositions may be useful in treating neurological and psychiatric disorders associated with muscarinic acetylcholine receptor dysfunction. Compounds of the invention may be prepared in several steps from 2-halo-5,6-dihydro-7H-pyrrolo[3,4-b]pyridin-7-one intermediates. |
| FILED | Friday, April 22, 2016 |
| APPL NO | 15/568936 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/506 (20130101) A61K 31/513 (20130101) A61K 31/517 (20130101) A61K 31/519 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 25/00 (20180101) A61P 25/28 (20180101) Acyclic or Carbocyclic Compounds C07C 2601/16 (20170501) Heterocyclic Compounds C07D 471/14 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221214 | Heath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | INDI MOLECULAR, INC. (Culver City, California) |
| ASSIGNEE(S) | INDI MOLECULAR, INC. (Culver City, California) |
| INVENTOR(S) | James R. Heath (South Pasadena, California); Arundhati Nag (Pasadena, California); Samir Das (Pasadena, California); Kaycie M. Deyle (Sylmar, California); Steven Wesley Millward (Monrovia, California); Paul Edward Kearney (Seattle, Washington) |
| ABSTRACT | The present application provides stable peptide-based Akt capture agents and the use thereof as detection, diagnosis, and treatment agents. The application further provides novel methods of developing stable peptide-based capture agents, including Akt capture agents, using iterative on-bead in situ click chemistry. |
| FILED | Monday, November 23, 2015 |
| APPL NO | 14/949236 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/08 (20130101) A61K 49/0043 (20130101) A61K 49/0056 (20130101) A61K 51/08 (20130101) Peptides C07K 7/02 (20130101) Original (OR) Class C07K 14/001 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1058 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/485 (20130101) C12Q 1/6804 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/573 (20130101) G01N 33/5748 (20130101) G01N 33/57449 (20130101) G01N 33/57496 (20130101) G01N 2333/91205 (20130101) G01N 2333/91215 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221215 | Arora et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | New York University (New York, New York) |
| INVENTOR(S) | Paramjit S. Arora (Cold Spring Harbor, New York); Dafna Bar-Sagi (New York, New York); Anupam Patgiri (New York, New York); Kamlesh Yadav (New York, New York) |
| ABSTRACT | The present invention relates to peptides having one or more stable, internally-constrained HBS α-helices, where the peptide is capable of interacting with Ras and related proteins. |
| FILED | Friday, March 06, 2015 |
| APPL NO | 14/641297 |
| ART UNIT | 1675 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/08 (20130101) A61K 38/10 (20130101) Peptides C07K 7/06 (20130101) C07K 7/08 (20130101) Original (OR) Class C07K 14/4705 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221217 | Huang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington, Center For Commercialization (Seattle, Washington); The Scripps Research Institute (La Jolla, California); International AIDS Vaccine Initiative (New York, New York) |
| ASSIGNEE(S) | University of Washington, Center for Commercialization (Seattle, Washington); The Scripps Research Institute (La Jolla, California); International AIDS Vaccine Initiative (New York, New York) |
| INVENTOR(S) | Po-Ssu Huang (Seattle, Washington); Joseph Graham Jardine (Seattle, Washington); Sergey V. Menis (Bothell, Washington); William Ray Schief (Encinitas, California); Neil P. King (Seattle, Washington) |
| ABSTRACT | The invention relates to an engineered outer domain (eOD) of HIV gp120 and mutants thereof and methods of making and using the same. The mutant eODs may be advantageous for the elicitation of CD4-binding site (CD4bs)-directed broadly-neutralizing antibodies (bnAbs) and/or improve binding to mature VRC01 and/or improve binding to germline VRC01 and the germlines of other VH1-2 derived broadly-neutralizing antibodies. The mutant eODs may also include glycan-masking mutations on eOD. The present invention also includes fusions of eOD to various protein multimers to enhance immunogenicity as well as the design of cocktails of different eODs that represent the full diversity of HIV sequences within the VRC01 epitope and surroundings. |
| FILED | Tuesday, December 22, 2015 |
| APPL NO | 14/978132 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 39/12 (20130101) A61K 39/21 (20130101) Peptides C07K 14/005 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 2740/16122 (20130101) C12N 2740/16134 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/564 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221218 | Chiu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California); Jacquelyn Dieter (Davis, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Charles Chiu (San Francisco, California); Eunice Chen (Palo Alto, California); Nicholas W. Lerche (Davis, California); Karen Lisa Bales (Davis, California) |
| ABSTRACT | Provided is a Titi Monkey Adenovirus (TMAdV) that can infect both human and non-human primates. Further provided are nucleic acid sequences, proteins, expression vectors and host cells, anti-TMAdV antibodies, vaccines, compositions, methods of detecting TMAdV, methods for assaying for anti-TMAdV compounds, and methods for treating or preventing a TMAdV infection. |
| FILED | Thursday, January 14, 2016 |
| APPL NO | 14/996127 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 14/005 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 2710/10321 (20130101) C12N 2710/10322 (20130101) C12N 2710/10334 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/701 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56983 (20130101) G01N 2469/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221223 | Dewji et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Nazneen Dewji (San Diego, California); S. Jonathan Singer (La Jolla, California) |
| ABSTRACT | The disclosure relates generally to neurodegenerative disorders and more specifically to a group of presenilin/G-protein/c-src binding polypeptides and methods of use for modulating signaling and progression of Alzheimer's disease. |
| FILED | Wednesday, November 23, 2016 |
| APPL NO | 15/360539 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/08 (20130101) A61K 38/10 (20130101) A61K 38/1709 (20130101) Peptides C07K 7/06 (20130101) C07K 7/08 (20130101) C07K 14/4711 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221235 | Scherer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | THE BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| INVENTOR(S) | Philipp Erich Scherer (Southlake, Texas); Jiyoung Park (Dallas, Texas); Zhiqiang An (Pearland, Texas) |
| ABSTRACT | Aspects of the present invention relate to methods and reagents for increasing chemosensitivity to platinum-based chemotherapy. In one aspect, a method of increasing chemosensitivity to platinum-based chemotherapy is provided, comprising administering to a patient in need thereof an effective amount of an endotrophin-neutralizing agent. The agent can be a monoclonal antibody, or fragment thereof, capable of binding to the C5 domain of the alpha3 chain of collagen VI. In some embodiments, the method can further include administering an effective amount of thiazolidinedione to said patient. |
| FILED | Friday, January 27, 2017 |
| APPL NO | 15/417740 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/555 (20130101) A61K 31/555 (20130101) A61K 33/24 (20130101) A61K 33/24 (20130101) A61K 39/3955 (20130101) A61K 2039/505 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Peptides C07K 16/18 (20130101) Original (OR) Class C07K 2317/76 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221271 | Xu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of South Carolina (Columbia, South Carolina) |
| ASSIGNEE(S) | University of South Carolina (Columbia, South Carolina) |
| INVENTOR(S) | Peisheng Xu (Chapin, South Carolina); Huacheng He (Columbia, South Carolina) |
| ABSTRACT | Polymer/copper combinations that can selectively target and kill cancer cells are described. Materials can include the reaction product of a biocompatible hydrophilic polymer and pyridine-2-thiol containing monomer. The copolymer reaction product can include pyridine-2-thiol side groups pendant to the backbone via a disulfide linkage. The hydrophilic component can form the polymer backbone and/or can form hydrophilic pendant groups off of the backbone. Copper ions can be associated with the copolymer. |
| FILED | Friday, October 13, 2017 |
| APPL NO | 15/783282 |
| ART UNIT | 1613 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/00 (20130101) A61K 31/795 (20130101) A61K 31/795 (20130101) A61K 33/34 (20130101) A61K 33/34 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 220/28 (20130101) Original (OR) Class C08F 2220/282 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221393 | Melton et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| ASSIGNEE(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| INVENTOR(S) | Douglas A. Melton (Lexington, Massachusetts); Qiao Zhou (Lexington, Massachusetts) |
| ABSTRACT | The present invention provides methods of reprogramming cells, for example, directly reprogramming a somatic cell of a first cell type into a somatic cell of a second cell type, are described herein. In particular, the present invention generally relates to methods for reprogramming a cell of an endoderm origin to a cell having pancreatic β-cell characteristics. The present invention also relates to an isolated population comprising reprogrammed cells, compositions and their use in the treatment of diabetes mellitus. In particular, the present invention relates to reprogramming a cell of an endoderm origin to a cell having pancreatic β-cell characteristics by increasing the protein expression of at least one transcription factor selected from Pdx1, Ngn3 or MafA in the cell of endoderm origin to reprogram the cell of an endoderm cell to a cell which exhibits at least one or at least two characteristics of an endogenous pancreatic β-cell. |
| FILED | Monday, June 19, 2017 |
| APPL NO | 15/627381 |
| ART UNIT | 1653 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0676 (20130101) Original (OR) Class C12N 2501/60 (20130101) C12N 2799/022 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221394 | Wamhoff et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | HemoShear, LLC (Charlottesville, Virginia) |
| ASSIGNEE(S) | HemoShear, LLC (Charlottesville, Virginia) |
| INVENTOR(S) | Brian R. Wamhoff (Charlottesville, Virginia); Brett R. Blackman (Charlottesville, Virginia); Robert A. Figler (Earlysville, Virginia); Daniel G. Gioeli (Charlottesville, Virginia); Michael B. Simmers (Charlottesville, Virginia) |
| ABSTRACT | Methods for mimicking a tumor microenvironment in vitro are provided. The methods comprise indirectly applying a shear stress upon at least one tumor cell type plated on a surface within a cell culture container. Methods for mimicking tumor metastasis and methods for testing drugs or compounds in such systems are also provided. |
| FILED | Monday, April 10, 2017 |
| APPL NO | 15/483010 |
| ART UNIT | 1655 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/067 (20130101) C12N 5/0693 (20130101) Original (OR) Class C12N 5/0697 (20130101) C12N 2502/28 (20130101) C12N 2502/30 (20130101) C12N 2502/1323 (20130101) C12N 2503/04 (20130101) C12N 2521/00 (20130101) C12N 2533/54 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221402 | Rosenberg |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yvonne Rosenberg (Washington, District of Columbia) |
| ASSIGNEE(S) | PlantVax, Inc. (Rockville, Maryland) |
| INVENTOR(S) | Yvonne Rosenberg (Washington, District of Columbia) |
| ABSTRACT | Disclosed herein are methods for the large-scale production of a highly thermally stable acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Additionally, the expression methods disclosed herein can produce ChE preparations consisting of extract or purified forms that can be produced in high amounts and are highly thermally stable. These ChE products can be used in vitro detection, detoxification and decontamination methods. |
| FILED | Saturday, March 14, 2015 |
| APPL NO | 15/126296 |
| ART UNIT | 1663 — Plants |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/465 (20130101) A61K 47/36 (20130101) Chemical Means for Extinguishing Fires or for Combating or Protecting Against Harmful Chemical Agents; Chemical Materials for Use in Breathing Apparatus A62D 3/02 (20130101) A62D 2101/02 (20130101) A62D 2101/26 (20130101) Peptides C07K 7/08 (20130101) C07K 2319/04 (20130101) C07K 2319/21 (20130101) C07K 2319/43 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/18 (20130101) Original (OR) Class Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/46 (20130101) Enzymes C12Y 301/01008 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221415 | Sharma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | West Virginia University (Morgantown, West Virginia) |
| ASSIGNEE(S) | West Virginia University (Morgantown, West Virginia) |
| INVENTOR(S) | Sriganesh B. Sharma (Morgantown, West Virginia); Chen-Chung Lin (Morgantown, West Virginia); Mark K. Farrugia (Morgantown, West Virginia); J. Michael Ruppert (Bruceton Mills, West Virginia) |
| ABSTRACT | The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs. |
| FILED | Wednesday, August 31, 2016 |
| APPL NO | 15/252865 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 31/713 (20130101) A61K 31/713 (20130101) A61K 35/13 (20130101) A61K 2300/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/14 (20130101) C12N 2310/113 (20130101) C12N 2310/141 (20130101) C12N 2310/531 (20130101) C12N 2320/31 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221419 | Sharp et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ALBERT EINSTEIN COLLGE OF MEDICINE, INC. (Bronx, New York) |
| ASSIGNEE(S) | Albert Einstein College of Medicine, Inc. (Bronx, New York) |
| INVENTOR(S) | David J. Sharp (Scarsdale, New York); Rabab Charafeddine (Bronx, New York) |
| ABSTRACT | Methods of treating a wound in a subject are provided comprising administering to the subject an amount of an inhibitor of Fidgetin-like 2. Compositions and pharmaceutical compositions comprising an amount of an inhibitor of Fidgetin-like 2 are also provided. Methods are also provided for identifying an inhibitor of Fidgetin-like 2. |
| FILED | Monday, March 12, 2018 |
| APPL NO | 15/917968 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/06 (20130101) A61K 9/0014 (20130101) A61K 9/127 (20130101) A61K 31/713 (20130101) A61K 31/7105 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) C12N 15/1137 (20130101) Original (OR) Class C12N 2310/14 (20130101) C12N 2320/30 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221422 | Gardner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Kevin H. Gardner (Dallas, Texas); Laura B. Motta-Mena (Dallas, Texas); Brian D. Zotowski (Dallas, Texas) |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| INVENTOR(S) | Kevin H. Gardner (Dallas, Texas); Laura B. Motta-Mena (Dallas, Texas); Brian D. Zotowski (Dallas, Texas) |
| ABSTRACT | The present invention provides methods for light-dependent gene regulation using a light-responsive DNA-binding protein. Also provided are related nucleic acid molecules, and protein molecules, such as those encoding or comprising the light-responsive DNA-binding protein or DNA-binding sites recognizing the light-responsive DNA-binding protein. Kits using the present light-dependent gene regulation system are further provided by the present invention. |
| FILED | Tuesday, November 01, 2016 |
| APPL NO | 15/340040 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Peptides C07K 2319/09 (20130101) C07K 2319/71 (20130101) C07K 2319/80 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/0069 (20130101) C12N 15/63 (20130101) C12N 15/625 (20130101) C12N 15/635 (20130101) Original (OR) Class C12N 2840/002 (20130101) Enzymes C12Y 113/12007 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221443 | Meldrum et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Deirdre Meldrum (Phoenix, Arizona); Shih-Hui (Joseph) Chao (Phoenix, Arizona); Thai Tran (Phoenix, Arizona); Laimonas Kelbauskas (Gilbert, Arizona); Jeff Houkal (Los Angeles, California); Andrew Hatch (Tempe, Arizona); Weimin Gao (Chandler, Arizona); David Richardson (Chandler, Arizona) |
| ABSTRACT | Systems and methods for in situ laser lysis for analysis of biological tissue (live, fixed, frozen or otherwise preserved) at single cell resolution in 3D. For example, a system and method for lysing individual cells in situ, including the steps of capturing a tissue sample comprising a cellular content, subjecting the tissue sample to a stream of continuous fluid flow, lysing a selected area of the tissue sample with a laser, thereby releasing at least a portion of the cellular content from the tissue sample, recovering at least one target molecule from the cellular content in the stream, and processing at least one target molecule is provided. The system collects cellular contents, performs highly multiplexed (RT-qPCR or RNA-seq), and sequentially (cell-by-cell) reconstructs a 3D spatial map of mRNA expression of the tissue with a large number of genes. A 3D spatial map of the DNA, RNA, and/or proteins can be generated for each cell in the tissue. |
| FILED | Thursday, April 21, 2016 |
| APPL NO | 15/135150 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/0293 (20130101) B01L 3/502761 (20130101) B01L 2200/0668 (20130101) B01L 2300/0816 (20130101) B01L 2300/0829 (20130101) B01L 2300/0864 (20130101) Apparatus for Enzymology or Microbiology; C12M 47/06 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/686 (20130101) C12Q 1/6806 (20130101) Original (OR) Class C12Q 1/6841 (20130101) C12Q 1/6848 (20130101) C12Q 1/6848 (20130101) C12Q 2547/101 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/286 (20130101) G01N 2001/2886 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221459 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Case Western Reserve University (Cleveland, Ohio) |
| ASSIGNEE(S) | Case Western Reserve University (Cleveland, Ohio) |
| INVENTOR(S) | Zhengne Wang (Cleveland, Ohio); Yujun Hao (Cleveland Heights, Ohio) |
| ABSTRACT | A method of treating cancer cells having mutated PIK3CA gene or protein of a subject in need thereof includes administering to the subject a therapeutically effective amount of an inhibitor of one or more enzymes of the glutamine metabolism pathway. |
| FILED | Wednesday, May 13, 2015 |
| APPL NO | 14/711507 |
| ART UNIT | 1642 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/195 (20130101) A61K 31/353 (20130101) A61K 31/433 (20130101) A61K 31/501 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6886 (20130101) Original (OR) Class C12Q 2600/106 (20130101) C12Q 2600/156 (20130101) C12Q 2600/158 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/57484 (20130101) G01N 2333/91215 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221460 | Trobridge et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | WASHINGTON STATE UNIVERSITY (Pullman, Washington) |
| ASSIGNEE(S) | Washington State University (Pullman, Washington) |
| INVENTOR(S) | Grant D. Trobridge (Pullman, Washington); Arun Kumar Nalla (Pullman, Washington) |
| ABSTRACT | Provided herein are methods for the prognosis of prostate cancer progression in a patient by analyzing the gene expression in a tumor sample obtained from the patient the prognosis of prostate cancer progression in a patient by analyzing the gene expression in a tumor sample obtained from the patient. In particular, gene expression levels of GCOM1, MEX3D, TRPM4, ATPAF1, PTRF, GLYATL1, FLNA, OBSCN, STRA13, WHSC1, ARFGAP3, KDM2A, FAM83H, CLDN7, CNOT6, and B3GNT9 are measured. Kits containing means for the measurement of gene expression as described herein and methods for treatment of prostate cancer are also provided. |
| FILED | Wednesday, March 25, 2015 |
| APPL NO | 15/129841 |
| ART UNIT | 1642 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6886 (20130101) Original (OR) Class C12Q 2600/112 (20130101) C12Q 2600/118 (20130101) C12Q 2600/158 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/57434 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221461 | Robins et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Adaptive Biotechnologies Corp. (Seattle, Washington); Memorial Sloan-Kettering Cancer Center (New York, New York) |
| ASSIGNEE(S) | ADAPTIVE BIOTECHNOLOGIES CORP. (Seattle, Washington); MEMORIAL SLOAN-KETTERING CANCER CENTER (New York, New York) |
| INVENTOR(S) | Harlan S. Robins (Seattle, Washington); Julie Rubinstein (Seattle, Washington); Ryan Emerson (Seattle, Washington); Jianda Yuan (New York, New York) |
| ABSTRACT | Disclosed are methods for determining the immunological status of the adaptive immune system of a subject by identifying and quantifying rearranged DNA (and/or subsequently transcribed RNA) sequences encoding T cell receptor (TCR) and/or immunoglobulin (IG) polypeptides, in a lymphoid DNA-containing sample from the subject TCR and/or IG sequence diversity and sequence distribution permit immunocompetence and immune repertoire assessment and reflect the degree of T cell or B cell clonality and clerical expansion in the sample. Methods for stratifying patient populations on the basis of immunocompetence including likelihood of responding to immunotherapy are also described. |
| FILED | Thursday, June 29, 2017 |
| APPL NO | 15/637871 |
| ART UNIT | 1642 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6851 (20130101) C12Q 1/6851 (20130101) C12Q 1/6883 (20130101) C12Q 1/6886 (20130101) Original (OR) Class C12Q 2537/143 (20130101) C12Q 2600/16 (20130101) C12Q 2600/106 (20130101) C12Q 2600/156 (20130101) Electric Digital Data Processing G06F 19/12 (20130101) G06F 19/22 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222335 | Stringari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Chiara Stringari (Irvine, California); Enrico Gratton (San Clemente, California); Michelle Digman (Irvine, California); Peter Donovan (Irvine, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Chiara Stringari (Irvine, California); Enrico Gratton (San Clemente, California); Michelle Digman (Irvine, California); Peter Donovan (Irvine, California) |
| ABSTRACT | A label-free imaging method to monitor stem cell metabolism discriminates different states of stem cell as they differentiate in a living tissues. We use intrinsic fluorescence biomarkers and the phasor approach to Fluorescence Lifetime Imaging Microscopy (FLIM). We identify and map intrinsic fluorophores such as collagen, retinol, retinoic acid, flavins, nicotinamide adenine dinucleotide (NADH) and porphyrin. We measure the phasor values of germ cells in C. Elegans germ line. Their metabolic fingerprint cluster according to their differentiation state, reflecting changes in FAD concentration and NADH binding during the differentiation pathway. The phasor approach to lifetime imaging provides a label-free, fit-free and sensitive method to identify different metabolic state of cells during differentiation, to sense small changes in the redox state of cells and may identify symmetric and asymmetric divisions and predict cell fate. |
| FILED | Thursday, October 27, 2011 |
| APPL NO | 13/283356 |
| ART UNIT | 1631 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/6408 (20130101) G01N 21/6458 (20130101) G01N 21/6486 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222366 | Everson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Colorado, a body corporate (Denver, Colorado) |
| ASSIGNEE(S) | The Regents of the University of Colorado, a body corporate (Denver, Colorado) |
| INVENTOR(S) | Gregory Thomas Everson (Englewood, Colorado); Steve Mark Helmke (Denver, Colorado) |
| ABSTRACT | A method for estimating portal blood flow and hepatic function in a subject is provided. In one example, the STAT test is an in vitro simplified, convenient test intended for screening purposes that can reasonably estimate the portal blood flow from a single blood sample taken 60 minutes after orally administered deuterated-cholate. The test can be administered to a patient having, or suspected of having, Chronic Hepatitis C, Primary Sclerosing Cholangitis (PSC), Non-Alcoholic Fatty Liver Disease (NAFLD), or any chronic liver disease. |
| FILED | Monday, September 12, 2016 |
| APPL NO | 15/263020 |
| ART UNIT | 1653 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Containers Specially Adapted for Medical or Pharmaceutical Purposes; Devices or Methods Specially Adapted for Bringing Pharmaceutical Products into Particular Physical or Administering Forms; Devices for Administering Food or Medicines Orally; Baby Comforters; Devices for Receiving Spittle A61J 1/05 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/49 (20130101) Original (OR) Class G01N 33/92 (20130101) G01N 2800/085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222374 | Sindhi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The University of Pittsburgh Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | Univeersity of Pittsburgh Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Rakesh Sindhi (Pittsburgh, Pennsylvania); Chethan Ashokkumar (Pittsburgh, Pennsylvania) |
| ABSTRACT | Disclosed herein are methods for diagnosing or predicting B-cell rejection in a subject. In one example, for assessing transplant rejection, the method includes determining an antigen presenting index by comparing uptake of a donor antigen to uptake of a reference antigen in a biological sample obtained from the subject. In another example, for assessing GVHD, the method includes determining an antigen presenting index by comparing uptake of a recipient antigen to uptake of a reference antigen in a biological sample obtained from the subject. |
| FILED | Wednesday, August 09, 2017 |
| APPL NO | 15/673289 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/582 (20130101) G01N 33/56972 (20130101) G01N 33/56977 (20130101) Original (OR) Class G01N 2333/70578 (20130101) G01N 2333/70596 (20130101) G01N 2800/50 (20130101) G01N 2800/245 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222386 | Worley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland) |
| ASSIGNEE(S) | The Johns Hopkins University (Baltimore, Maryland) |
| INVENTOR(S) | Paul F. Worley (Baltimore, Maryland); DeSheng Xu (Lutherville-Timonium, Maryland); Meifang Xiao (Baltimore, Maryland) |
| ABSTRACT | The present invention relates to the field of cognitive function. More specifically, the present invention provides compositions and methods useful for assessing cognitive dysfunction/function in Alzheimer's disease and other diseases of cognition. In one embodiment, the method comprises the steps of (a) reducing heterocomplexes comprising NPTX1 and NPTX2 present in a biological sample obtained from the patient into NPTX1 and NPTX2 monomers; (b) covalently modifying the thiol groups of the NPTX1 and NPTX2 monomers to prevent re-formation of NPTX1/NPTX2 heterocomplexes; (c) detecting NPTX2 in the sample; and (d) assessing cognitive function in the patient by comparing NPTX2 detected in the sample to a control. |
| FILED | Friday, September 18, 2015 |
| APPL NO | 15/511860 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 16/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/53 (20130101) G01N 33/566 (20130101) G01N 33/6851 (20130101) G01N 33/6896 (20130101) Original (OR) Class G01N 2800/2821 (20130101) G01N 2800/2835 (20130101) Electric Digital Data Processing G06F 19/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222390 | Glass et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Curators of the University of Missouri (Columbia, Missouri) |
| ASSIGNEE(S) | THE CURATORS OF THE UNIVERSITY OF MISSOURI (Columbia, Missouri) |
| INVENTOR(S) | Timothy Glass (Columbia, Missouri); Kenneth Hettie (Columbia, Missouri) |
| ABSTRACT | A fluorescence sensing compound for separately detecting and visualizing one or more monoamine neurotransmitters in cells, the fluorescence sensing compound having the following formula: wherein R1 and R2 are each independently selected from the group consisting of hydrogen, alkyl, alkylene, aryl, cycloalkyl; wherein R3 is selected from the group consisting of hydrogen, alkyl, alkylene, aryl, cycloalkyl, cyano, azido; and wherein R4 is selected from the group consisting of (CH3)2Si, O, N, S, and CH2. |
| FILED | Friday, August 05, 2016 |
| APPL NO | 15/229716 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Organic Dyes or Closely-related Compounds for Producing Dyes; Mordants; Lakes C09B 57/02 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/06 (20130101) C09K 11/07 (20130101) C09K 2211/1048 (20130101) C09K 2211/1051 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/582 (20130101) G01N 33/942 (20130101) Original (OR) Class G01N 33/9406 (20130101) G01N 33/9413 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222391 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Johns Hopkins University (Baltimore, Maryland) |
| ASSIGNEE(S) | The Johns Hopkins University (Baltimore, Maryland); Pioneer Hi-Bred International, Inc. (Johnston, Iowa) |
| INVENTOR(S) | Tza-Huei Wang (Timonium, Maryland); Tushar Dnyandeo Rane (Baltimore, Maryland); Helena Claire Zec (Baltimore, Maryland); Wen-Chy Chu (Baltimore, Maryland) |
| ABSTRACT | A continuous throughput microfluidic system includes an input system configured to provide a sequential stream of sample plugs; a droplet generator arranged in fluid connection with the input system to receive the sequential stream of sample plugs and configured to provide an output stream of droplets; a droplet treatment system arranged in fluid connection with the droplet generator to receive the output stream of droplets in a sequential order and configured to provide a stream of treated droplets in the sequential order; a detection system arranged to obtain detection signals from the treated droplets in the sequential order; a control system configured to communicate with the input system, the droplet generator, and the droplet treatment system; and a data processing and storage system configured to communicate with the control system and the detection system. |
| FILED | Friday, December 07, 2012 |
| APPL NO | 13/708510 |
| ART UNIT | 1798 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 19/0046 (20130101) Chemical or Physical Laboratory Apparatus for General Use B01L 3/0241 (20130101) B01L 3/0265 (20130101) B01L 3/502715 (20130101) B01L 3/502784 (20130101) B01L 2200/14 (20130101) B01L 2200/027 (20130101) B01L 2200/143 (20130101) B01L 2200/147 (20130101) B01L 2200/0673 (20130101) B01L 2300/18 (20130101) B01L 2300/0829 (20130101) B01L 2300/0838 (20130101) B01L 2300/0883 (20130101) B01L 2300/1822 (20130101) Combinatorial Chemistry; Libraries, e.g Chemical Libraries C40B 60/12 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/28 (20130101) G01N 35/08 (20130101) Original (OR) Class G01N 35/00029 (20130101) G01N 35/00871 (20130101) G01N 2035/00148 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222438 | Weaver et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Trustees of Dartmouth College (Hanover, New Hampshire) |
| ASSIGNEE(S) | THE TRUSTEES OF DARTMOUTH COLLEGE (Hanover, New Hampshire) |
| INVENTOR(S) | John B. Weaver (Hanover, New Hampshire); Alexander Hartov (Enfield, New Hampshire) |
| ABSTRACT | A system for measuring responses of magnetic nanoparticles has static magnetic bias field along first axis, and AC driving coils providing AC magnetic field along second axis perpendicular to the first axis, both fields passing through an imaging zone. Sensing coils are oriented to sense fields parallel to the first axis, but not parallel to the second axis. A processor determines responses of nanoparticles in the imaging zone to the AC field. Another system has DC bias on first axis and AC driving coils providing an AC magnetic field along a second axes, magnetic gradient oriented along the first and/or second axis, and the second axis is rotated mechanically or electronically. The signal processor provides a voxel-based model of magnetic nanoparticle distribution in imaging zone. In some embodiments, the static magnet is a main magnet of a magnetic resonance imaging system. |
| FILED | Friday, November 01, 2013 |
| APPL NO | 14/440268 |
| ART UNIT | 3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 33/1276 (20130101) G01R 33/4808 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222489 | Fu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | General Electric Company (Schenectady, New York) |
| ASSIGNEE(S) | GENERAL ELECTRIC COMPANY (Schenectady, New York) |
| INVENTOR(S) | Geng Fu (Rexford, New York); Xue Rui (Clifton Park, New York); Yannan Jin (Schenectady, New York); Jianjun Guo (Ballston Spa, New York); Peter Michael Edic (Albany, New York); Brian David Yanoff (Schenectady, New York) |
| ABSTRACT | The present approach relates to the use of reference pixels provided between the primary pixels of a detector panel. Coincidence circuitry or logic may be employed so that the measured signal arising from the same X-ray event may be properly, that is the signal measured at both a reference and primary pixel may be combined so as to provide an accurate estimate of the measured signal, at an appropriate location on the detector panel. |
| FILED | Monday, March 13, 2017 |
| APPL NO | 15/457558 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Measurement of Nuclear or X-radiation G01T 1/241 (20130101) G01T 1/247 (20130101) Original (OR) Class G01T 1/366 (20130101) G01T 7/005 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222605 | Kim et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | California Institute of Technology (Pasadena, California) |
| INVENTOR(S) | Jinho Kim (Pasadena, California); Changhuei Yang (South Pasadena, California) |
| ABSTRACT | In one aspect an imaging system includes: an illumination system including an array of light sources; an optical system including one or more lens arrays, each of the lens arrays including an array of lenses, each of the lenses in each of the one or more lens arrays in alignment with a corresponding set of light sources of the array of light sources; an imaging system including an array of image sensors, each of the image sensors in alignment with a corresponding lens or set of lenses of the one or more lens arrays, each of the image sensors configured to acquire image data based on the light received from the corresponding lens or set of lenses; a plate receiver system capable of receiving a multi-well plate including an array of wells, the plate receiver system configured to align each of the wells with a corresponding one of the image sensors; and a controller configured to control the illumination of the light sources and the acquisition of image data by the image sensors, the controller further configured to perform: an image acquisition process including a plurality of scans, each scan associated with a unique pattern of illumination, each of the image sensors configured to generate an image for a respective one of the wells during each scan; and an image reconstruction process during which the controller performs a fourier ptychographic operation to generate a reconstructed image for each of the wells based on the image data captured for the respective well during each of the scans. |
| FILED | Wednesday, June 28, 2017 |
| APPL NO | 15/636494 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/6452 (20130101) G01N 21/6456 (20130101) G01N 21/6458 (20130101) G01N 2021/6478 (20130101) G01N 2201/0446 (20130101) Optical Elements, Systems, or Apparatus G02B 13/0095 (20130101) G02B 21/16 (20130101) G02B 21/0076 (20130101) G02B 21/365 (20130101) Original (OR) Class Pictorial Communication, e.g Television H04N 5/2256 (20130101) H04N 5/2258 (20130101) H04N 5/22541 (20180801) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222694 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Fengwei Huo (Evanston, Illinois); Zijian Zheng (Kowloon, China PRC); Gengfeng Zheng (Ambler, Pennsylvania) |
| ABSTRACT | The disclosure relates to methods of printing indicia on a substrate using a tip array comprised of elastomeric, compressible polymers. The tip array can be prepared using conventional photolithographic methods and can be tailored to have any desired number and/or arrangement of tips. Numerous copies (e.g., greater than 15,000, or greater than 11 million) of a pattern can be made in a parallel fashion in as little as 40 minutes. |
| FILED | Thursday, May 19, 2016 |
| APPL NO | 15/159148 |
| ART UNIT | 2854 — Printing/Measuring and Testing |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 10/00 (20130101) B82Y 30/00 (20130101) B82Y 40/00 (20130101) Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor; G03F 7/0002 (20130101) Original (OR) Class Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/856 (20130101) Y10S 977/874 (20130101) Y10S 977/878 (20130101) Y10S 977/887 (20130101) Y10S 977/888 (20130101) Y10S 977/902 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223141 | Mars et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Jason Mars (Ann Arbor, Michigan); Michael Laurenzano (Dexter, Michigan); Lingjia Tang (Ann Arbor, Michigan) |
| ABSTRACT | A system is provided for monitoring, regenerating and replacing the code of running applications with semantically equivalent, specialized code versions that reflect the demands of the execution environment. The system includes a co-designed compiler and runtime system that virtualizes a selected set of edges in a host program, where these edges provide hooks through which the runtime system may redirect execution into an intermediate representation utilized to optimize introspective and extrospective processes. |
| FILED | Thursday, February 09, 2017 |
| APPL NO | 15/428917 |
| ART UNIT | 2197 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 8/443 (20130101) G06F 9/4552 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223634 | Sussillo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | David Sussillo (Portola Valley, California); Jonathan C. Kao (Stanford, California); Sergey Stavisky (San Francisco, California); Krishna V. Shenoy (Palo Alto, California) |
| ABSTRACT | A brain machine interface (BMI) to control a device is provided. The BMI has a neural decoder, which is a neural to kinematic mapping function with neural signals as input to the neural decoder and kinematics to control the device as output of the neural decoder. The neural decoder is based on a continuous-time multiplicative recurrent neural network, which has been trained as a neural to kinematic mapping function. An advantage of the invention is the robustness of the decoder to perturbations in the neural data; its performance degrades less—or not at all in some circumstances—in comparison to the current state decoders. These perturbations make the current use of BMI in a clinical setting extremely challenging. This invention helps to ameliorate this problem. The robustness of the neural decoder does not come at the cost of some performance, in fact an improvement in performance is observed. |
| FILED | Friday, August 14, 2015 |
| APPL NO | 14/826300 |
| ART UNIT | 2122 — AI & Simulation/Modeling |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/04001 (20130101) Computer Systems Based on Specific Computational Models G06N 3/0445 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223813 | Brokish et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | InstaRecon, Inc. (Urbana, Illinois) |
| ASSIGNEE(S) | InstaRecon (Urbana, Illinois) |
| INVENTOR(S) | Jeffrey Brokish (Savoy, Illinois); Yoram Bresler (Urbana, Illinois) |
| ABSTRACT | Methods and systems for computed tomography. A subject is imaged with a divergent beam source using a plurality of source positions and a detector array comprising a plurality of detector bins to obtain a representation of the subject including a plurality of image voxels. Contribution of a voxel to a detector bin in a computed forward projection or a detector bin to a voxel in a backprojection is determined by the intensity value assigned to the voxel, or to the detector bin, respectively, multiplied by the product of an area or volume of overlap and an additional weighting factor, and the area or volume of overlap is determined by overlap of the voxel with the area or volume of the image illuminated by a ray-wedge defined by detector bin edge rays. |
| FILED | Wednesday, August 10, 2016 |
| APPL NO | 15/233615 |
| ART UNIT | 2666 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 11/005 (20130101) G06T 11/006 (20130101) Original (OR) Class G06T 11/008 (20130101) G06T 2207/10081 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224194 | Ibrahim et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Battelle Memorial Institute (Richland, Washington) |
| ASSIGNEE(S) | Battelle Memorial Institute (Richland, Washington) |
| INVENTOR(S) | Yehia M. Ibrahim (Richland, Washington); Richard D. Smith (Richland, Washington) |
| ABSTRACT | An apparatus includes a first pair of opposing electrode arrangements that confine ions between them in a portion of a confinement volume inwardly laterally in a first confinement direction with respect to a longitudinal ion propagation direction, each opposing electrode arrangement including an arrangement of RF electrodes situated to receive an unbiased RF voltage having an alternate phase between adjacent RF electrodes of the arrangement of RF electrodes so as to provide the confining of ions between the first pair of opposing electrode arrangements, and a second pair of opposing electrode arrangements that confine the ions between the second pair in the confinement volume inwardly laterally in a second confinement direction that complements the first confinement direction, each opposing electrode arrangement of the second pair including an arrangement of RF electrodes that receive an unbiased RF voltage having an alternate phase between adjacent RF electrodes. |
| FILED | Thursday, September 08, 2016 |
| APPL NO | 15/260046 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 49/062 (20130101) H01J 49/063 (20130101) H01J 49/065 (20130101) H01J 49/0095 (20130101) Original (OR) Class H01J 49/4235 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US RE47267 | Maeda et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Syntrix Biosystems, Inc. (Auburn, Washington) |
| ASSIGNEE(S) | Syntrix Biosystems, Inc. (Auburn, Washington) |
| INVENTOR(S) | Dean Y. Maeda (Seattle, Washington); John A Zebala (Issaquah, Washington) |
| ABSTRACT | There is disclosed pyridine-and pyrimidinecarboxamide compounds useful as pharmaceutical agents, synthesis processes, and pharmaceutical compositions which include pyridine-and pyrimidinecarboxamides compounds. More specifically, there is disclosed a genus of CXCR2 inhibitor compounds that are useful for treating a variety of inflammatory and neoplastic disorders. |
| FILED | Wednesday, June 08, 2016 |
| APPL NO | 15/177218 |
| ART UNIT | 3991 — Central Reexamination Unit (Chemical) |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/44 (20130101) A61K 31/69 (20130101) A61K 31/444 (20130101) A61K 31/4439 (20130101) Heterocyclic Compounds C07D 213/82 (20130101) Original (OR) Class C07D 401/12 (20130101) C07D 413/12 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 5/025 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Defense (DOD)
| US 10219575 | Stringfellow et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | TIAX LLC (Lexington, Massachusetts) |
| ASSIGNEE(S) | TIAX LLC (Lexington, Massachusetts) |
| INVENTOR(S) | Richard Stringfellow (Winchester, Massachusetts); Simona Socrate (Winchester, Massachusetts); Jacky Lau (Woburn, Massachusetts) |
| ABSTRACT | A structured material for impact protection includes a plurality of tubular members formed from a thermoplastic elastomer material. The plurality of tubular members are arranged in a bundle such that the central axes of the plurality of tubular members are substantially parallel, and adjacent tubular members are secured to one another along their length. A method of forming a structured impact protection material includes arranging a plurality of tubes formed from a thermoplastic elastomer material into a selected shape. The tubes are arranged in a layer with central axes of the plurality of tubes aligned to be parallel to each other. Heat is applied to adjacent first end portions of tubes of plurality of tubes and the adjacent first end portions are secured to each other via thermal bond. Heat is applied to adjacent second end portions of the tubes and the adjacent second end portions are secured to each other via thermal bond. |
| FILED | Tuesday, August 20, 2013 |
| APPL NO | 13/971269 |
| ART UNIT | 3765 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Hats; Head Coverings A42B 3/124 (20130101) Original (OR) Class Technical Subjects Covered by Former US Classification Y10T 428/24149 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219697 | Muller |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California); Cortera Neurotechnologies, Inc. (Berkeley, California) |
| INVENTOR(S) | Rikky Muller (Kirkland, Washington) |
| ABSTRACT | Systems and methods for biosignal acquisition, and in particular, electrocorticography signal acquisition, are disclosed for small area, low noise recording and digitization of brain signals from electrode arrays. |
| FILED | Tuesday, February 16, 2016 |
| APPL NO | 15/044965 |
| ART UNIT | 2632 — Digital Communications |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0006 (20130101) Original (OR) Class A61B 5/048 (20130101) A61B 5/0476 (20130101) A61B 5/0478 (20130101) A61B 5/04004 (20130101) A61B 5/04017 (20130101) A61B 5/7203 (20130101) A61B 5/7228 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/3704 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 27/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219811 | Haider et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Hani Haider (Carter Lake, Iowa); Ibrahim Al-Shawi (Amman, Jordan); Osvaldo Andres Barrera (Omaha, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Hani Haider (Carter Lake, Iowa); Ibrahim Al-Shawi (Amman, Jordan); Osvaldo Andres Barrera (Omaha, Nebraska) |
| ABSTRACT | A number of improvements are provided relating to computer aided surgery utilizing an on tool tracking system. The various improvements relate generally to both the methods used during computer aided surgery and the devices used during such procedures. Other improvements relate to the structure of the tools used during a procedure and how the tools can be controlled using the OTT device. Still other improvements relate to methods of providing feedback during a procedure to improve either the efficiency or quality, or both, for a procedure including the rate of and type of data processed depending upon a CAS mode. |
| FILED | Wednesday, June 27, 2012 |
| APPL NO | 14/128213 |
| ART UNIT | 3775 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/142 (20161101) A61B 17/1626 (20130101) A61B 17/1675 (20130101) A61B 17/1703 (20130101) Original (OR) Class A61B 17/1764 (20130101) A61B 34/20 (20160201) A61B 34/30 (20160201) A61B 34/32 (20160201) A61B 34/76 (20160201) A61B 2034/102 (20160201) A61B 2034/2057 (20160201) A61B 2090/064 (20160201) A61B 2090/366 (20160201) A61B 2090/371 (20160201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219870 | Mondry et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nabraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Jack Mondry (Edina, Minnesota); Shane Farritor (Lincoln, Nebraska); Eric Markvicka (Brush, Colorado); Thomas Frederick (Lincoln, Nebraska); Joe Bartels (Lincoln, Nebraska) |
| ABSTRACT | Disclosed herein are various medical device components, including components that can be incorporated into robotic and/or in vivo medical devices. Also disclosed are various medical devices for in vivo medical procedures. Included herein, for example, is a surgical robotic device having an elongate device body, a right robotic arm coupled to a right shoulder assembly, and a left robotic arm coupled to a left shoulder assembly. |
| FILED | Monday, November 21, 2016 |
| APPL NO | 15/357663 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/00234 (20130101) A61B 34/20 (20160201) A61B 34/30 (20160201) Original (OR) Class A61B 90/361 (20160201) A61B 2017/2906 (20130101) A61B 2034/302 (20160201) A61B 2034/2048 (20160201) A61B 2034/2051 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/0084 (20130101) B25J 9/0087 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219919 | Belter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | YALE UNIVERSITY (New Haven, Connecticut) |
| INVENTOR(S) | Joseph Thomas Belter (New Haven, Connecticut); Aaron Michael Dollar (New Haven, Connecticut); Michael Leddy (New Haven, Connecticut); Kevin Dale Gemmell, Jr. (San Diego, California) |
| ABSTRACT | The present invention provides a prosthetic hand capable of multiple grasp types. The prosthetic finger units are underactuated both within and between the finger units using a differential mechanism arrangement. The locking movement of the prosthetic thumb unit is coupled to the differential mechanism. As the user repositions the prosthetic thumb unit, the differential mechanism is effected as to alter both the initial positions and force distribution of the prosthetic finger units. The present invention further provides an additive manufacturing molding method for making the same. |
| FILED | Thursday, August 18, 2016 |
| APPL NO | 15/240819 |
| ART UNIT | 3774 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/68 (20130101) A61F 2/72 (20130101) A61F 2/583 (20130101) Original (OR) Class A61F 2/586 (20130101) A61F 2/5044 (20130101) A61F 2/5046 (20130101) A61F 2002/701 (20130101) A61F 2002/5075 (20130101) A61F 2002/5093 (20130101) A61F 2002/6872 (20130101) A61F 2005/563 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220051 | Bellacosa et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Institute for Cancer Research (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | Institute For Cancer Research (, None) |
| INVENTOR(S) | Alfonso Bellacosa (Philadelphia, Pennsylvania); Timothy Yen (Haverford, Pennsylvania); Neil Beeharry (Philadelphia, Pennsylvania); Mitchell Smith (Elkins Park, Pennsylvania); Rossella Tricarico (Philadelphia, Pennsylvania); Vikram Bhattacharjee (Philadelphia, Pennsylvania); Pietro Mancuso (Philadelphia, Pennsylvania) |
| ABSTRACT | The invention provides methods for enhancing the cytotoxicity of DNA damage in cancer cells that express thymine DNA glycosylase, and treating tumors accordingly. The methods comprise inhibiting the expression or biologic activity of thymine DNA glycosylase, and inducing DNA damage in the cancer cells. DNA damage may be induced by administration of bendamustine or gemcitabine to the cancer cells. |
| FILED | Thursday, November 13, 2014 |
| APPL NO | 14/540428 |
| ART UNIT | 1629 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/122 (20130101) A61K 31/277 (20130101) A61K 31/546 (20130101) A61K 31/4184 (20130101) A61K 31/4184 (20130101) A61K 31/7068 (20130101) Original (OR) Class A61K 31/7068 (20130101) A61K 31/7088 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1137 (20130101) C12N 2310/14 (20130101) C12N 2320/31 (20130101) Enzymes C12Y 302/02029 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220084 | Ficht et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Texas A and M University System (College Station, Texas) |
| ASSIGNEE(S) | THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas) |
| INVENTOR(S) | Thomas A. Ficht (College Station, Texas); Allison Ficht (College Station, Texas); Renee Tsolis (Davis, California); Leslie Garry Adams (College Station, Texas) |
| ABSTRACT | Methods and compositions for the treatment of Brucella induced diseases and disorders are disclosed herein. In preferred embodiments, the invention relates to vaccines. In additional embodiments, the invention relates to formulations capable of releasing said vaccines at a controlled rate of release in vivo. In further embodiments, the invention relates to modified strains of the bacteria Brucella melitensis and Brucella abortus. In still further embodiments, the invention relates to compositions that do not induce clinical symptoms or splenomegaly in a subject receiving said compositions. |
| FILED | Tuesday, December 15, 2015 |
| APPL NO | 14/969882 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/098 (20130101) Original (OR) Class A61K 2039/54 (20130101) A61K 2039/522 (20130101) A61K 2039/541 (20130101) A61K 2039/622 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56911 (20130101) G01N 2333/23 (20130101) G01N 2469/20 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220089 | Hsiao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| INVENTOR(S) | Elaine Hsiao (Rowland Heights, California); Sarkis K Mazmanian (Porter Ranch, California); Paul H Patterson (Altadena, California); Sara McBride (Pasadena, California) |
| ABSTRACT | Disclosed herein are compositions, systems, and methods for diagnosing and treatment of subjects suffering from anxiety, autism spectrum disorder (ASD), or a pathological condition with one or more of the symptoms of ASD. |
| FILED | Wednesday, August 28, 2013 |
| APPL NO | 14/012769 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/74 (20130101) A61K 35/741 (20130101) A61K 39/3955 (20130101) Original (OR) Class A61K 2039/505 (20130101) Peptides C07K 16/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) G01N 2800/28 (20130101) G01N 2800/7076 (20130101) G01N 2800/7085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220351 | Tuteja et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan); The United States of America, as represented by the Secretary of the Air Force (Washington, District of Columbia) |
| ASSIGNEE(S) | The Regents of The University of Michigan (Ann Arbor, Michigan); The United States of America, as represented by the Secretary of the Air Force (Washington, District of Columbia) |
| INVENTOR(S) | Anish Tuteja (Ann Arbor, Michigan); Arun Kumar Kota (Ann Arbor, Michigan); Gibum Kwon (Ann Arbor, Michigan); Joseph M. Mabry (Lancaster, California) |
| ABSTRACT | The present disclosure provides a porous material having a surface that is concurrently both superhydrophilic (having a first apparent advancing dynamic contact angle of less than or equal to about 5° for water) and oleophobic (having a second apparent advancing dynamic contact angle of greater than or equal to about 90°) or superoleophobic (a second apparent advancing dynamic contact angle of greater than or equal to about 150° for oil). Such materials can be used in a separator device to separate a liquid-liquid mixture of immiscible components (e.g., oil and water) or miscible components (e.g., alcohols). Separation apparatus incorporating such materials and methods of making and using these materials are also provided. |
| FILED | Thursday, November 12, 2015 |
| APPL NO | 14/939953 |
| ART UNIT | 1777 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Separation B01D 69/02 (20130101) Original (OR) Class B01D 69/10 (20130101) B01D 69/12 (20130101) B01D 2325/36 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/40 (20130101) C02F 1/44 (20130101) C02F 2101/32 (20130101) C02F 2101/325 (20130101) Cracking Hydrocarbon Oils; Production of Liquid Hydrocarbon Mixtures, e.g by Destructive Hydrogenation, Oligomerisation, Polymerisation; Recovery of Hydrocarbon Oils From Oil-shale, Oil-sand, or Gases; Refining Mixtures Mainly Consisting of Hydrocarbons; Reforming of Naphtha; Mineral Waxes C10G 21/00 (20130101) C10G 31/09 (20130101) C10G 33/06 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/249953 (20150401) Y10T 428/249978 (20150401) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220364 | North et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of the Navy (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Stella H. North (Alexandria, Virginia); Evgeniya H. Lock (Annandale, Virginia); Scott G. Walton (Fairfax, Virginia); Chris Rowe Taitt (White Plains, Maryland) |
| ABSTRACT | Disclosed herein is a method of: treating an organic polymer with an electron beam-generated plasma; exposing the treated polymer to air or an oxygen- and hydrogen-containing gas, generating hydroxyl groups on the surface of the polymer; reacting the surface with an organosilane compound having a chloro, fluoro, or alkoxy group and a functional or reactive group that is less reactive with the surface than the chloro, fluoro, or alkoxy group; and covalently immobilizing a biomolecule to the functional or reactive group or a reaction product thereof. |
| FILED | Friday, April 13, 2018 |
| APPL NO | 15/952462 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 19/0046 (20130101) Original (OR) Class B01J 2219/00587 (20130101) B01J 2219/00596 (20130101) B01J 2219/00711 (20130101) B01J 2219/00725 (20130101) Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 59/14 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 7/16 (20130101) C08J 7/123 (20130101) C08J 2325/06 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/54353 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220468 | Bichsel |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Steven Lynn Bichsel (Arlington, Texas) |
| ASSIGNEE(S) | Lockheed Martin Corporation (Bethesda, Maryland) |
| INVENTOR(S) | Steven Lynn Bichsel (Arlington, Texas) |
| ABSTRACT | In one embodiment, a system includes a deposition system that comprises an energy source, a material feed, and an active guide. The system further includes a base platform and a control system communicatively coupled to the deposition system. The control system is configured to provide instructions to the deposition system to deposit one or more layers of material from the material feed onto a baseplate coupled to the base platform, thereby creating a structure. The control system is further configured to provide instructions to the deposition system to weld the material as it is deposited from the material feed using an energy beam from the energy source and to deploy the active guide to shape the material, thereby forming at least one shaped surface of the structure. |
| FILED | Thursday, October 15, 2015 |
| APPL NO | 14/884378 |
| ART UNIT | 3761 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Soldering or Unsoldering; Welding; Cladding or Plating by Soldering or Welding; Cutting by Applying Heat Locally, e.g Flame Cutting; Working by Laser Beam B23K 9/04 (20130101) B23K 9/173 (20130101) B23K 15/02 (20130101) B23K 15/0026 (20130101) B23K 15/0086 (20130101) Original (OR) Class B23K 26/14 (20130101) B23K 26/144 (20151001) B23K 26/342 (20151001) B23K 26/702 (20151001) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 30/00 (20141201) B33Y 50/02 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220520 | Hawkes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | Elliot W. Hawkes (San Francisco, California) |
| ABSTRACT | Grasping devices and mechanisms are provided capable of grasping onto flat or curved surfaces repeatably and releasably using synthetic dry adhesives. Applications of these devices can be found in a large variety of robotic applications. |
| FILED | Wednesday, May 20, 2015 |
| APPL NO | 15/308472 |
| ART UNIT | 1785 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Manipulators; Chambers Provided With Manipulation Devices B25J 15/008 (20130101) Original (OR) Class Aeroplanes; Helicopters B64C 25/52 (20130101) B64C 39/028 (20130101) B64C 2201/12 (20130101) B64C 2201/18 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/24802 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220916 | Hooper et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SPAWAR Systems Center Pacific (San Diego, California) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Ralph D. Hooper (Lemon Grove, California); William A. Chambers (Jamul, California); Jeffery T. Gilchrist (Cardiff, California) |
| ABSTRACT | An open water transport system for payloads and a method for transporting payloads. The system includes two sponsons substantially parallel to the other. The sponsons are spaced apart from each other and extending in a forward direction. A deck plate module is detachably mounted on top of each sponson. A superstructure may be detachably mounted to the deck plate modules. The superstructure may bear a weight of one or more payloads. The carriage assembly couples to the payload(s). The carriage assembly has an adjustment mechanism that permits an operator to redistribute the weight of a payload. The open water transport system is towed by another vehicle. |
| FILED | Wednesday, June 14, 2017 |
| APPL NO | 15/623152 |
| ART UNIT | 3617 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Ships or Other Waterborne Vessels; Equipment for Shipping B63B 1/121 (20130101) Original (OR) Class B63B 3/48 (20130101) B63B 7/082 (20130101) B63B 21/56 (20130101) B63B 25/002 (20130101) B63B 2001/123 (20130101) B63B 2211/02 (20130101) Offensive or Defensive Arrangements on Vessels; Mine-laying; Mine-sweeping; Submarines; Aircraft Carriers B63G 2008/002 (20130101) B63G 2008/005 (20130101) B63G 2008/008 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220930 | Bognar |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | John A. Bognar (Belgrade, Montana) |
| ASSIGNEE(S) | ANASPHERE, INC. (Belgrade, Montana) |
| INVENTOR(S) | John A. Bognar (Belgrade, Montana) |
| ABSTRACT | This invention relates to a thermal hydrogen generator and a process and system for generating hydrogen gas, more specifically to a process and system for generating hydrogen gas by thermally decomposing a metal hydride. |
| FILED | Tuesday, September 17, 2013 |
| APPL NO | 14/029174 |
| ART UNIT | 1734 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 7/00 (20130101) Lighter-than Air Aircraft B64B 1/58 (20130101) B64B 1/62 (20130101) Original (OR) Class Non-metallic Elements; Compounds Thereof; C01B 3/04 (20130101) Explosives or Thermic Compositions; Manufacture Thereof; Use of Single Substances as Explosives C06B 43/00 (20130101) C06B 45/00 (20130101) Meteorology G01W 1/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220939 | Min et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sikorsky Aircraft Corporation (Stratford, Connecticut) |
| ASSIGNEE(S) | SIKORSKY AIRCRAFT CORPORATION (Stratford, Connecticut) |
| INVENTOR(S) | ByungYoung Min (Glastonbury, Connecticut); Barbara Brenda Botros (Vernon, Connecticut); Razvan Virgil Florea (Manchester, Connecticut); Patrick Bowles (Glastonbury, Connecticut); Claude G. Matalanis (Longmeadow, Massachusetts); Brian E. Wake (South Glastonbury, Connecticut) |
| ABSTRACT | A rotary wing aircraft includes a fuselage having a plurality of surfaces. At least one engine is mounted in the fuselage. A rotor assembly includes a rotor shaft a plurality of rotor blades operatively connected to the rotor shaft. The rotor assembly includes a plurality of surface portions. An active air discharge opening extends through one of the plurality of surfaces of the fuselage and one of the plurality of surface portions of the rotor assembly, and an active air generation system is mounted in the fuselage. The active air generation system is configured and disposed to generate and direct a flow of air through the active air discharge opening to disrupt an airstream flowing over the one of the plurality of surfaces of the fuselage and the one of the plurality of surface portions of the rotor assembly. |
| FILED | Monday, September 12, 2016 |
| APPL NO | 15/262671 |
| ART UNIT | 3644 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Aeroplanes; Helicopters B64C 7/00 (20130101) B64C 21/04 (20130101) Original (OR) Class B64C 27/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220965 | Nguyen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Tam Nguyen Thuc Nguyen (Sugar Land, Texas); Kerri L. Cahoy (Lexington, Massachusetts); Meghan K. Quadrino (Cambridge, Massachusetts) |
| ABSTRACT | Described herein are systems and methods for attitude determination using infrared Earth horizon sensors (EHSs) with Gaussian response characteristics. Attitude information is acquired by detecting Earth's infrared electromagnetic radiation and, subsequently, determining the region obscured by Earth in the sensors' fields of view to compute a nadir vector estimation in the spacecraft's body frame. The method can be applied when two sensors, each with known and distinct pointing directions, detect the horizon, which is defined as having their fields of view partially obscured by Earth. The method can be implemented compactly to provide high-accuracy attitude within small spacecraft, such as CubeSat-based satellites. |
| FILED | Thursday, October 05, 2017 |
| APPL NO | 15/725478 |
| ART UNIT | 3665 — Computerized Vehicle Controls and Navigation, Radio Wave, Optical and Acoustic Wave Communication, Robotics, and Nuclear Systems |
| CURRENT CPC | Cosmonautics; Vehicles or Equipment Therefor B64G 1/26 (20130101) B64G 1/32 (20130101) B64G 1/34 (20130101) B64G 1/36 (20130101) B64G 1/281 (20130101) B64G 1/283 (20130101) B64G 1/285 (20130101) B64G 1/286 (20130101) B64G 1/288 (20130101) B64G 1/363 (20130101) B64G 1/365 (20130101) Original (OR) Class B64G 1/366 (20130101) B64G 1/407 (20130101) B64G 2001/245 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221214 | Heath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | INDI MOLECULAR, INC. (Culver City, California) |
| ASSIGNEE(S) | INDI MOLECULAR, INC. (Culver City, California) |
| INVENTOR(S) | James R. Heath (South Pasadena, California); Arundhati Nag (Pasadena, California); Samir Das (Pasadena, California); Kaycie M. Deyle (Sylmar, California); Steven Wesley Millward (Monrovia, California); Paul Edward Kearney (Seattle, Washington) |
| ABSTRACT | The present application provides stable peptide-based Akt capture agents and the use thereof as detection, diagnosis, and treatment agents. The application further provides novel methods of developing stable peptide-based capture agents, including Akt capture agents, using iterative on-bead in situ click chemistry. |
| FILED | Monday, November 23, 2015 |
| APPL NO | 14/949236 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/08 (20130101) A61K 49/0043 (20130101) A61K 49/0056 (20130101) A61K 51/08 (20130101) Peptides C07K 7/02 (20130101) Original (OR) Class C07K 14/001 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1058 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/485 (20130101) C12Q 1/6804 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/573 (20130101) G01N 33/5748 (20130101) G01N 33/57449 (20130101) G01N 33/57496 (20130101) G01N 2333/91205 (20130101) G01N 2333/91215 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221235 | Scherer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | THE BOARD OF REGENTS OF THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| INVENTOR(S) | Philipp Erich Scherer (Southlake, Texas); Jiyoung Park (Dallas, Texas); Zhiqiang An (Pearland, Texas) |
| ABSTRACT | Aspects of the present invention relate to methods and reagents for increasing chemosensitivity to platinum-based chemotherapy. In one aspect, a method of increasing chemosensitivity to platinum-based chemotherapy is provided, comprising administering to a patient in need thereof an effective amount of an endotrophin-neutralizing agent. The agent can be a monoclonal antibody, or fragment thereof, capable of binding to the C5 domain of the alpha3 chain of collagen VI. In some embodiments, the method can further include administering an effective amount of thiazolidinedione to said patient. |
| FILED | Friday, January 27, 2017 |
| APPL NO | 15/417740 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/555 (20130101) A61K 31/555 (20130101) A61K 33/24 (20130101) A61K 33/24 (20130101) A61K 39/3955 (20130101) A61K 2039/505 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Peptides C07K 16/18 (20130101) Original (OR) Class C07K 2317/76 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221274 | Brennan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. (Gainesville, Florida) |
| ASSIGNEE(S) | UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INCORPORATED (Gainesville, Florida) |
| INVENTOR(S) | Anthony B. Brennan (Gainesville, Florida); Laura M. Villada (Gainesville, Florida); Canan Kizilkaya (Gainesville, Florida) |
| ABSTRACT | Disclosed herein a composition comprising a urethane of the FIG. 3; where hydroxyl or amine linkages on the urethane of the FIG. 3 are functionalized with molecules that contain fluorine atoms, phosphorus atoms, sulfur atoms, unsaturated carboxylic acids, derivatives of unsaturated carboxylic acids, or combinations thereof. Disclosed herein too is a composition comprising a urethane of the FIG. 3; where hydroxyl or amine linkages of the urethane of the FIG. 3 are functionalized with molecules that contain fluorine atoms, phosphorus atoms, sulfur atoms, unsaturated carboxylic acids, derivatives of unsaturated carboxylic acids, or combinations thereof; and a polymeric resin. |
| FILED | Thursday, June 25, 2015 |
| APPL NO | 15/322334 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 220/68 (20130101) C08F 222/1006 (20130101) C08F 290/067 (20130101) Original (OR) Class C08F 2222/1013 (20130101) Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 71/04 (20130101) Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 175/16 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221333 | Wynne et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | VIRGINIA COMMONWEALTH UNIVERSITY (Richmond, Virginia) |
| ASSIGNEE(S) | VIRGINIA COMMONWEALTH UNIVERSITY (Richmond, Virginia) |
| INVENTOR(S) | Kenneth J. Wynne (Midlothian, Virginia); Wei Zhang (Midlothian, Virginia) |
| ABSTRACT | A compound is provided, having the formula (I), wherein Rs is a soft block polymer; wherein each T is independently a urethane or urea linkage; see formulae (A) and (B); wherein each RD is independently —CH3, —CH2CH3, —CH2CH2CH3, or —CH2CH2CH2CH3; wherein each R′D is independently —CH3, —CH2CH3, —CH2CH2CH3, —CH2CH2CH2CH3, or —ORD; and wherein each p is independently 1, 2, or 3. Compositions containing the compound, and methods of making and using the compound are provided. |
| FILED | Tuesday, September 30, 2014 |
| APPL NO | 15/025888 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 65/336 (20130101) C08G 77/54 (20130101) C08G 77/388 (20130101) Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients C08K 5/5465 (20130101) C08K 5/5465 (20130101) C08K 5/5465 (20130101) Compositions of Macromolecular Compounds C08L 71/02 (20130101) C08L 75/04 (20130101) C08L 83/04 (20130101) C08L 83/08 (20130101) Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 171/02 (20130101) Original (OR) Class C09D 183/14 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 3/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221402 | Rosenberg |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yvonne Rosenberg (Washington, District of Columbia) |
| ASSIGNEE(S) | PlantVax, Inc. (Rockville, Maryland) |
| INVENTOR(S) | Yvonne Rosenberg (Washington, District of Columbia) |
| ABSTRACT | Disclosed herein are methods for the large-scale production of a highly thermally stable acetylcholinesterase (AChE) and butyrylcholinesterase (BChE). Additionally, the expression methods disclosed herein can produce ChE preparations consisting of extract or purified forms that can be produced in high amounts and are highly thermally stable. These ChE products can be used in vitro detection, detoxification and decontamination methods. |
| FILED | Saturday, March 14, 2015 |
| APPL NO | 15/126296 |
| ART UNIT | 1663 — Plants |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 38/465 (20130101) A61K 47/36 (20130101) Chemical Means for Extinguishing Fires or for Combating or Protecting Against Harmful Chemical Agents; Chemical Materials for Use in Breathing Apparatus A62D 3/02 (20130101) A62D 2101/02 (20130101) A62D 2101/26 (20130101) Peptides C07K 7/08 (20130101) C07K 2319/04 (20130101) C07K 2319/21 (20130101) C07K 2319/43 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/18 (20130101) Original (OR) Class Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/46 (20130101) Enzymes C12Y 301/01008 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221460 | Trobridge et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | WASHINGTON STATE UNIVERSITY (Pullman, Washington) |
| ASSIGNEE(S) | Washington State University (Pullman, Washington) |
| INVENTOR(S) | Grant D. Trobridge (Pullman, Washington); Arun Kumar Nalla (Pullman, Washington) |
| ABSTRACT | Provided herein are methods for the prognosis of prostate cancer progression in a patient by analyzing the gene expression in a tumor sample obtained from the patient the prognosis of prostate cancer progression in a patient by analyzing the gene expression in a tumor sample obtained from the patient. In particular, gene expression levels of GCOM1, MEX3D, TRPM4, ATPAF1, PTRF, GLYATL1, FLNA, OBSCN, STRA13, WHSC1, ARFGAP3, KDM2A, FAM83H, CLDN7, CNOT6, and B3GNT9 are measured. Kits containing means for the measurement of gene expression as described herein and methods for treatment of prostate cancer are also provided. |
| FILED | Wednesday, March 25, 2015 |
| APPL NO | 15/129841 |
| ART UNIT | 1642 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6886 (20130101) Original (OR) Class C12Q 2600/112 (20130101) C12Q 2600/118 (20130101) C12Q 2600/158 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/57434 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221693 | Chan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | General Electric Company (Schenectady, New York) |
| ASSIGNEE(S) | General Electric Company (Schenectady, New York) |
| INVENTOR(S) | George Joe-Kueng Chan (Lynn, Massachusetts); Ronald Scott Bunker (West Chester, Ohio); Victor Hugo Silva Correia (Lynn, Massachusetts); Christopher Kanoa Hoffman (Lynn, Massachusetts) |
| ABSTRACT | An airfoil comprises at least one wall defining a leading edge, a trailing edge, a pressure side extending between the leading edge and the trailing edge, and a suction side extending between the leading edge and the trailing edge. The airfoil is curved in three dimensions and has one or more cavities defined by an interior surface of the at least one wall. A plurality of cooling film holes extending between the cavity and at least one cooling trench located on at least one of the pressure side and the suction side, spaced from the leading edge. The at least one trench has a floor spaced from an outer surface of the airfoil. The plurality of cooling film holes extend through the floor at an angle other than perpendicular. |
| FILED | Thursday, July 03, 2014 |
| APPL NO | 14/901450 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/18 (20130101) F01D 5/143 (20130101) F01D 5/186 (20130101) F01D 5/187 (20130101) Original (OR) Class F01D 9/041 (20130101) F01D 25/12 (20130101) Non-positive-displacement Pumps F04D 29/324 (20130101) F04D 29/542 (20130101) F04D 29/5846 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2260/202 (20130101) Climate Change Mitigation Technologies Related to Transportation Y02T 50/673 (20130101) Y02T 50/676 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221714 | Peters et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Hartford, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Christopher J. Peters (West Hartford, Connecticut); Dave J. Hyland (Portland, Connecticut) |
| ABSTRACT | An assembly is provided for rotational equipment with an axial centerline. This assembly includes a primary seal device, a ring structure and a secondary seal device. The primary seal device is configured as a hydrostatic non-contact seal device. The primary seal device includes a plurality of seal shoes and a seal base. The seal shoes are arranged circumferentially about the axial centerline in an annular array. The seal base circumscribes the annular array of the seal shoes. The ring structure is axially engaged with the seal base. The secondary seal device is mounted with the ring structure. The secondary seal device includes a seal ring body and an alignment tab. The seal ring body is configured to substantially seal an annular gap between the ring structure and the seal base. The alignment tab projects out from the seal ring body and into an aperture in the ring structure. The alignment tab is adapted to substantially rotationally locate and/or fix the secondary seal device to the ring structure. |
| FILED | Friday, January 22, 2016 |
| APPL NO | 15/004556 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/02 (20130101) F01D 9/02 (20130101) F01D 11/04 (20130101) Original (OR) Class F01D 11/025 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/30 (20130101) Pistons; Cylinders; Sealings F16J 15/442 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221767 | Romanov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Hartford, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Dmitriy A. Romanov (Wells, Maine); Paul M. Lutjen (Kennebunkport, Maine) |
| ABSTRACT | A turbine component includes a main body with an upstream end and a downstream end. A cooling passage network is interior to the main body and has multiple cooling passages. A shared passage wall in the cooling passage network includes a cross passage opening connecting each passage partially defined by the shared passage wall. The cross passage further including a pressure balancing feature operable to reduce a local pressure differential in a fluid pressure in each adjacent passage at the cross passage. |
| FILED | Monday, August 31, 2015 |
| APPL NO | 14/841054 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Foundry Moulding B22C 9/04 (20130101) B22C 9/10 (20130101) Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/187 (20130101) F01D 9/041 (20130101) F01D 11/08 (20130101) F01D 25/12 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 3/04 (20130101) F02C 7/18 (20130101) Original (OR) Class F02C 7/28 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2230/211 (20130101) F05D 2240/11 (20130101) F05D 2240/12 (20130101) F05D 2240/30 (20130101) F05D 2240/55 (20130101) F05D 2260/20 (20130101) F05D 2260/204 (20130101) F05D 2300/13 (20130101) Climate Change Mitigation Technologies Related to Transportation Y02T 50/676 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222065 | Hannwacker et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | General Electric Company (Schenectady, New York) |
| ASSIGNEE(S) | General Electric Company (Schenectady, New York) |
| INVENTOR(S) | David Andrew Hannwacker (Torrance, California); Stephen John Howell (West Newbury, Massachusetts); John Carl Jacobson (Melrose, Massachusetts) |
| ABSTRACT | A combustor assembly for a gas turbine engine includes a liner and a combustor dome. The combustor dome and liner together at least in part define a combustion chamber. The combustor dome includes a transition portion and a forward wall. The transition portion extends from the forward wall towards the liner. Additionally the transition portion may define an angle relative to the forward wall and/or may define a radius of curvature between the forward wall of the combustor dome and a flat of the transition portion of the combustor dome for increasing an aerodynamic efficiency of the combustor dome. |
| FILED | Thursday, February 25, 2016 |
| APPL NO | 15/053433 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2240/35 (20130101) F05D 2300/6033 (20130101) Generating Combustion Products of High Pressure or High Velocity, e.g Gas-turbine Combustion Chambers F23R 3/002 (20130101) F23R 3/06 (20130101) F23R 3/007 (20130101) Original (OR) Class F23R 3/42 (20130101) F23R 3/50 (20130101) F23R 2900/00005 (20130101) F23R 2900/00018 (20130101) F23R 2900/03041 (20130101) F23R 2900/03042 (20130101) Climate Change Mitigation Technologies Related to Transportation Y02T 50/675 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222182 | Cardoza et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Department of the Navy (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America as Represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Normary Camacho Cardoza (LaPlata, Maryland); Nicholas Shaker (Springfield, Virginia); Michael G. Craft (Waldorf, Maryland); Lonnie Frericks (King George, Virginia) |
| ABSTRACT | A modular shaped charge system including a housing including a circular opening; an attachment ring having a diameter complementary to a diameter of the opening of the housing. The attachment ring configured to snap fit into the opening of the housing. A liner including a cone shape with a base diameter complementary to the diameter of the attachment ring. The liner is configured to snap fit into the attachment ring. The apex of the liner is positioned inside the housing. An air gap cover including a cone shape with a base diameter complementary to the diameter of the attachment ring. The air gap cover is configured to thread into the attachment ring, and the apex of the air gap cover is positioned outside the housing. |
| FILED | Friday, August 18, 2017 |
| APPL NO | 15/731876 |
| ART UNIT | 3641 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Explosive Charges, e.g for Blasting, Fireworks, Ammunition F42B 1/028 (20130101) F42B 1/032 (20130101) F42B 1/036 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222189 | Reimann et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | Raytheon Company (Waltham, Massachusetts) |
| INVENTOR(S) | Daniel D. Reimann (Tucson, Arizona); Jeffery R. Richards (Tucson, Arizona); Charles M. Hoke (Reno, Nevada); Robert D. Travis (Tucson, Arizona) |
| ABSTRACT | A missile or other flight vehicle has a stage separation mechanism for separating a downstream stage from an upstream portion of the missile. The mechanism includes one or more holes in fluid communication with a cavity between the upstream and downstream portions of the missile. The holes are located downstream of one or more shocks produced by one or more local variations in the outer surface shape of the missile. The one or more local variations in outer surface shapes produce the one or more shocks as the missile is flown at supersonic speeds. These shock(s) produce downstream pressure rises, and these pressure increases are communicated to the cavity by the hole(s). The increased pressure in the cavity provides a mechanism for separating the downstream stage from the upstream portion of the missile, after release of a mechanical coupling between the upstream portion and downstream stage. |
| FILED | Friday, July 22, 2016 |
| APPL NO | 15/217491 |
| ART UNIT | 3641 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Explosive Charges, e.g for Blasting, Fireworks, Ammunition F42B 15/36 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222278 | Weston et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Christine M. Weston (Cambridge, Massachusetts); Joseph J. Lacirignola (Beverly, Massachusetts); David C. Maurer (Stoneham, Massachusetts); David F. Aubin, Jr. (Pelham, New Hampshire); Andrew P. Dumas (Somerville, Massachusetts); Ninoshka K. Singh (Somerville, Massachusetts); Jeffrey S. Palmer (Westford, Massachusetts) |
| ABSTRACT | A directional force sensor and sensing system are described. The directional force sensor includes a leaf spring and one or more load sensors disposed about the leaf spring such that in response to a force applied to the leaf spring, the one or more load sensors provide a signal. A controller is coupled to receive signals from the one or more directional force sensors and determines characteristics of forces applied to the directional force sensors. |
| FILED | Wednesday, December 21, 2016 |
| APPL NO | 15/386287 |
| ART UNIT | 2852 — Printing/Measuring and Testing |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/1038 (20130101) A61B 5/6802 (20130101) A61B 5/7225 (20130101) A61B 2562/0261 (20130101) Weighing G01G 19/4142 (20130101) Measuring Force, Stress, Torque, Work, Mechanical Power, Mechanical Efficiency, or Fluid Pressure G01L 1/044 (20130101) Original (OR) Class G01L 1/2268 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222316 | Jalali et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Bahram Jalali (Los Angeles, California); Eric Diebold (Los Angeles, California); Brandon Buckley (Los Angeles, California) |
| ABSTRACT | An imaging flow cytometry apparatus and method which allows registering multiple locations across a cell, and/or across multiple flow channels, in parallel using radio-frequency-tagged emission (FIRE) coupled with a parallel optical detection scheme toward increasing analysis throughput. An optical source is modulated by multiple RF frequencies to produce an optical interrogation beam having a spatially distributed beat frequency. This beam is directed to one or more focused streams of cells whose responsive fluorescence, in different frequencies, is registered in parallel by an optical detector. |
| FILED | Tuesday, June 26, 2018 |
| APPL NO | 16/019323 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/1434 (20130101) Original (OR) Class G01N 15/1459 (20130101) G01N 15/1484 (20130101) G01N 21/64 (20130101) G01N 21/6428 (20130101) G01N 21/6458 (20130101) G01N 21/6486 (20130101) G01N 33/537 (20130101) G01N 2015/1006 (20130101) G01N 2015/1477 (20130101) G01N 2021/6421 (20130101) G01N 2201/067 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222416 | Inamdar et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Hypres, Inc. (Elmsford, New York) |
| ASSIGNEE(S) | Hypres, Inc. (Elmsford, New York) |
| INVENTOR(S) | Amol Inamdar (Elmsford, New York); Jie Ren (Elmwood Park, New Jersey); Denis Amparo (White Plains, New York) |
| ABSTRACT | A superconducting circuit is disclosed for fast digital readout of on-chip diagnostics in an array of devices in an integrated circuit. The digital readout comprises a digital RSFQ multiplexer to select the readout channel. This permits a large number of devices to be tested with a minimum of input and output lines. The devices may comprise digital devices (such as elementary RSFQ cells), or analog devices (such as inductors, resistors, or Josephson junctions) with a SQUID quantizer to generate a digital signal. The diagnostic array and the digital multiplexer are preferably configured to operate as part of the same integrated circuit at cryogenic temperatures. |
| FILED | Wednesday, April 13, 2016 |
| APPL NO | 15/097930 |
| ART UNIT | 2844 — Electrical Circuits and Systems |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/3181 (20130101) G01R 31/31712 (20130101) Original (OR) Class G01R 31/31727 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222468 | Assefzadeh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | WILLIAM MARSH RICE UNIVERSITY (Houston, Texas) |
| ASSIGNEE(S) | William Marsh Rice University (Houston, Texas) |
| INVENTOR(S) | M. Mahdi Assefzadeh (Houston, Texas); Aydin Babakhani (Houston, Texas) |
| ABSTRACT | A radar system may comprise a trigger, driver, switching circuit, and antenna for generating an ultra-short impulse without utilizing an oscillator. A radar imaging system for imaging a formation or a cross section of a pipeline may include at least one radar sensor. The system may transmit a high-frequency, short impulse signal to a formation or pipeline and measure a reflected signal. A high speed impulse generator may allow the short impulse signals to be generated. This impulse generator may utilize a switching circuit and digital driver to provide the short impulse signals. The images provide useful information about complex permittivity of the formation, the geometry of the pipeline, deposition thickness of asphaltenes and wax, velocity of the fluid, as well as size, type, concentration of gas bubbles, water, or solid particles in the flow, or combinations thereof. |
| FILED | Monday, September 29, 2014 |
| APPL NO | 15/021978 |
| ART UNIT | 3648 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Earth Drilling, e.g Deep Drilling; Obtaining Oil, Gas, Water, Soluble or Meltable Materials or a Slurry of Minerals From Wells E21B 47/0002 (20130101) E21B 47/122 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 22/00 (20130101) Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/032 (20130101) G01S 7/038 (20130101) G01S 7/282 (20130101) G01S 7/411 (20130101) G01S 13/89 (20130101) Original (OR) Class G01S 13/0209 (20130101) Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags G01V 3/30 (20130101) Antennas, i.e Radio Aerials H01Q 1/38 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222550 | Ptasinski et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Joanna Ptasinski (San Diego, California); Stephen Russell (San Diego, California) |
| ASSIGNEE(S) | United States of America as represented by Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Joanna Ptasinski (San Diego, California); Stephen Russell (San Diego, California) |
| ABSTRACT | Methods and devices for a plasmonic circuit are described. A planar plasmonic device is configured with a controlling gate structure and when coupled to a complementary plasmonic device, a switching circuit can be realized. Also, by varying the properties of the complementary plasmonic device, the circuit can also operate as an amplifier. By use of combinations of this plasmonic circuit element, more advanced circuits and logic functions can be arrived at. |
| FILED | Thursday, May 03, 2018 |
| APPL NO | 15/969944 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/124 (20130101) G02B 6/1226 (20130101) Original (OR) Class G02B 2006/12107 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222552 | Djordjevic et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Oracle International Corporation (Redwood Shores, California) |
| ASSIGNEE(S) | Oracle International Corporation (Redwood Shores, California) |
| INVENTOR(S) | Stevan S. Djordjevic (San Diego, California); Xuezhe Zheng (San Diego, California); Ashok V. Krishnamoorthy (San Diego, California) |
| ABSTRACT | An integrated circuit is described. This integrated circuit includes an optical waveguide defined in a semiconductor layer, and a dielectric optical waveguide disposed on the semiconductor layer and that overlaps a region of the optical waveguide. Moreover, the dielectric optical waveguide includes an optical device (such as a mirror) on a facet separating a first portion of the dielectric optical waveguide and a second portion of the dielectric optical waveguide. The facet may be at an angle relative to a plane of the dielectric optical waveguide and may include a metal layer. During operation, an optical signal conveyed by the optical waveguide is evanescent coupled to the dielectric optical waveguide. Then, the optical signal may be reflected by the optical device. For example, the angle of the facet may be 45°, so that the optical signal is reflected normal to the plane of the dielectric optical waveguide. |
| FILED | Tuesday, January 12, 2016 |
| APPL NO | 14/993340 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/122 (20130101) G02B 6/12002 (20130101) G02B 6/29331 (20130101) Original (OR) Class G02B 2006/12092 (20130101) G02B 2006/12104 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222627 | Beresnev et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S. Army Research Laboratory ATTN: RDRL-LOC-I (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Leonid A. Beresnev (Columbia, Maryland); Anthony R. Valenzuela (Baltimore, Maryland); Chatt C. Williamson (Mt. Airy, Maryland) |
| ABSTRACT | An optics system includes at least one emitting fiber tip that transmits a divergent beam. The divergent beam includes a global maximum intensify of radiation centered with an output optical axis. The divergent beam includes central beams for collimating and periphery beams for disposing. The periphery beams include parasitic radiation of the divergent beam. The optics system includes at least one collimating lens having an output size, output shape, and output optical axis centered thereto and configured to redirect the central beams to a target and redirect the periphery beams into free-space; and at least one redirecting element positioned in between the at least one emitting fiber tip and the at least one collimating lens. The redirecting element includes a first area having an interior size and interior shape to transmit the central beams, and at least one second area outside of the first area to transmit the periphery beams. |
| FILED | Tuesday, March 21, 2017 |
| APPL NO | 15/464382 |
| ART UNIT | 2872 — Optics |
| CURRENT CPC | Armour; Armoured Turrets; Armoured or Armed Vehicles; Means of Attack or Defence, e.g Camouflage, in General F41H 13/0062 (20130101) Optical Elements, Systems, or Apparatus G02B 6/262 (20130101) G02B 27/30 (20130101) Original (OR) Class G02B 27/0927 (20130101) G02B 27/0961 (20130101) G02B 27/0977 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223171 | Labasan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | Intel Corporation (Santa Clara, California) |
| INVENTOR(S) | Stephanie Labasan (Portland, Oregon); Federico Ardanaz (Hillsboro, Oregon); Jonathan M. Eastep (Portland, Oregon); Richard J. Greco (West Linn, Oregon) |
| ABSTRACT | Systems, apparatuses and methods may provide for obtaining, by a system level reallocator in a plurality of reallocators arranged in a hierarchical tree, resource budget information. Additionally, application performance information may be obtained by at least one of the plurality of reallocators. Moreover, a performance imbalance between a plurality of compute subtrees associate with the application performance information may be reduced by the at least one of the plurality of reallocators and based at least in part on the resource budget information and the application performance information. |
| FILED | Friday, March 25, 2016 |
| APPL NO | 15/081424 |
| ART UNIT | 2196 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 9/5083 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223634 | Sussillo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | David Sussillo (Portola Valley, California); Jonathan C. Kao (Stanford, California); Sergey Stavisky (San Francisco, California); Krishna V. Shenoy (Palo Alto, California) |
| ABSTRACT | A brain machine interface (BMI) to control a device is provided. The BMI has a neural decoder, which is a neural to kinematic mapping function with neural signals as input to the neural decoder and kinematics to control the device as output of the neural decoder. The neural decoder is based on a continuous-time multiplicative recurrent neural network, which has been trained as a neural to kinematic mapping function. An advantage of the invention is the robustness of the decoder to perturbations in the neural data; its performance degrades less—or not at all in some circumstances—in comparison to the current state decoders. These perturbations make the current use of BMI in a clinical setting extremely challenging. This invention helps to ameliorate this problem. The robustness of the neural decoder does not come at the cost of some performance, in fact an improvement in performance is observed. |
| FILED | Friday, August 14, 2015 |
| APPL NO | 14/826300 |
| ART UNIT | 2122 — AI & Simulation/Modeling |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/04001 (20130101) Computer Systems Based on Specific Computational Models G06N 3/0445 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224297 | Chua et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Palo Alto Research Center Incorporated (Palo Alto, California) |
| ASSIGNEE(S) | Palo Alto Research Center Incorporated (Palo Alto, California) |
| INVENTOR(S) | Christopher L. Chua (San Jose, California); Jeng Ping Lu (Fremont, California); Gregory Whiting (Menlo Park, California); Scott J. Limb (Palo Alto, California); Rene A. Lujan (Sunnyvale, California); Qian Wang (Mountain View, California) |
| ABSTRACT | A self-destructing device includes a stressed substrate with a heater thermally coupled to the stressed substrate. The device includes a power source and trigger circuitry comprising a sensor and a switch. The sensor generates a trigger signal when exposed to a trigger stimulus. The switch couples the power source to the heater in response to the trigger signal When energized by the power source, the heater generates heat sufficient to initiate self-destruction of the stressed substrate. |
| FILED | Tuesday, July 26, 2016 |
| APPL NO | 15/220221 |
| ART UNIT | 2878 — Optics |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/15 (20130101) H01L 23/57 (20130101) H01L 23/64 (20130101) H01L 23/345 (20130101) H01L 23/576 (20130101) Original (OR) Class H01L 23/5256 (20130101) H01L 29/74 (20130101) H01L 31/202 (20130101) H01L 31/022408 (20130101) H01L 31/022475 (20130101) Pulse Technique H03K 19/17768 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224499 | Wu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Kansas (Lawrence, Kansas) |
| ASSIGNEE(S) | UNIVERSITY OF KANSAS (Lawrence, Kansas) |
| INVENTOR(S) | Judy Z. Wu (Lawrence, Kansas); Youpin Gong (Lawrence, Kansas); Qingfeng Liu (Lawrence, Kansas) |
| ABSTRACT | An optoelectronic device comprises a nanocomposite comprising a carbon nanostructure having a surface and a biomolecule adsorbed on the surface and forming a heterojunction at the interface of the carbon nanostructure and the biomolecule, the carbon nanostructure and the biomolecule each characterized by respective conduction band edges and valence band edges. The device further comprises first and second electrodes in electrical communication with the nanocomposite. The conduction band edge offset, the valence band edge offset, or both, across the heterojunction is greater in energy than the binding energy of an exciton generated in the carbon nanostructure or the biomolecule upon the absorption of light such that the exciton dissociates at the heterojunction to an electron, which is injected into one of the carbon nanostructure and the biomolecule, and a hole, which is injected into the other of the carbon nanostructure and the biomolecule. |
| FILED | Friday, January 29, 2016 |
| APPL NO | 15/547914 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 1/44 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 29/1606 (20130101) H01L 31/06 (20130101) H01L 31/0288 (20130101) H01L 31/1136 (20130101) H01L 51/0048 (20130101) H01L 51/0093 (20130101) H01L 51/4206 (20130101) H01L 51/4253 (20130101) Original (OR) Class Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/549 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224567 | Yoon |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Quallion LLC (Sylmar, California) |
| ASSIGNEE(S) | Quallion LLC (Sylmar, California) |
| INVENTOR(S) | Sang Young Yoon (Brea, California) |
| ABSTRACT | The battery includes an electrolyte activating a positive electrode and a negative electrode. The electrolyte includes a plurality of salts in a solvent, one or more passivation salts in the solvent, and one or more passivation additives in the solvent. At least one of the passivation salts forms a passivation layer on the negative electrode during discharge of the battery and includes both lithium and boron. At least one of the salts is an inorganic lithium salt that excludes boron. The solvent includes one or more organic solvents. At least one of the passivation additives forms a passivation layer on the negative electrode during discharge of the battery and is not a salt. The positive electrode has one or more positive active materials that each include a lithium transition-metal oxide and the negative electrodes includes a negative active material selected from a group consisting of lithium metal and graphite. |
| FILED | Monday, September 16, 2013 |
| APPL NO | 13/987925 |
| ART UNIT | 1726 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/0525 (20130101) H01M 10/0567 (20130101) Original (OR) Class H01M 10/4235 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 60/122 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224668 | Benton et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Isodyne, Inc. (Wichita, Kansas); Naval Air Warfare Center, Aircraft Division (Patuxent River, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | George E. Benton (Wichita, Kansas); Oliviu Muja (Leonardtown, Maryland) |
| ABSTRACT | An assembly for terminating a sheathed cable harness at an electrical component port, the assembly incorporating a nipple having a hollow bore fitted for receiving the cable harness; a coupling nut mounting the nipple upon the electrical component, the coupling nut being connected to the nipple's proximal end, and being adapted for aligning the hollow bore with the electrical component's port; and a Hunter spring annularly clamping the cable harness's sheath to the nipple, the Hunter spring having an outer end and a plurality of radially outwardly extending teeth, the radially outwardly extending teeth being positioned at the spring's outer end. |
| FILED | Friday, October 20, 2017 |
| APPL NO | 15/789791 |
| ART UNIT | 2833 — Electrical Circuits and Systems |
| CURRENT CPC | Electrically-conductive Connections; Structural Associations of a Plurality of Mutually-insulated Electrical Connecting Elements; Coupling Devices; Current Collectors H01R 9/037 (20130101) H01R 13/5205 (20130101) Original (OR) Class H01R 13/6592 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224872 | Valdes-Garcia et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | International Business Machines Corporation (Armonk, New York) |
| INVENTOR(S) | Alberto Valdes-Garcia (Hartsdale, New York); Bodhisatwa Sadhu (White Plains, New York) |
| ABSTRACT | A voltage controlled oscillator (VCO), a method of designing a voltage controlled oscillator, and a design structure comprising a semiconductor substrate including a voltage controlled oscillator are disclosed. In one embodiment, the VCO comprises an LC tank circuit for generating an oscillator output at an oscillator frequency, and an oscillator core including cross-coupled semiconductor devices to provide feedback to the tank circuit. The VCO further comprises a supply node, a tail node, and a noise by-pass circuit connected to the supply and tail nodes, in parallel with the tank circuit and the oscillator core. The by-pass circuit forms a low-impedance path at a frequency approximately twice the oscillator frequency to at least partially immunize the oscillator core from external noise and to reduce noise contribution from the cross-coupled semiconductor devices. |
| FILED | Thursday, April 07, 2016 |
| APPL NO | 15/093169 |
| ART UNIT | 2842 — Electrical Circuits and Systems |
| CURRENT CPC | Electric Digital Data Processing G06F 17/505 (20130101) G06F 17/5045 (20130101) G06F 17/5063 (20130101) Generation of Oscillations, Directly or by Frequency-changing, by Circuits Employing Active Elements Which Operate in a Non-switching Manner; Generation of Noise by Such Circuits H03B 1/00 (20130101) H03B 5/1212 (20130101) Original (OR) Class H03B 5/1215 (20130101) H03B 5/1228 (20130101) H03B 5/1243 (20130101) H03B 5/1281 (20130101) H03B 2200/009 (20130101) H03B 2200/0038 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224875 | Nguyen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Clark T.-C. Nguyen (Oakland, California); Tristan O. Rocheleau (Berkeley, California) |
| ABSTRACT | A micro-electromechanical system (MEMS) frequency divider apparatus having one or more MEMS resonators on a substrate is presented. A first oscillator frequency, as an approximate multiple of the parametric oscillation frequency, is capacitively coupled from a very closely-spaced electrode (e.g., 40 nm) to a resonant structure of the first oscillator, thus inducing mechanical oscillation. This mechanical oscillation can be coupled through additional MEMS resonators on the substrate. The mechanical resonance is then converted, in at least one of the MEMS resonators, by capacitive coupling back to an electrical signal which is a division of the first oscillation frequency. Output may be generated as a single ended output, or in response to a differential signal between two output electrodes. |
| FILED | Wednesday, June 01, 2016 |
| APPL NO | 15/170577 |
| ART UNIT | 2842 — Electrical Circuits and Systems |
| CURRENT CPC | Generation of Oscillations, Directly or by Frequency-changing, by Circuits Employing Active Elements Which Operate in a Non-switching Manner; Generation of Noise by Such Circuits H03B 19/00 (20130101) H03B 19/14 (20130101) Original (OR) Class H03B 2200/0016 (20130101) Impedance Networks, e.g Resonant Circuits; Resonators H03H 9/25 (20130101) H03H 9/171 (20130101) H03H 9/02007 (20130101) H03H 9/2431 (20130101) H03H 9/2436 (20130101) H03H 9/2447 (20130101) Pulse Technique H03K 25/02 (20130101) Automatic Control, Starting, Synchronisation, or Stabilisation of Generators of Electronic Oscillations or Pulses H03L 7/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224944 | Salem et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Loai Galal Bahgat Salem (La Jolla, California); Patrick Mercier (San Diego, California) |
| ABSTRACT | A low power voltage regulator includes a weighted transistor array having a plurality of transistor switches with a total conductance of G, corresponding to bits from a MSB to LSB. A transistor switch corresponding to the MSB has a conductance of G/2 and remaining bits have a consecutive descending conductance of G/2N to the LSB, and search time takes a low number of cycles by starting with the MSB. A redundant LSB transistor switch has the same G/2N conductance of the LSB. The redundant LSB is used to correct steady-state errors, and a proportional derivative controller compensates output voltage. The compensation in a method eliminates an output pole of the voltage regulator to provide a stable voltage regulator operation irrespective of load current, load capacitance, or sampling frequency. Voltage can be regulated via the additional LSB below the resolution limit via pulse width modulation. |
| FILED | Monday, February 05, 2018 |
| APPL NO | 15/888661 |
| ART UNIT | 2845 — Electrical Circuits and Systems |
| CURRENT CPC | Systems for Regulating Electric or Magnetic Variables G05F 1/59 (20130101) Coding; Decoding; Code Conversion in General H03M 1/462 (20130101) H03M 1/0617 (20130101) Original (OR) Class H03M 1/808 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225039 | Tollefson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, None) |
| INVENTOR(S) | Eric R. Tollefson (Medford, Massachusetts); Bruce R. Jordan, Jr. (Lincoln, Massachusetts) |
| ABSTRACT | Systems and techniques for physical layer encryption (PLE) using beamforming. The techniques are based on the principles of Linear Amplification with Nonlinear Components (LINC) to produce a transmit signal with limited dynamic range. A masking signal is structured based upon a source data signal to produce a transmit signal with limited dynamic range, while providing a high degree of secrecy. |
| FILED | Monday, May 11, 2015 |
| APPL NO | 15/304141 |
| ART UNIT | 2497 — Cryptography and Security |
| CURRENT CPC | Secret Communication; Jamming of Communication H04K 1/02 (20130101) Original (OR) Class H04K 1/10 (20130101) H04K 3/825 (20130101) H04K 2203/32 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225080 | Drost et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S. Army Research Laboratory ATTN: RDRL-LOC-I (Adelphi, Maryland) |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Robert James Drost (Washington, District of Columbia); Terrence Joseph Moore (Silver Spring, Maryland); Michael Brodsky (Milburn, New Jersey) |
| ABSTRACT | Quantum networking systems and methods for routing entangled photons pairs are described herein. One quantum networking system includes entangled photon sources which generate entangled photons; optical output ports; a reconfigurable switching network connecting to the entangled photon sources and the output ports, which include a regular repeating structure of optical crossbar switches and interconnections for selectively routing individual ones of entangled photons pairs input to the network to and amongst the outputs; and a control module. The control module is configured to receive a request for entangled photons at the output ports; execute a routing algorithm to determine the state of the switches in the reconfigurable switching network to satisfy the request; and generate and transmit control signals to the switching network in order to set the states of the switches according to the executed routing algorithm. The reconfigurable switching network may be a Beneš or a banyan-type network architecture. |
| FILED | Tuesday, May 09, 2017 |
| APPL NO | 15/590828 |
| ART UNIT | 2647 — Telecommunications: Analog Radio Telephone; Satellite and Power Control; Transceivers, Measuring and Testing; Bluetooth; Receivers and Transmitters; Equipment Details |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 2207/114 (20130101) Transmission H04B 10/70 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/0855 (20130101) Original (OR) Class H04L 9/0858 (20130101) Telephonic Communication H04M 99/00 (20130101) H04M 2201/60 (20130101) H04M 2207/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225112 | Doane |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Jonathan P. Doane (Arlington, Massachusetts) |
| ABSTRACT | A method and apparatus for achieving simultaneous transmit and receive operation with digital cancelling based upon probe waveforms is described. Digital cancelling based upon probe waveforms enables adjacent transmitting and receiving channels to transmit and receive correlated signals. |
| FILED | Thursday, December 21, 2017 |
| APPL NO | 15/850650 |
| ART UNIT | 2631 — Digital Communications |
| CURRENT CPC | Transmission H04B 1/0475 (20130101) H04B 1/7107 (20130101) H04B 7/0842 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 25/0202 (20130101) H04L 25/03343 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225138 | Wu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Architecture Technology Corporation (Minneapolis, Minnesota) |
| ASSIGNEE(S) | Architecture Technology Corporation (Minneapolis, Minnesota) |
| INVENTOR(S) | John Wu (Eden Prairie, Minnesota); Nathan Bahr (Eden Prairie, Minnesota); Ranga Ramanujan (Hamel, Minnesota); Brett Thompson (St. Louis Park, Minnesota); Steven M. Schneider (Shakopee, Minnesota); Corey Webster (Minneapolis, Minnesota) |
| ABSTRACT | In one example, in a Dynamic Host Configuration Protocol (DHCP) network comprising one or more configuration computing systems, a method includes receiving one or more augmented DHCP configuration messages. The method also includes determining that each of the one or more augmented DHCP configuration messages includes a message tag indicating that the respective augmented DHCP configuration message contains parameter information that includes a client identifier associated with a respective one of the one or more network devices. The method further includes determining, based on the parameter information included in each of the one or more augmented DHCP configuration messages, configuration data that is usable to configure the one or more network devices. The method also includes configuring, based on the configuration data, the one or more network devices. |
| FILED | Tuesday, February 16, 2016 |
| APPL NO | 15/044760 |
| ART UNIT | 2454 — Computer Networks |
| CURRENT CPC | Electric Digital Data Processing G06F 15/177 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 41/0803 (20130101) Original (OR) Class H04L 61/103 (20130101) H04L 61/2015 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225230 | Daugherty et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | Raytheon Company (Waltham, Massachusetts) |
| INVENTOR(S) | Brandon H. Daugherty (Melissa, Texas); Jason B. Emery (Dallas, Texas); Brian D. Sirois (Northlake, Texas); Bradley D. Staal (Allen, Texas); Paul J. Lewis (Allen, Texas); Michael S. Mitchener (Worcester, Massachusetts) |
| ABSTRACT | A method includes receiving, at a field programmable gate array (FPGA), one or more Ethernet packets of a message including control or status information associated with the FPGA. The method also includes determining, by the FPGA, a payload of each packet by removing at least one Ethernet header from the packet. The method further includes removing, by the FPGA, a User Datagram Protocol (UDP) header from each packet and determining UDP header metadata. The method also includes converting, by the FPGA based on the UDP header metadata, the packets to a read or write message associated with one or more registers of the FPGA. In addition, the method includes performing, by the FPGA, a read or write of the one or more registers of the FPGA according to the read or write message. |
| FILED | Wednesday, December 14, 2016 |
| APPL NO | 15/379065 |
| ART UNIT | 2844 — Electrical Circuits and Systems |
| CURRENT CPC | Electric Digital Data Processing G06F 13/385 (20130101) G06F 17/5054 (20130101) Pulse Technique H03K 19/1733 (20130101) H03K 19/17708 (20130101) H03K 19/17748 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 12/56 (20130101) H04L 49/358 (20130101) H04L 61/10 (20130101) Original (OR) Class H04L 67/06 (20130101) H04L 69/161 (20130101) H04L 69/164 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225672 | Lacirignola et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Joseph J. Lacirignola (Beverly, Massachusetts); Trina Rae Vian (Westford, Massachusetts); David F. Aubin, Jr. (Pelham, New Hampshire); Thomas F. Quatieri (Newtonville, Massachusetts); Kate D. Fischl (Cambridge, Massachusetts); Paula P. Collins (Arlington, Massachusetts); Christopher J. Smalt (Arlington, Massachusetts); Paul D. Gatewood (Medford, Massachusetts); Nicolas Malyska (Watertown, Massachusetts); David C. Maurer (Stoneham, Massachusetts) |
| ABSTRACT | Loud sounds with fast rise times, like gunfire and explosions, can cause noise-induced hearing loss (NIHL). Unfortunately, current models do not adequately explain how impulsive sounds cause NIHL, which makes it difficult to predict and prevent NIHL on battlefields and other hostile or rugged environments. Fortunately, the impulsive sounds experienced by soldiers and others working in rugged environments can be recorded using a compact, portable system that acquires, digitizes, and stores high-bandwidth audio data. An example of this system can be mounted on a helmet or other article and used to record hours of audio data at a bandwidth of 20 kHz or higher, which is broad enough to capture sounds with rise times less than 50 ms. An analog-to-digital converter (ADC) digitizes these broadband audio signals at rate of 40 kHz or higher to preserve the impulse information. A processor transfers the digitized samples from a buffer to a memory card for later retrieval using an interrupt-driven processing technique. |
| FILED | Tuesday, April 17, 2018 |
| APPL NO | 15/955037 |
| ART UNIT | 2651 — Videophones and Telephonic Communications |
| CURRENT CPC | Electric Digital Data Processing G06F 3/165 (20130101) Speech Analysis or Synthesis; Speech Recognition; Speech or Voice Processing; Speech or Audio Coding or Decoding G10L 21/0208 (20130101) Information Storage Based on Relative Movement Between Record Carrier and Transducer G11B 20/10 (20130101) G11B 20/24 (20130101) Loudspeakers, Microphones, Gramophone Pick-ups or Like Acoustic Electromechanical Transducers; Deaf-aid Sets; Public Address Systems H04R 3/005 (20130101) H04R 25/75 (20130101) Original (OR) Class H04R 2430/01 (20130101) H04R 2460/07 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225906 | Coe-Sullivan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Seth Coe-Sullivan (Belmont, Massachusetts); Jonathan S. Steckel (Cambridge, Massachusetts); LeeAnn Kim (Dover, Massachusetts); Moungi G. Bawendi (Cambridge, Massachusetts); Vladimir Bulovic (Lexington, Massachusetts) |
| ASSIGNEE(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Seth Coe-Sullivan (Belmont, Massachusetts); Jonathan S. Steckel (Cambridge, Massachusetts); LeeAnn Kim (Dover, Massachusetts); Moungi G. Bawendi (Cambridge, Massachusetts); Vladimir Bulovic (Lexington, Massachusetts) |
| ABSTRACT | A light emitting device includes a semiconductor nanocrystal in a layer. The layer can be a monolayer of semiconductor nanocrystals. The monolayer can form a pattern on a substrate. |
| FILED | Thursday, October 20, 2005 |
| APPL NO | 11/253595 |
| ART UNIT | 2875 — Optics |
| CURRENT CPC | Typewriters; Selective Printing Mechanisms,, i.e Mechanisms Printing Otherwise Than From a Forme; Correction of Typographical Errors B41J 2/0057 (20130101) Printing, Duplicating, Marking, or Copying Processes; Colour Printing, B41M 1/02 (20130101) B41M 3/003 (20130101) B41M 5/0256 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) B82Y 30/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/6715 (20130101) H01L 51/56 (20130101) H01L 51/502 (20130101) H01L 51/5012 (20130101) Electric Heating; Electric Lighting Not Otherwise Provided for H05B 33/10 (20130101) Original (OR) Class H05B 33/145 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225952 | Chainer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | International Business Machines Corporation (Armonk, New York) |
| INVENTOR(S) | Timothy J. Chainer (Putnam Valley, New York); Pritish R. Parida (Fishkill, New York) |
| ABSTRACT | A first fluid is heated in a preheating section and passes into an evaporator coupled to a first electronic component. Operational heat from the first electronic component vaporizes the first fluid. A second fluid passes into a cold plate coupled to a second electronic component. Operational heat from the second electronic component heats the second fluid. First and second portions of the second fluid output from the cold plate pass through first and second routes, respectively. The first portion becomes thermally coupled to the preheating section and the second portion bypasses the preheating section. Heat transfer from the first portion to the preheating section causes the heating of the first fluid in the preheating section. |
| FILED | Wednesday, October 28, 2015 |
| APPL NO | 14/924805 |
| ART UNIT | 3744 — Optics |
| CURRENT CPC | Electric Digital Data Processing G06F 1/20 (20130101) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 7/20309 (20130101) Original (OR) Class H05K 7/20327 (20130101) H05K 7/20509 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Energy (DOE)
| US 10220378 | Rozhkova et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| ASSIGNEE(S) | UChicago Argonne, LLC (Chicago, Illinois) |
| INVENTOR(S) | Elena A. Rozhkova (Lemont, Illinois); Peng Wang (Shandong, China PRC); Richard D. Schaller (Clarendon Hills, Illinois); Nada M. Dimitrijevic (Lemont, Illinois); Tijana Rajh (Naperville, Illinois); Shankar G. Balasubramanian (Lemont, Illinois) |
| ABSTRACT | Aspects of the disclosure relate to an efficient entirely man-made nanobio hybrid fabricated through cell-free expression of transmembrane proton pump followed by assembly of the synthetic protein architecture with semiconductor nanoparticles for photocatalytic H2 evolution. The system produces H2 at a turnover rate of 240 μmol of H2 (μmol protein)−1 h−1 under green and 17.74 mmol of H2 (μmol protein)−1 h−1 under white light at ambient conditions, in water at neutral pH with methanol as a sacrificial electron donor. Robsutness and flexibility of this approach allows for systemic manipulation at nanoparticle-bio interface toward directed evolution of energy materials and devices. |
| FILED | Thursday, June 01, 2017 |
| APPL NO | 15/611674 |
| ART UNIT | 1732 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 21/063 (20130101) B01J 23/42 (20130101) B01J 31/38 (20130101) Original (OR) Class B01J 31/062 (20130101) B01J 35/004 (20130101) B01J 35/0006 (20130101) B01J 35/0013 (20130101) B01J 37/0219 (20130101) B01J 37/0221 (20130101) B01J 37/0244 (20130101) B01J 2231/005 (20130101) B01J 2531/005 (20130101) Non-metallic Elements; Compounds Thereof; C01B 3/042 (20130101) Peptides C07K 17/14 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 8/0606 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220410 | Banerjee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Texas A and M University System (College Station, Texas) |
| ASSIGNEE(S) | THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas) |
| INVENTOR(S) | Debjyoti Banerjee (College Station, Texas); Byeongnam Jo (Ibaraki, Japan); Jiwon Yu (Gyeongsangbuk-do, South Korea); Seunghwan Jung (Seoul, South Korea); Donghyun Shin (Arlington, Texas); Saeil Jeon (Greensboro, North Carolina); Seokwon Kang (Gyeonggi-do, South Korea) |
| ABSTRACT | Systems and methods for forming nanoparticles in-situ are disclosed herein. The nanoparticles may be formed in-situ through thermocycling a solution comprising at least one of a molten salt, a surfactant, and a catalyst. The nanoparticles may form in the solution itself and/or on surfaces of a vessel in which the solution is formed. Nanofins may be formed from the agglomeration of particles in the solution and on surfaces. Microchannels may be formed by these nanofins, and in some cases microchannels on a surface may have nanofins form on the surface. In some embodiments, a previously formed solution that has nanoparticles formed in-situ may be used to generate nanofins in a vessel, on a wafer in a vessel, in the solution itself, or combinations thereof. |
| FILED | Monday, December 15, 2014 |
| APPL NO | 15/104970 |
| ART UNIT | 1715 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/1273 (20130101) A61K 9/5115 (20130101) A61K 9/5192 (20130101) Processes for Applying Fluent Materials to Surfaces, in General B05D 1/18 (20130101) B05D 5/02 (20130101) Original (OR) Class B05D 7/227 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220471 | Khairallah |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| ASSIGNEE(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| INVENTOR(S) | Saad Khairallah (Livermore, California) |
| ABSTRACT | An additive manufacturing system wherein a gentle sintering run on heat-fusible particles is followed closely by a selective laser melting run. The laser sintering run slightly sinters the particles and causes the particles to adhere to each other, but not necessarily deform and lose their original shape. The particles become connected via bridges between each other, which holds them in place. During the laser melting run, the powder melts in place, with minimum particle ejection or mobility, since the particles form a network of connected particles. |
| FILED | Wednesday, October 14, 2015 |
| APPL NO | 14/882762 |
| ART UNIT | 1742 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 3/1055 (20130101) B22F 2003/1056 (20130101) Soldering or Unsoldering; Welding; Cladding or Plating by Soldering or Welding; Cutting by Applying Heat Locally, e.g Flame Cutting; Working by Laser Beam B23K 26/066 (20151001) Original (OR) Class B23K 26/342 (20151001) B23K 26/0622 (20151001) Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/20 (20170801) B29C 64/153 (20170801) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 30/00 (20141201) B33Y 50/02 (20141201) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 10/295 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221119 | Ramasamy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BATTELLE MEMORIAL INSTITUTE (Richland, Washington) |
| ASSIGNEE(S) | BATTELLE MEMORIAL INSTITUTE (Richland, Washington) |
| INVENTOR(S) | Karthikeyan Kallupalayam Ramasamy (West Richland, Washington); Michel J. Gray (Kennewick, Washington); Carlos A. Alvarez-Vasco (Itagui, Colombia); Mond F. Guo (Richland, Washington); Senthil Subramaniam (Richland, Washington) |
| ABSTRACT | Methods, systems and catalysts for converting an alcohol containing feedstock to an upgraded material in a single catalyst bed wherein a feedstock is fed to a catalyst under preselected conditions to obtain an intermediate; and condensing the intermediate through an aldol condensation reaction to yield a product containing an upgraded material. In one instance the feedstock includes ethanol, the catalyst is a mixed metal oxide catalyst and the upgraded material is typically a C5+ ketone(s) or alcohol(s), such as 2-pentanone, 2-heptanone, 4-heptanone and 2-nonanone. |
| FILED | Monday, January 15, 2018 |
| APPL NO | 15/871773 |
| ART UNIT | 1622 — Organic Chemistry |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 23/72 (20130101) B01J 23/80 (20130101) Acyclic or Carbocyclic Compounds C07C 45/45 (20130101) Original (OR) Class C07C 45/45 (20130101) C07C 49/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221321 | Addleman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BATTELLE MEMORIAL INSTITUTE (Richland, Washington) |
| ASSIGNEE(S) | Battelle Memorial Institute (Richland, Washington) |
| INVENTOR(S) | Raymond S. Addleman (Benton City, Washington); Curtis J. Larimer (Richland, Washington); Christopher A. Barrett (Richland, Washington); George T. Bonheyo (Sequim, Washington); Robert T. Jeters (Sequim, Washington); Eric M. Winder (Sequim, Washington) |
| ABSTRACT | Compositions and processes are disclosed for forming hydrophobic coatings and lubricant-infused surface coatings. Coatings may be applied to various substrates without prior chemical or temperature treatment of the substrates and over large and irregular surfaces. Coatings are self-healing, anti-fouling, and have enhanced lifetimes. |
| FILED | Friday, August 28, 2015 |
| APPL NO | 14/839471 |
| ART UNIT | 1715 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Processes for Applying Fluent Materials to Surfaces, in General B05D 1/12 (20130101) B05D 5/08 (20130101) Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients C08K 3/36 (20130101) C08K 7/26 (20130101) Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 5/00 (20130101) Original (OR) Class C09D 7/61 (20180101) C09D 183/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221401 | Swartz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | James Robert Swartz (Menlo Park, California); Jamin Koo (Stanford, California) |
| ABSTRACT | Compositions and methods are provided for an O2 tolerant Fe—Fe hydrogenase. The hydrogenases of the invention comprise specific amino acid substitutions relative to the native, or wild-type enzymes. |
| FILED | Friday, September 02, 2016 |
| APPL NO | 15/255833 |
| ART UNIT | 1656 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/0067 (20130101) Original (OR) Class Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 3/00 (20130101) Enzymes C12Y 112/02001 (20130101) C12Y 112/07002 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221466 | Gelis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Artem V. Gelis (Naperville, Illinois); Michael Alexander Brown (Chicago, Illinois) |
| ASSIGNEE(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| INVENTOR(S) | Artem V. Gelis (Naperville, Illinois); Michael Alexander Brown (Chicago, Illinois) |
| ABSTRACT | The invention provides a method for extracting transition metals, the method comprising supplying a feedstream containing transition metal, mixing the feedstream with nitric acid for a time and at a concentration sufficient to form an aqueous phase containing the transition metal, combining the aqueous phase with organic extractant phase for a time and at a concentration sufficient to cause the transition metal to reside within the organic extractant phase, and combining the transition metal-containing organic extractant phase with an hydroxamic acid-containing aqueous phase at a concentration and for a time sufficient to cause the transition metal to reside in the hydroxamic acid-containing aqueous phase. |
| FILED | Wednesday, August 05, 2015 |
| APPL NO | 14/819105 |
| ART UNIT | 1732 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Production and Refining of Metals; Pretreatment of Raw Materials C22B 3/0005 (20130101) C22B 3/065 (20130101) C22B 3/0067 (20130101) C22B 3/0068 (20130101) C22B 34/34 (20130101) Original (OR) Class Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 10/234 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221498 | Pascall et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| ASSIGNEE(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| INVENTOR(S) | Andrew J. Pascall (Livermore, California); Hannah Grace Coe (Anchor Point, Alaska); Julie A. Jackson (Livermore, California); Susant K. Patra (Brentwood, California) |
| ABSTRACT | A method of producing a complex product includes designing a three dimensional preform of the complex product, creating a three dimensional preform of the complex product using the model, depositing a material on the preform, and removing the preform to complete the complex product. In one embodiment the system provides a complex heat sink that can be used in heat dissipation in power electronics, light emitting diodes, and microchips. |
| FILED | Tuesday, August 11, 2015 |
| APPL NO | 14/823194 |
| ART UNIT | 3726 — Manufacturing Devices & Processes, Machine Tools & Hand Tools Group Art Units |
| CURRENT CPC | Metal-working Not Otherwise Provided For; Combined Operations; Universal Machine Tools B23P 15/26 (20130101) B23P 2700/10 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 80/00 (20141201) Processes for the Electrolytic or Electrophoretic Production of Coatings; Electroforming; Apparatus Therefor C25D 1/003 (20130101) C25D 13/02 (20130101) Original (OR) Class C25D 13/12 (20130101) C25D 15/00 (20130101) C25D 15/02 (20130101) Heat-exchange Apparatus, Not Provided for in Another Subclass, in Which the Heat-exchange Media Do Not Come into Direct Contact F28D 2021/0029 (20130101) Details of Heat-exchange and Heat-transfer Apparatus, of General Application F28F 3/12 (20130101) F28F 21/02 (20130101) F28F 21/04 (20130101) F28F 21/08 (20130101) F28F 2260/02 (20130101) Technical Subjects Covered by Former US Classification Y10T 29/4935 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221671 | Zhang |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wu Zhang (Morgantown, West Virginia) |
| ASSIGNEE(S) | U.S. Department of Energy (Washington, District of Columbia) |
| INVENTOR(S) | Wu Zhang (Morgantown, West Virginia) |
| ABSTRACT | The method disclosed receives a data stream from an MWD system and determines the response of a specific energy (SE) relationship and a rate of penetration (ROP) relationship respectively to variables controllable by the operator, in order to enable operation at a lowest SE, or a highest Rate-of-Penetration (ROP) to SE ratio. The method utilizes artificial neural networks trained by MWD data to deduce a depth-of-cut and torque based on relationships manifesting between the various data points collected, and an SE equation and a predicted ROP is evaluated over a series of probable operating points. The method continuously gathers and analyzes MWD data during the drilling operation and allows an operator to manage the controllable parameters such that operation at the lowest SE or highest ROP or ROP to SE ratio can be achieved during the drilling operation. |
| FILED | Wednesday, July 15, 2015 |
| APPL NO | 14/799753 |
| ART UNIT | 2121 — AI & Simulation/Modeling |
| CURRENT CPC | Earth Drilling, e.g Deep Drilling; Obtaining Oil, Gas, Water, Soluble or Meltable Materials or a Slurry of Minerals From Wells E21B 44/00 (20130101) Original (OR) Class Computer Systems Based on Specific Computational Models G06N 3/04 (20130101) G06N 3/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221999 | Croteau et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNITED TECHNOLOGIES RESEARCH CENTER (East Hartford, Connecticut) |
| ASSIGNEE(S) | UNITED TECHNOLOGIES CORPORATION (Hartford, Connecticut) |
| INVENTOR(S) | Paul F. Croteau (Columbia, Connecticut); Andrzej Ernest Kuczek (Bristol, Connecticut); Daniel V. Viens (Mansfield Center, Connecticut); Justin R. Hawkes (Marlborough, Connecticut); Wenping Zhao (Glastonbury, Connecticut); Thomas J. Garosshen (Glastonbury, Connecticut) |
| ABSTRACT | A pressure vessel fluid manifold assembly includes a pressure vessel having a plurality of lobes joined to each other, each of the plurality of lobes having a wall disposed in contact with an adjacent wall of an adjacent lobe, and wherein the manifold can be external or internal to the lobes. |
| FILED | Tuesday, October 07, 2014 |
| APPL NO | 15/517017 |
| ART UNIT | 3736 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Vessels for Containing or Storing Compressed, Liquefied or Solidified Gases; Fixed-capacity Gas-holders; Filling Vessels With, or Discharging From Vessels, Compressed, Liquefied, or Solidified Gases F17C 1/00 (20130101) F17C 1/14 (20130101) F17C 1/16 (20130101) F17C 13/002 (20130101) Original (OR) Class F17C 2201/056 (20130101) F17C 2201/0152 (20130101) F17C 2201/0166 (20130101) F17C 2201/0171 (20130101) F17C 2203/0617 (20130101) F17C 2203/0636 (20130101) F17C 2203/0643 (20130101) F17C 2203/0646 (20130101) F17C 2203/0663 (20130101) F17C 2205/0146 (20130101) F17C 2205/0305 (20130101) F17C 2209/221 (20130101) F17C 2209/2181 (20130101) F17C 2221/012 (20130101) F17C 2221/031 (20130101) F17C 2221/033 (20130101) F17C 2221/035 (20130101) F17C 2223/035 (20130101) F17C 2223/0123 (20130101) F17C 2260/018 (20130101) F17C 2270/0168 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 60/321 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222001 | Croteau et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | UNITED TECHNOLOGIES CORPORATION (Farmington, Connecticut) |
| INVENTOR(S) | Paul F. Croteau (Columbia, Connecticut); John P. Wesson (West Hartford, Connecticut); Andrzej Ernest Kuczek (Bristol, Connecticut); Matthew E. Lynch (Canton, Connecticut); Tahany Ibrahim El-Wardany (Bloomfield, Connecticut); Ellen Y. Sun (South Windsor, Connecticut); Wenping Zhao (Glastonbury, Connecticut); Daniel V. Viens (Mansfield Center, Connecticut) |
| ABSTRACT | A pressure vessel configured to store a pressurized fluid is provided including a plurality of lobes. Each lobe includes at least one vertically arranged interior wall. The plurality of lobes are positioned in a side by side configuration such that a first interior wall of a first lobe is positioned adjacent a second interior wall of a second adjacent lobe. The first interior wall and the second interior wall are configured to contact one another at a first point of tangency. A first tangent intersects the first lobe at the first point of tangency and a second tangent intersects the second lobe at the first point of tangency. The first tangent and the second tangent are separated by about 120 degrees. |
| FILED | Monday, September 08, 2014 |
| APPL NO | 15/035060 |
| ART UNIT | 3736 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Vessels for Containing or Storing Compressed, Liquefied or Solidified Gases; Fixed-capacity Gas-holders; Filling Vessels With, or Discharging From Vessels, Compressed, Liquefied, or Solidified Gases F17C 1/00 (20130101) F17C 1/14 (20130101) F17C 1/16 (20130101) F17C 13/06 (20130101) Original (OR) Class F17C 2201/056 (20130101) F17C 2201/0152 (20130101) F17C 2203/0617 (20130101) F17C 2203/0636 (20130101) F17C 2203/0663 (20130101) F17C 2205/0146 (20130101) F17C 2209/219 (20130101) F17C 2209/221 (20130101) F17C 2209/234 (20130101) F17C 2209/2109 (20130101) F17C 2209/2181 (20130101) F17C 2221/012 (20130101) F17C 2221/031 (20130101) F17C 2221/033 (20130101) F17C 2221/035 (20130101) F17C 2223/036 (20130101) F17C 2223/0123 (20130101) F17C 2223/0153 (20130101) F17C 2260/018 (20130101) F17C 2270/0168 (20130101) F17C 2270/0178 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 60/321 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222066 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Siemens Energy, Inc. (Orlando, Florida) |
| ASSIGNEE(S) | SIEMENS ENERGY, INC. (Orlando, Florida) |
| INVENTOR(S) | Yuntao Chen (Oviedo, Florida); Juan Enrique Portillo Bilbao (Oviedo, Florida); Andrew J. North (Orlando, Florida); Lucky Tran (Orlando, Florida); Joseph Meadows (Charlotte, North Carolina); Walter Ray Laster (Oviedo, Florida) |
| ABSTRACT | A ducting arrangement (10) in a combustion stage downstream of a main combustion stage of a gas turbine engine is provided. A duct (18) is fluidly coupled to receive a cross-flow of combustion gases from the main combustion stage. Duct (18) includes a duct segment (23) with an expanding cross-sectional area (24) where one or more injector assemblies (26) are disposed. Injector assembly (26) includes one or more reactant-guiding structures (27) arranged to deliver a flow of reactants into the downstream combustion stage to be mixed with the cross-flow of combustion gases. Disclosed injector assemblies are arranged in expanding cross-sectional area (24) to reduce total pressure loss while providing an effective level of mixing of the injected reactants with the passing cross-flow. Respective duct components or the entire ducting arrangement may be formed as a unitized structure, such as a single piece using a rapid manufacturing technology, such as 3D Printing/Additive Manufacturing (AM) technologies. |
| FILED | Thursday, May 26, 2016 |
| APPL NO | 15/165195 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 6/003 (20130101) F02C 7/222 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2240/35 (20130101) Generating Combustion Products of High Pressure or High Velocity, e.g Gas-turbine Combustion Chambers F23R 3/002 (20130101) F23R 3/02 (20130101) F23R 3/04 (20130101) F23R 3/06 (20130101) F23R 3/10 (20130101) F23R 3/16 (20130101) F23R 3/18 (20130101) F23R 3/20 (20130101) F23R 3/34 (20130101) F23R 3/42 (20130101) F23R 3/045 (20130101) F23R 3/286 (20130101) F23R 3/346 (20130101) Original (OR) Class F23R 2900/03341 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222125 | Coteus et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | International Business Machines Corporation (Armonk, New York) |
| INVENTOR(S) | Paul W. Coteus (Yorktown, New York); Shawn A. Hall (Pleasantville, New York); Mark D. Schultz (Ossining, New York); Todd E. Takken (Brewster, New York); Shurong Tian (Mount Kisco, New York) |
| ABSTRACT | An apparatus for cooling an electronic component has a planar top member of a thermal energy conductive material and a parallel planar bottom member of the material, the planar bottom member including a surface having regions configured for heat exchange contact with the electronic component. The planar top member has a plurality of stamped indent formations at a plurality of locations, each indent formation providing a contact surface such that the planar top member is affixed to the bottom member by braze or solder at each contact surface. Alternatively, the planar bottom member also has a plurality of stamped indent formations in alignment with indent formations of the top member. The planar top member is affixed to the bottom member by brazing or soldering each respective contact surface of an indent formation of the planar top member to an opposing contact surface of a corresponding indent formation of the parallel planar bottom member. |
| FILED | Tuesday, August 04, 2015 |
| APPL NO | 14/818064 |
| ART UNIT | 3763 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Metal-working Not Otherwise Provided For; Combined Operations; Universal Machine Tools B23P 15/26 (20130101) B23P 2700/10 (20130101) Heat-exchange Apparatus, Not Provided for in Another Subclass, in Which the Heat-exchange Media Do Not Come into Direct Contact F28D 1/0308 (20130101) Original (OR) Class Details of Heat-exchange and Heat-transfer Apparatus, of General Application F28F 3/02 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/4878 (20130101) H01L 21/4882 (20130101) H01L 23/473 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222253 | Dawson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| ASSIGNEE(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| INVENTOR(S) | Jay W. Dawson (Livermore, California); Graham S. Allen (Pleasanton, California); Michael R. Carter (Livermore, California); John E. Heebner (San Ramon, California); Michael J. Messerly (Danville, California); Paul H. Pax (Livermore, California); Alexander M. Rubenchik (Livermore, California) |
| ABSTRACT | A system for aerially surveying an area where a plane may have crashed in water and locating pings from the plane's black box using a laser on an aerial platform that produces laser pulses; using a launch telescope to direct the laser pulses to the water producing scattering from the laser pulses and a continuous stream of backscatter; using a receiving telescope to collect the continuous stream of backscatter; using an interferometer operatively connected to the receiving telescope to produce two outputs, wherein one output is the continuous stream of backscatter, and wherein the other output is a delayed replica of the first output; and using a data collection and analysis unit operatively connected to the interferometer to produce a measurement of the sound. |
| FILED | Tuesday, June 07, 2016 |
| APPL NO | 15/175423 |
| ART UNIT | 3645 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Measurement of Mechanical Vibrations or Ultrasonic, Sonic or Infrasonic Waves G01H 9/00 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223091 | Bertolli et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| INVENTOR(S) | Carlo Bertolli (Dobbs Ferry, New York); John K. O'Brien (South Salem, New York); Olivier H. Sallenave (Baldwin Place, New York); Zehra N. Sura (Yorktown Heights, New York) |
| ABSTRACT | In one embodiment, a computer-implemented method includes receiving source code to be compiled into an executable file for an unaligned instruction set architecture (ISA). Aligned assembled code is generated, by a computer processor. The aligned assembled code complies with an aligned ISA and includes aligned processor code for a processor and aligned accelerator code for an accelerator. A first linking pass is performed on the aligned assembled code, including relocating a first relocation target in the aligned accelerator code that refers to a first object outside the aligned accelerator code. Unaligned assembled code is generated in accordance with the unaligned ISA and includes unaligned accelerator code for the accelerator and unaligned processor code for the processor. A second linking pass is performed on the unaligned assembled code, including relocating a second relocation target outside the unaligned accelerator code that refers to an object in the unaligned accelerator code. |
| FILED | Thursday, July 20, 2017 |
| APPL NO | 15/654991 |
| ART UNIT | 2192 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 8/54 (20130101) Original (OR) Class G06F 8/445 (20130101) G06F 9/3001 (20130101) G06F 9/3012 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223260 | O'Brien et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| INVENTOR(S) | Kathryn M. O'Brien (South Salem, New York); John K. O'Brien (South Salem, New York); Zehra N. Sura (Yorktown Heights, New York) |
| ABSTRACT | According to one embodiment, a method of creating compiler-generated memory mapping hints in a computer system includes analyzing code, by a compiler of the computer system, to identify data access patterns in the code. System configuration information defining data processing system characteristics of a target system for the code is accessed. The data processing system characteristics include a plurality of processing resources and memory domain characteristics relative to the processing resources. A preferred allocation of data in memory domains of the target system is determined based on mapping the code to one or more selected processing resources and mapping the data to one or more of the memory domains based on the memory domain characteristics relative to the one or more selected processing resources. The preferred allocation is stored as compiler-generated memory mapping hints in a format accessible by a physical memory mapping resource of the target system. |
| FILED | Wednesday, March 19, 2014 |
| APPL NO | 14/219136 |
| ART UNIT | 2131 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 12/06 (20130101) Original (OR) Class G06F 12/10 (20130101) G06F 2212/251 (20130101) G06F 2212/657 (20130101) Climate Change Mitigation Technologies in Information and Communication Technologies [ICT] i.e Information and Communication Technologies Aiming at the Reduction of Their Own Energy Use Y02D 10/13 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224125 | Barsoum et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DREXEL UNIVERSITY (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | Drexel University (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Michel W. Barsoum (Moorestown, New Jersey); Yury Gogotsi (Warminster, Pennsylvania); Michael Naguib Abdelmalak (Knoxville, Tennessee); Olha Mashtalir (Philadelphia, Pennsylvania) |
| ABSTRACT | The present invention is directed to compositions comprising at least one layer or at least two layers, each layer comprising a substantially two-dimensional array of crystal cells, having first and second surfaces, each crystal cell having the empirical formula of Mn+1Xn, where M, X, and n are described in the specification, and devices incorporating these compositions. |
| FILED | Friday, October 27, 2017 |
| APPL NO | 15/795727 |
| ART UNIT | 1727 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Layered Products, i.e Products Built-up of Strata of Flat or Non-flat, e.g Cellular or Honeycomb, Form B32B 18/00 (20130101) B32B 2250/02 (20130101) B32B 2307/202 (20130101) B32B 2457/10 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Non-metallic Elements; Compounds Thereof; C01B 21/06 (20130101) C01B 21/062 (20130101) C01B 21/076 (20130101) C01B 21/0602 (20130101) C01B 21/0615 (20130101) C01B 21/0617 (20130101) C01B 21/0828 (20130101) C01B 32/90 (20170801) C01B 32/914 (20170801) C01B 32/921 (20170801) C01B 32/949 (20170801) Ammonia; Cyanogen; Compounds Thereof C01C 3/08 (20130101) Indexing Scheme Relating to Structural and Physical Aspects of Solid Inorganic Compounds C01P 2002/01 (20130101) C01P 2002/08 (20130101) C01P 2002/20 (20130101) C01P 2002/72 (20130101) C01P 2002/77 (20130101) C01P 2002/78 (20130101) C01P 2002/82 (20130101) C01P 2002/85 (20130101) C01P 2002/88 (20130101) C01P 2004/03 (20130101) C01P 2004/04 (20130101) C01P 2004/24 (20130101) C01P 2004/61 (20130101) C01P 2004/133 (20130101) C01P 2004/136 (20130101) C01P 2006/12 (20130101) C01P 2006/40 (20130101) Acyclic or Carbocyclic Compounds C07C 233/03 (20130101) C07C 275/00 (20130101) C07C 317/04 (20130101) Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients C08K 3/14 (20130101) C08K 3/28 (20130101) Cables; Conductors; Insulators; Selection of Materials for Their Conductive, Insulating or Dielectric Properties H01B 1/20 (20130101) Original (OR) Class Capacitors; Capacitors, Rectifiers, Detectors, Switching Devices or Light-sensitive Devices, of the Electrolytic Type H01G 11/04 (20130101) H01G 11/32 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/38 (20130101) H01M 4/58 (20130101) H01M 4/62 (20130101) H01M 4/366 (20130101) H01M 4/0492 (20130101) H01M 4/583 (20130101) H01M 4/587 (20130101) H01M 10/052 (20130101) H01M 10/054 (20130101) H01M 10/0525 (20130101) H01M 2004/021 (20130101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/755 (20130101) Y10S 977/896 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224175 | Stevens et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Battelle Memorial Institute (Richland, Washington) |
| ASSIGNEE(S) | Battelle Memorial Institute (Richland, Washington) |
| INVENTOR(S) | Andrew J. Stevens (Richland, Washington); Libor Kovarik (West Richland, Washington); Nigel D. Browning (Richland, Washington); Andrey V. Liyu (Richland, Washington); Xin Yuan (Summit, New Jersey); Lawrence Carin (Durham, North Carolina) |
| ABSTRACT | Transmission microscopy imaging systems include a mask and/or other modulator situated to encode image beams, e.g., by deflecting the image beam with respect to the mask and/or sensor. The beam is modulated/masked either before or after transmission through a sample to induce a spatially and/or temporally encoded signal by modifying any of the beam/image components including the phase/coherence, intensity, or position of the beam at the sensor. For example, a mask can be placed/translated through the beam so that several masked beams are received by a sensor during a single sensor integration time. Images associated with multiple mask displacements are then used to reconstruct a video sequence using a compressive sensing method. Another example of masked modulation involves a mechanism for phase-retrieval, whereby the beam is modulated by a set of different masks in the image plane and each masked image is recorded in the diffraction plane. |
| FILED | Friday, March 18, 2016 |
| APPL NO | 15/075015 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor; G03F 7/20 (20130101) G03F 7/30 (20130101) Electric Discharge Tubes or Discharge Lamps H01J 37/26 (20130101) H01J 37/222 (20130101) Original (OR) Class H01J 37/244 (20130101) H01J 2237/226 (20130101) H01J 2237/0451 (20130101) H01J 2237/0453 (20130101) H01J 2237/2802 (20130101) H01J 2237/24455 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224194 | Ibrahim et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Battelle Memorial Institute (Richland, Washington) |
| ASSIGNEE(S) | Battelle Memorial Institute (Richland, Washington) |
| INVENTOR(S) | Yehia M. Ibrahim (Richland, Washington); Richard D. Smith (Richland, Washington) |
| ABSTRACT | An apparatus includes a first pair of opposing electrode arrangements that confine ions between them in a portion of a confinement volume inwardly laterally in a first confinement direction with respect to a longitudinal ion propagation direction, each opposing electrode arrangement including an arrangement of RF electrodes situated to receive an unbiased RF voltage having an alternate phase between adjacent RF electrodes of the arrangement of RF electrodes so as to provide the confining of ions between the first pair of opposing electrode arrangements, and a second pair of opposing electrode arrangements that confine the ions between the second pair in the confinement volume inwardly laterally in a second confinement direction that complements the first confinement direction, each opposing electrode arrangement of the second pair including an arrangement of RF electrodes that receive an unbiased RF voltage having an alternate phase between adjacent RF electrodes. |
| FILED | Thursday, September 08, 2016 |
| APPL NO | 15/260046 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 49/062 (20130101) H01J 49/063 (20130101) H01J 49/065 (20130101) H01J 49/0095 (20130101) Original (OR) Class H01J 49/4235 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224312 | Jones |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| ASSIGNEE(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| INVENTOR(S) | Adam Jones (Albuquerque, New Mexico) |
| ABSTRACT | A modification to the standard layout of vias used for vertically-stacked wafer bonding is proposed which has been found to improve the interconnect overlay while avoiding the dishing problems associated with the planarization processes used in the creation of conductive posts within the vias. In particular, the pitch, i.e. the spacing between adjacent posts, is intentionally chosen to be different for each wafer. By using different pitches, there is an increase in the probability of overlap of posts on each wafer, even when one wafer is slightly offset with respect to the other (which is possible when aligning one wafer with another in a standard bonding tool). Advantageously, the use of different pitches allows for the use of relatively small diameter (one micron or less) posts while still creating sufficient overlap for the necessary connections. |
| FILED | Tuesday, May 23, 2017 |
| APPL NO | 15/603100 |
| ART UNIT | 2811 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 24/13 (20130101) H01L 24/16 (20130101) H01L 25/50 (20130101) H01L 25/0657 (20130101) Original (OR) Class H01L 2224/13006 (20130101) H01L 2224/13014 (20130101) H01L 2224/13082 (20130101) H01L 2224/16145 (20130101) H01L 2225/06513 (20130101) H01L 2225/06527 (20130101) H01L 2225/06568 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224422 | Law et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Matt Law (Irvine, California); Jason Tolentino (Irvine, California) |
| ABSTRACT | Disclosed herein are embodiments of a method to form quantum dot field-effect transistors (QD FETs) having little to no bias-stress effect. Bias-stress effect can be reduced or eliminated through, as an example, the use of a gas or liquid to remove ligands and/or reduce charge trapping on the QD FETs, followed by deposition of an inorganic or organic matrix around the QDs in the FET. |
| FILED | Thursday, December 17, 2015 |
| APPL NO | 14/973522 |
| ART UNIT | 2898 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 29/127 (20130101) H01L 29/158 (20130101) H01L 29/778 (20130101) H01L 29/7782 (20130101) H01L 29/66969 (20130101) H01L 29/66977 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224475 | Cybart et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Shane A. Cybart (San Diego, California); Ethan Y. Cho (San Diego, California); Robert C. Dynes (La Jolla, California); Travis J. Wong (San Diego, California) |
| ABSTRACT | Nano-scale junctions, wires, and junction arrays are created by using a focused high-energy ion beam to direct-write insulating or poorly conducting barriers into thin films of materials that are sensitive to disorder, including superconductors, ferromagnetic materials and semiconductors. |
| FILED | Thursday, June 11, 2015 |
| APPL NO | 15/317101 |
| ART UNIT | 1735 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/18 (20130101) H01L 39/249 (20130101) H01L 39/2493 (20130101) H01L 39/2496 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224565 | Nanda et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-BATTELLE, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | UT-BATTELLE, LLC (Oak Ridge, Tennessee) |
| INVENTOR(S) | Jagjit Nanda (Knoxville, Tennessee); Nancy J. Dudney (Knoxville, Tennessee); Chaitanya Kumar Narula (Knoxville, Tennessee); Sreekanth Pannala (Knoxville, Tennessee); Raymond Robert Unocic (Knoxville, Tennessee); Surendra Kumar Martha (Knoxville, Tennessee) |
| ABSTRACT | A lithium ion battery includes a positive electrode comprising carbon fibers, a binder composition with conductive carbon, and a lithium rich composition. The lithium rich composition comprises at least one selected from the group consisting of Li1+x(My MzII MwIII)O2 where x+y+z+w=1, and xLi2MnO3(1−x)LiMO2, where x=0.2-0.7, and where M, MII and MIII are interchangeably manganese, nickel and cobalt, and LiM2−xMxIIO4, where M and MII are manganese and nickel, respectively, with x=0.5. A negative electrode comprises carbon fibers having bound thereto silicon nanoparticles, and a mesophase pitch derived carbon binder between the silicon nanoparticles and the carbon fibers. An electrolyte is interposed between the positive electrode and the negative electrode. Methods of making positive and negative electrodes are also disclosed. |
| FILED | Friday, October 12, 2012 |
| APPL NO | 13/651322 |
| ART UNIT | 1724 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/131 (20130101) H01M 4/134 (20130101) H01M 4/0471 (20130101) H01M 4/505 (20130101) H01M 4/525 (20130101) H01M 4/587 (20130101) H01M 4/625 (20130101) H01M 4/1391 (20130101) H01M 4/1395 (20130101) H01M 10/0525 (20130101) Original (OR) Class H01M 2004/021 (20130101) Climate Change Mitigation Technologies Related to Transportation Y02T 10/7011 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224579 | Christensen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Robert Bosch GmbH (Stuttgart, Germany) |
| ASSIGNEE(S) | Robert Bosch GmbH (Stuttgart, Germany) |
| INVENTOR(S) | John F. Christensen (Elk Grove, California); Reinhardt Klein (Mountain View, California); Abdul-Kader Srouji (San Francisco, California); Ashish Krupadanam (Cupertino, California); Anahita MirTabatabaei (San Francisco, California); Nikhil Ravi (Mountain View, California) |
| ABSTRACT | Methods and systems are described of managing a battery system. The battery system including at least one battery cell and one or more sensors configured to measure a temperature of the at least one battery cell. The method includes receiving a measurement of the temperature of the at least one battery cell, estimating an open circuit potential of the at least one battery cell, estimating a capacity fade of the at least one battery cell based on the open circuit potential of the at least one battery cell and a ratio of a change in the open circuit potential relative to a change in the temperature of the at least one battery cell, and regulating at least one of charging or discharging of the at least one battery cell based on the estimation of the capacity fade. |
| FILED | Thursday, March 17, 2016 |
| APPL NO | 15/072839 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/362 (20130101) G01R 31/3651 (20130101) G01R 31/3679 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/48 (20130101) H01M 10/425 (20130101) H01M 10/443 (20130101) H01M 10/482 (20130101) H01M 10/486 (20130101) H01M 10/613 (20150401) H01M 10/615 (20150401) H01M 10/623 (20150401) H01M 10/625 (20150401) H01M 10/633 (20150401) H01M 10/4257 (20130101) Original (OR) Class H01M 10/6567 (20150401) H01M 2010/4271 (20130101) H01M 2010/4278 (20130101) H01M 2220/20 (20130101) H01M 2220/30 (20130101) Circuit Arrangements or Systems for Supplying or Distributing Electric Power; Systems for Storing Electric Energy H02J 7/0068 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224799 | Stautner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | General Electric Company (Schenectady, New York) |
| ASSIGNEE(S) | GENERAL ELECTRIC COMPANY (Schenectady, New York) |
| INVENTOR(S) | Ernst Wolfgang Stautner (Niskayuna, New York); Evangelos Trifon Laskaris (Schenectady, New York); Kiruba Sivasubramaniam Haran (Clifton Park, New York); Ruben Jeevanasan Fair (Niskayuna, New York); Randy Scott Longtin (Schenectady, New York); Suyu Hou (Niskayuna, New York); Fulton Jose Lopez (Clifton Park, New York) |
| ABSTRACT | A cryocooler assembly for cooling a field winding of an electrical machine having an axis of rotation is provided. The assembly includes a cryocooler and a reservoir coupled in flow communication to the cryocooler and configured to contain a cooling agent. A flow assembly is coupled in flow communication to the reservoir. The flow assembly includes a first flow loop coupled in flow communication to the reservoir; a second flow loop coupled in flow communication to the reservoir; and a plurality of flow members coupled in flow communication to the first flow loop and the second flow loop and coupled to the field winding. Each flow member is configured to thermosiphon the cooling agent in a first state from the reservoir and in a second state to the reservoir. |
| FILED | Monday, October 08, 2012 |
| APPL NO | 13/646966 |
| ART UNIT | 3744 — Semiconductors/Memory |
| CURRENT CPC | Refrigeration Machines, Plants or Systems; Combined Heating and Refrigeration Systems; Heat-pump Systems F25B 9/00 (20130101) F25B 9/14 (20130101) Dynamo-electric Machines H02K 9/20 (20130101) H02K 55/00 (20130101) Original (OR) Class H02K 55/04 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/725 (20130101) Y02E 40/625 (20130101) Technical Subjects Covered by Former US Classification Y10T 29/49014 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224819 | Shamsi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Curators of the University of Missouri (Columbia, Missouri) |
| ASSIGNEE(S) | The Curators of the University of Missouri (Columbia, Missouri) |
| INVENTOR(S) | Pourya Shamsi (Rolla, Missouri); Mehdi Ferdowsi (Washington, Missouri) |
| ABSTRACT | A power circuit substantially canceling ripples at the source. The power circuit includes a switching circuit configured to control a power flow between an input and an output, a main storage element electrically connected in series with the switching circuit, and a resonant tank electrically coupled to the switching circuit and configured to compensate for switching ripples in the main storage element. Aspects of the invention can be applied to a converter circuit or to an inverter circuit. |
| FILED | Thursday, March 01, 2018 |
| APPL NO | 15/909584 |
| ART UNIT | 2838 — Electrical Circuits and Systems |
| CURRENT CPC | Apparatus for Conversion Between AC and AC, Between AC and DC, or Between DC and DC, and for Use With Mains or Similar Power Supply Systems; Conversion of DC or AC Input Power into Surge Output Power; Control or Regulation Thereof H02M 1/15 (20130101) H02M 1/084 (20130101) H02M 3/07 (20130101) H02M 3/157 (20130101) H02M 3/158 (20130101) H02M 3/33507 (20130101) Original (OR) Class H02M 3/33576 (20130101) H02M 7/483 (20130101) H02M 7/538 (20130101) H02M 2001/0058 (20130101) Coding; Decoding; Code Conversion in General H03M 5/08 (20130101) Climate Change Mitigation Technologies Related to Buildings, e.g Housing, House Appliances or Related End-user Applications Y02B 70/1425 (20130101) Y02B 70/1441 (20130101) Y02B 70/1491 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US D842236 | Garduno et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Triad National Security, LLC (Los Alamos, New Mexico) |
| ASSIGNEE(S) | Triad National Security, LLC (Los Alamos, New Mexico) |
| INVENTOR(S) | Gilbert John Garduno (Los Alamos, New Mexico); Orlando Thomas Lopez (Los Alamos, New Mexico); Kyle Matthew Sternberg (Los Alamos, New Mexico) |
| ABSTRACT | |
| FILED | Thursday, July 28, 2016 |
| APPL NO | 29/572474 |
| ART UNIT | 2924 — Design |
| CURRENT CPC | Equipment for production, distribution, or transformation of energy D13/103 |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Science Foundation (NSF)
| US 10219870 | Mondry et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nabraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Jack Mondry (Edina, Minnesota); Shane Farritor (Lincoln, Nebraska); Eric Markvicka (Brush, Colorado); Thomas Frederick (Lincoln, Nebraska); Joe Bartels (Lincoln, Nebraska) |
| ABSTRACT | Disclosed herein are various medical device components, including components that can be incorporated into robotic and/or in vivo medical devices. Also disclosed are various medical devices for in vivo medical procedures. Included herein, for example, is a surgical robotic device having an elongate device body, a right robotic arm coupled to a right shoulder assembly, and a left robotic arm coupled to a left shoulder assembly. |
| FILED | Monday, November 21, 2016 |
| APPL NO | 15/357663 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/00234 (20130101) A61B 34/20 (20160201) A61B 34/30 (20160201) Original (OR) Class A61B 90/361 (20160201) A61B 2017/2906 (20130101) A61B 2034/302 (20160201) A61B 2034/2048 (20160201) A61B 2034/2051 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/0084 (20130101) B25J 9/0087 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219919 | Belter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | YALE UNIVERSITY (New Haven, Connecticut) |
| INVENTOR(S) | Joseph Thomas Belter (New Haven, Connecticut); Aaron Michael Dollar (New Haven, Connecticut); Michael Leddy (New Haven, Connecticut); Kevin Dale Gemmell, Jr. (San Diego, California) |
| ABSTRACT | The present invention provides a prosthetic hand capable of multiple grasp types. The prosthetic finger units are underactuated both within and between the finger units using a differential mechanism arrangement. The locking movement of the prosthetic thumb unit is coupled to the differential mechanism. As the user repositions the prosthetic thumb unit, the differential mechanism is effected as to alter both the initial positions and force distribution of the prosthetic finger units. The present invention further provides an additive manufacturing molding method for making the same. |
| FILED | Thursday, August 18, 2016 |
| APPL NO | 15/240819 |
| ART UNIT | 3774 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/68 (20130101) A61F 2/72 (20130101) A61F 2/583 (20130101) Original (OR) Class A61F 2/586 (20130101) A61F 2/5044 (20130101) A61F 2/5046 (20130101) A61F 2002/701 (20130101) A61F 2002/5075 (20130101) A61F 2002/5093 (20130101) A61F 2002/6872 (20130101) A61F 2005/563 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220004 | Zink et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Jeffrey I. Zink (Sherman Oaks, California); Courtney R. Thomas (Venice, California); Monty Liong (Foster City, California); Sarah Ann Henscheid (Corvallis, Oregon); Jinwoo Cheon (Seoul, South Korea); Jae-Hyun Lee (Seoul, South Korea); Daniel P. Ferris (Los Angeles, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Jeffrey I. Zink (Sherman Oaks, California); Courtney R. Thomas (Venice, California); Monty Liong (Foster City, California); Sarah Ann Henscheid (Corvallis, Oregon); Jinwoo Cheon (Seoul, South Korea); Jae-Hyun Lee (Seoul, South Korea); Daniel P. Ferris (Los Angeles, California) |
| ABSTRACT | A method for controlled delivery of a substance into a body includes administering a plurality of containment vessels into the body, in which each of the plurality of containment vessels includes a quantity of the substance loaded therein prior to the administering; and providing a time-varying magnetic field such that the plurality of containment vessels are exposed thereto to cause a release of at least a portion of the substance from the plurality of containment vessels. Each of the plurality of containment vessels has an average outer diameter less than about 1 μm. |
| FILED | Monday, July 16, 2012 |
| APPL NO | 13/550374 |
| ART UNIT | 3783 — Body Treatment, Kinestherapy, and Exercising |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5094 (20130101) Original (OR) Class A61K 41/0028 (20130101) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 2205/0288 (20130101) A61M 2205/368 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220089 | Hsiao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| INVENTOR(S) | Elaine Hsiao (Rowland Heights, California); Sarkis K Mazmanian (Porter Ranch, California); Paul H Patterson (Altadena, California); Sara McBride (Pasadena, California) |
| ABSTRACT | Disclosed herein are compositions, systems, and methods for diagnosing and treatment of subjects suffering from anxiety, autism spectrum disorder (ASD), or a pathological condition with one or more of the symptoms of ASD. |
| FILED | Wednesday, August 28, 2013 |
| APPL NO | 14/012769 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/74 (20130101) A61K 35/741 (20130101) A61K 39/3955 (20130101) Original (OR) Class A61K 2039/505 (20130101) Peptides C07K 16/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) G01N 2800/28 (20130101) G01N 2800/7076 (20130101) G01N 2800/7085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220124 | Rylander et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Christopher Rylander (Blacksburg, Virginia); Mehmet A. Kosoglu (Fairfax, Virginia); Robert L. Hood (Blacksburg, Virginia); John L. Robertson (Floyd, Virginia); John H. Rossmeisl (Blacksburg, Virginia); David C. Grant (Blacksburg, Virginia); Marissa N. Rylander (Blacksburg, Virginia) |
| ASSIGNEE(S) | VIRGINIA TECH INTELLECTUAL PROPERTIES, INC. (Blacksburg, Virginia) |
| INVENTOR(S) | Christopher Rylander (Blacksburg, Virginia); Mehmet A. Kosoglu (Fairfax, Virginia); Robert L. Hood (Blacksburg, Virginia); John L. Robertson (Floyd, Virginia); John H. Rossmeisl (Blacksburg, Virginia); David C. Grant (Blacksburg, Virginia); Marissa N. Rylander (Blacksburg, Virginia) |
| ABSTRACT | The present invention relates to the field of optical imaging and therapeutics. More particularly, embodiments of the present invention provide minimally-invasive Fiberoptic Microneedle Devices (FMDs) for light-based therapeutics, which physically penetrate tissue and deliver light directly into the target area below the skin surface. Embodiments of the invention enable depth-selective and deep photothermal therapeutics and include methods of treating cancer, methods of re-shaping or removing adipose tissue, and methods of delivering drugs or co-delivering drugs and energy to selected tissue. |
| FILED | Tuesday, February 28, 2012 |
| APPL NO | 14/002058 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 18/20 (20130101) A61B 18/22 (20130101) A61B 2018/208 (20130101) A61B 2018/00452 (20130101) A61B 2018/00464 (20130101) A61B 2018/00476 (20130101) A61B 2018/2005 (20130101) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 1/008 (20130101) Original (OR) Class A61M 5/158 (20130101) A61M 2202/08 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 5/062 (20130101) A61N 2005/063 (20130101) A61N 2005/0612 (20130101) Rotary-piston, or Oscillating-piston, Positive-displacement Machines for Liquids; Rotary-piston, or Oscillating-piston, Positive-displacement Pumps F04C 2270/0421 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220520 | Hawkes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | Elliot W. Hawkes (San Francisco, California) |
| ABSTRACT | Grasping devices and mechanisms are provided capable of grasping onto flat or curved surfaces repeatably and releasably using synthetic dry adhesives. Applications of these devices can be found in a large variety of robotic applications. |
| FILED | Wednesday, May 20, 2015 |
| APPL NO | 15/308472 |
| ART UNIT | 1785 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Manipulators; Chambers Provided With Manipulation Devices B25J 15/008 (20130101) Original (OR) Class Aeroplanes; Helicopters B64C 25/52 (20130101) B64C 39/028 (20130101) B64C 2201/12 (20130101) B64C 2201/18 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/24802 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221153 | Petroff, II et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Saint Louis University (St. Louis, Missouri) |
| ASSIGNEE(S) | Saint Louis University (St. Louis, Missouri) |
| INVENTOR(S) | John T. Petroff, II (St. Louis, Missouri); Ryan D. McCulla (St. Louis, Missouri); Christopher Arnatt (Manchester, Missouri) |
| ABSTRACT | The present invention generally relates to various dibenzothiophene compounds, processes for preparing these compounds, and use of these compounds in organic light-emitting diodes and as cellular imaging agents. In particular, the compounds of the present invention include various sulfoxide and sulfone analogs of various dibenzothiophene compounds. The present invention also relates to cell imaging agents comprising one or more of the dibenzothiophene compounds and processes for imaging a cell using the compounds. The present invention also relates to organic light-emitting diodes comprising one or more of the dibenzothiophene compounds and processes for preparing these organic light-emitting diodes. |
| FILED | Thursday, May 03, 2018 |
| APPL NO | 15/970584 |
| ART UNIT | 1625 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 333/76 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 51/56 (20130101) H01L 51/0074 (20130101) H01L 51/5012 (20130101) H01L 51/5206 (20130101) H01L 51/5221 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221216 | Ly et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Carnegie Mellon University (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | Carnegie Mellon University (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Danith H. Ly (Pittsburgh, Pennsylvania); Raman Bahal (Hamden, Connecticut); Arunava Manna (Pittsburgh, Pennsylvania); Dinesh Chandra Bhunia (Pittsburgh, Pennsylvania); Rapireddy Srinivas (Westborough, Massachusetts); Yidan Cong (Gaithersburg, Maryland) |
| ABSTRACT | Described herein are recognition modules that bind specifically to a template nucleic acid and which ligate together in a reducing environment to produce a gamma peptide nucleic acid (γPNA) oligomer. Also provided are methods of synthesizing a γPNA oligomer on a template using the recognition modules. |
| FILED | Friday, April 11, 2014 |
| APPL NO | 14/782448 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Peptides C07K 7/02 (20130101) C07K 14/003 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/87 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6806 (20130101) C12Q 1/6806 (20130101) C12Q 2525/107 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221272 | Lau et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Kenneth Ka Shun Lau (Cherry Hill, New Jersey); Sruthi Janakiraman (Easton, Pennsylvania); Chia-Yun Hsieh (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | DREXEL UNIVERSITY (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Kenneth Ka Shun Lau (Cherry Hill, New Jersey); Sruthi Janakiraman (Easton, Pennsylvania); Chia-Yun Hsieh (Philadelphia, Pennsylvania) |
| ABSTRACT | A method of forming a patterned polymer layer on a substrate and a substrate having a polymer layer formed by the method. The method includes providing a substrate comprising a first surface having a first surface energy and a pattern located on the substrate forming a second surface having a second, lower surface energy than the first surface, and selectively depositing a polymeric layer onto the first surface using a monomer material in an initiated chemical vapor deposition process, wherein the initiated chemical vapor deposition process is operated under supersaturation conditions during the deposition process. |
| FILED | Monday, June 05, 2017 |
| APPL NO | 15/613854 |
| ART UNIT | 2816 — Semiconductors/Memory |
| CURRENT CPC | Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 20/06 (20130101) C08F 26/10 (20130101) C08F 271/02 (20130101) Original (OR) Class Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 14/042 (20130101) C23C 14/165 (20130101) C23C 16/30 (20130101) C23C 16/452 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221333 | Wynne et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | VIRGINIA COMMONWEALTH UNIVERSITY (Richmond, Virginia) |
| ASSIGNEE(S) | VIRGINIA COMMONWEALTH UNIVERSITY (Richmond, Virginia) |
| INVENTOR(S) | Kenneth J. Wynne (Midlothian, Virginia); Wei Zhang (Midlothian, Virginia) |
| ABSTRACT | A compound is provided, having the formula (I), wherein Rs is a soft block polymer; wherein each T is independently a urethane or urea linkage; see formulae (A) and (B); wherein each RD is independently —CH3, —CH2CH3, —CH2CH2CH3, or —CH2CH2CH2CH3; wherein each R′D is independently —CH3, —CH2CH3, —CH2CH2CH3, —CH2CH2CH2CH3, or —ORD; and wherein each p is independently 1, 2, or 3. Compositions containing the compound, and methods of making and using the compound are provided. |
| FILED | Tuesday, September 30, 2014 |
| APPL NO | 15/025888 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 65/336 (20130101) C08G 77/54 (20130101) C08G 77/388 (20130101) Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients C08K 5/5465 (20130101) C08K 5/5465 (20130101) C08K 5/5465 (20130101) Compositions of Macromolecular Compounds C08L 71/02 (20130101) C08L 75/04 (20130101) C08L 83/04 (20130101) C08L 83/08 (20130101) Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 171/02 (20130101) Original (OR) Class C09D 183/14 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 3/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221399 | Gelbart et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | William M. Gelbart (Los Angeles, California); Charles M. Knobler (Los Angeles, California); Rees F. Garmann (Santa Cruz, California); Odisse Azizgolshani (Whittier, California); Ruben D. Cadena-Nava (Ensenada, Mexico) |
| ABSTRACT | The invention provides compositions of matter comprising a cowpea chlorotic mottle virus capsid protein (CCMV CP) and a ribonucleic acid, as well as methods for using such compositions. In such compositions, the cowpea chlorotic mottle virus capsid protein envelops the ribonucleic acid so as to for a capsid that can inhibit the degradation of the ribonucleic acid (e.g. by RNAses). A method of delivering a ribonucleic acid into the cytoplasm of a mammalian cell is also provided. Typically, the method comprises the steps of combining the mammalian cell with a composition of matter described herein under conditions selected to allow the cowpea chlorotic mottle virus capsid to contact the mammalian cell and deliver the ribonucleic acid into the cytoplasm of a mammalian cell. |
| FILED | Friday, March 03, 2017 |
| APPL NO | 15/449827 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 14/005 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) Original (OR) Class C12N 7/045 (20130101) C12N 9/1247 (20130101) C12N 2770/14022 (20130101) C12N 2770/14023 (20130101) C12N 2770/14033 (20130101) C12N 2770/14042 (20130101) Enzymes C12Y 207/07006 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221446 | Brown, III et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Carl Brown, III (Albuquerque, New Mexico); Steven Wayde Graves (Santa Fe, New Mexico); Darko Stefanovic (Albuquerque, New Mexico); Matthew Richard Lakin (Albuquerque, New Mexico) |
| ASSIGNEE(S) | STC.UNM (Albuquerque, New Mexico) |
| INVENTOR(S) | Carl Brown, III (Albuquerque, New Mexico); Steven Wayde Graves (Santa Fe, New Mexico); Darko Stefanovic (Albuquerque, New Mexico); Matthew Richard Lakin (Albuquerque, New Mexico) |
| ABSTRACT | This disclosure describes a structured polynucleotide, devices that include the structured polynucleotide, and methods involving the structured polynucleotide and/or devices. Generally, the structured polynucleotide includes five domains. A first domain acts as a toehold for an input DNA logic gate to initiate binding to an SCS biomolecule. A second domain acts as a substrate recognition sequence for an upstream DNA logic gate. A third domain acts as a toehold for a output DNA logic gate to initiate binding of the SCS biomolecule to the gate. A fourth domain acts as an effector sequence to alter the state of the output logic gate. A fifth domain acts as a cage sequence to lock the effector sequence in an inactive state until an input gate binds to the structured polynucleotide. |
| FILED | Monday, October 03, 2016 |
| APPL NO | 15/283594 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6818 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222262 | Pate et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Virginia Patent Foundation (Charlottesville, Virginia) |
| ASSIGNEE(S) | University of Virginia Patent Foundation (Charlottesville, Virginia) |
| INVENTOR(S) | Brooks Hart Pate (Charlottesville, Virginia); Justin L. Neill (Charlottesville, Virginia) |
| ABSTRACT | An emission can be obtained from a sample in response to excitation using a specified range of excitation frequencies. Such excitation can include generating a specified chirped waveform and a specified downconversion local oscillator (LO) frequency using a digital-to-analog converter (DAC), upconverting the chirped waveform via mixing the chirped waveform with a specified upconversion LO frequency, frequency multiplying the upconverted chirped waveform to provide a chirped excitation signal for exciting the sample, receiving an emission from sample, the emission elicited at least in part by the chirped excitation signal, and downconverting the received emission via mixing the received emission with a signal based on the specified downconversion LO signal to provide a downconverted emission signal within the bandwidth of an analog-to-digital converter (ADC). The specified chirped waveform can include a first chirped waveform during a first duration, and a second chirped waveform during a second duration. |
| FILED | Thursday, August 31, 2017 |
| APPL NO | 15/692339 |
| ART UNIT | 2886 — Optics |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 3/443 (20130101) Original (OR) Class G01J 3/453 (20130101) G01J 3/2889 (20130101) G01J 3/4338 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/35 (20130101) G01N 21/3586 (20130101) G01N 2021/3595 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222315 | Grier et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NEW YORK UNIVERSITY (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | David G. Grier (New York, New York); Aaron Yevick (New York, New York); Mark Hannel (New York, New York) |
| ABSTRACT | Holograms of colloidal dispersions encode comprehensive information about individual particles' three-dimensional positions, sizes and optical properties. Extracting that information typically is computation-ally intensive, and thus slow. Machine-learning techniques based on support vector machines (SVMs) can analyze holographic video microscopy data in real time on low-power computers. The resulting stream of precise particle-resolved tracking and characterization data provides unparalleled insights into the composition and dynamics of colloidal dispersions and enables applications ranging from basic research to process control and quality assurance. |
| FILED | Monday, October 12, 2015 |
| APPL NO | 15/518739 |
| ART UNIT | 2886 — Optics |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/147 (20130101) G01N 15/0227 (20130101) G01N 15/1429 (20130101) Original (OR) Class G01N 15/1434 (20130101) G01N 15/1484 (20130101) G01N 2015/0233 (20130101) G01N 2015/0238 (20130101) G01N 2015/1075 (20130101) G01N 2015/1445 (20130101) G01N 2015/1454 (20130101) G01N 2015/1477 (20130101) G01N 2015/1488 (20130101) G01N 2015/1493 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222390 | Glass et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Curators of the University of Missouri (Columbia, Missouri) |
| ASSIGNEE(S) | THE CURATORS OF THE UNIVERSITY OF MISSOURI (Columbia, Missouri) |
| INVENTOR(S) | Timothy Glass (Columbia, Missouri); Kenneth Hettie (Columbia, Missouri) |
| ABSTRACT | A fluorescence sensing compound for separately detecting and visualizing one or more monoamine neurotransmitters in cells, the fluorescence sensing compound having the following formula: wherein R1 and R2 are each independently selected from the group consisting of hydrogen, alkyl, alkylene, aryl, cycloalkyl; wherein R3 is selected from the group consisting of hydrogen, alkyl, alkylene, aryl, cycloalkyl, cyano, azido; and wherein R4 is selected from the group consisting of (CH3)2Si, O, N, S, and CH2. |
| FILED | Friday, August 05, 2016 |
| APPL NO | 15/229716 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Organic Dyes or Closely-related Compounds for Producing Dyes; Mordants; Lakes C09B 57/02 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/06 (20130101) C09K 11/07 (20130101) C09K 2211/1048 (20130101) C09K 2211/1051 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/582 (20130101) G01N 33/942 (20130101) Original (OR) Class G01N 33/9406 (20130101) G01N 33/9413 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222493 | Urazghildiiev |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cornell University (Ithaca, New York) |
| ASSIGNEE(S) | Cornell University (Ithaca, New York) |
| INVENTOR(S) | Ildar Urazghildiiev (Ithaca, New York) |
| ABSTRACT | The present invention is directed to acoustics and signal processing. More specifically, the present invention is directed to a system and methods by which whether and the time during which one or more subjects are present within a given area of a marine or terrestrial ecosystem, and other information regarding the subjects can be efficiently determined by the sounds that the subjects produce. Advantageously, certain embodiments of the present invention permit a user to select and rapidly produce one or more visual presentations of the signals of interest (SOI) recorded from the passive acoustic monitoring of a given area of an ecosystem in order to obtain additional information about the subjects. |
| FILED | Thursday, October 23, 2014 |
| APPL NO | 15/029758 |
| ART UNIT | 2817 — Semiconductors/Memory |
| CURRENT CPC | Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags G01V 1/001 (20130101) Original (OR) Class G01V 1/38 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222694 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Fengwei Huo (Evanston, Illinois); Zijian Zheng (Kowloon, China PRC); Gengfeng Zheng (Ambler, Pennsylvania) |
| ABSTRACT | The disclosure relates to methods of printing indicia on a substrate using a tip array comprised of elastomeric, compressible polymers. The tip array can be prepared using conventional photolithographic methods and can be tailored to have any desired number and/or arrangement of tips. Numerous copies (e.g., greater than 15,000, or greater than 11 million) of a pattern can be made in a parallel fashion in as little as 40 minutes. |
| FILED | Thursday, May 19, 2016 |
| APPL NO | 15/159148 |
| ART UNIT | 2854 — Printing/Measuring and Testing |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 10/00 (20130101) B82Y 30/00 (20130101) B82Y 40/00 (20130101) Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor; G03F 7/0002 (20130101) Original (OR) Class Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/856 (20130101) Y10S 977/874 (20130101) Y10S 977/878 (20130101) Y10S 977/887 (20130101) Y10S 977/888 (20130101) Y10S 977/902 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223141 | Mars et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Jason Mars (Ann Arbor, Michigan); Michael Laurenzano (Dexter, Michigan); Lingjia Tang (Ann Arbor, Michigan) |
| ABSTRACT | A system is provided for monitoring, regenerating and replacing the code of running applications with semantically equivalent, specialized code versions that reflect the demands of the execution environment. The system includes a co-designed compiler and runtime system that virtualizes a selected set of edges in a host program, where these edges provide hooks through which the runtime system may redirect execution into an intermediate representation utilized to optimize introspective and extrospective processes. |
| FILED | Thursday, February 09, 2017 |
| APPL NO | 15/428917 |
| ART UNIT | 2197 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 8/443 (20130101) G06F 9/4552 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224422 | Law et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Matt Law (Irvine, California); Jason Tolentino (Irvine, California) |
| ABSTRACT | Disclosed herein are embodiments of a method to form quantum dot field-effect transistors (QD FETs) having little to no bias-stress effect. Bias-stress effect can be reduced or eliminated through, as an example, the use of a gas or liquid to remove ligands and/or reduce charge trapping on the QD FETs, followed by deposition of an inorganic or organic matrix around the QDs in the FET. |
| FILED | Thursday, December 17, 2015 |
| APPL NO | 14/973522 |
| ART UNIT | 2898 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 29/127 (20130101) H01L 29/158 (20130101) H01L 29/778 (20130101) H01L 29/7782 (20130101) H01L 29/66969 (20130101) H01L 29/66977 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224456 | Gaska et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sensor Electronic Technology, Inc. (Columbia, South Carolina) |
| ASSIGNEE(S) | Sensor Electronic Technology, Inc. (Columbia, South Carolina) |
| INVENTOR(S) | Remigijus Gaska (Columbia, South Carolina); Maxim S. Shatalov (Columbia, South Carolina); Michael Shur (Latham, New York); Alexander Dobrinsky (Silver Spring, Maryland) |
| ABSTRACT | A method of fabricating a light emitting diode, which includes an n-type contact layer and a light generating structure adjacent to the n-type contact layer, is provided. The light generating structure includes a set of quantum wells. The contact layer and light generating structure can be configured so that a difference between an energy of the n-type contact layer and an electron ground state energy of a quantum well is greater than an energy of a polar optical phonon in a material of the light generating structure. Additionally, the light generating structure can be configured so that its width is comparable to a mean free path for emission of a polar optical phonon by an electron injected into the light generating structure. |
| FILED | Monday, October 30, 2017 |
| APPL NO | 15/797282 |
| ART UNIT | 2822 — Semiconductors/Memory |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 33/04 (20130101) H01L 33/06 (20130101) Original (OR) Class H01L 33/10 (20130101) H01L 33/22 (20130101) H01L 33/0025 (20130101) H01L 33/32 (20130101) H01L 33/38 (20130101) H01L 33/46 (20130101) H01L 33/0075 (20130101) H01L 33/145 (20130101) H01L 33/385 (20130101) H01L 33/405 (20130101) H01L 2933/0058 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224481 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Trustees of the University of Pennsylvania (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | The Trustees of the University of Pennsylvania (Philadelphia, Pennsylvania) |
| INVENTOR(S) | I-Wei Chen (Swarthmore, Pennsylvania); Yang Lu (Wynnewood, Pennsylvania) |
| ABSTRACT | Provided are methods of forming electric devices by effecting application of a stress to the device so as to deform the device within the device's elastic limit and to place the device into a new electric—e.g., resistance—state. |
| FILED | Tuesday, October 07, 2014 |
| APPL NO | 14/507977 |
| ART UNIT | 2894 — Semiconductors/Memory |
| CURRENT CPC | Static Stores G11C 13/0007 (20130101) G11C 13/0069 (20130101) G11C 2013/0083 (20130101) G11C 2013/0095 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 45/10 (20130101) H01L 45/145 (20130101) H01L 45/146 (20130101) H01L 45/1641 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224499 | Wu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Kansas (Lawrence, Kansas) |
| ASSIGNEE(S) | UNIVERSITY OF KANSAS (Lawrence, Kansas) |
| INVENTOR(S) | Judy Z. Wu (Lawrence, Kansas); Youpin Gong (Lawrence, Kansas); Qingfeng Liu (Lawrence, Kansas) |
| ABSTRACT | An optoelectronic device comprises a nanocomposite comprising a carbon nanostructure having a surface and a biomolecule adsorbed on the surface and forming a heterojunction at the interface of the carbon nanostructure and the biomolecule, the carbon nanostructure and the biomolecule each characterized by respective conduction band edges and valence band edges. The device further comprises first and second electrodes in electrical communication with the nanocomposite. The conduction band edge offset, the valence band edge offset, or both, across the heterojunction is greater in energy than the binding energy of an exciton generated in the carbon nanostructure or the biomolecule upon the absorption of light such that the exciton dissociates at the heterojunction to an electron, which is injected into one of the carbon nanostructure and the biomolecule, and a hole, which is injected into the other of the carbon nanostructure and the biomolecule. |
| FILED | Friday, January 29, 2016 |
| APPL NO | 15/547914 |
| ART UNIT | 2884 — Optics |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 1/44 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 29/1606 (20130101) H01L 31/06 (20130101) H01L 31/0288 (20130101) H01L 31/1136 (20130101) H01L 51/0048 (20130101) H01L 51/0093 (20130101) H01L 51/4206 (20130101) H01L 51/4253 (20130101) Original (OR) Class Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/549 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224694 | Wei et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rhode Island Board of Education, State of Rhode Island and Providence Plantations (Providence, Rhode Island) |
| ASSIGNEE(S) | Rhode Island Board of Education, State of Rhode Island and Providence Plantations (Providence, Rhode Island) |
| INVENTOR(S) | Tao Wei (West Kingston, Rhode Island); Zhen Chen (Kingstown, Rhode Island); Gerald Hefferman (Warwick, Rhode Island) |
| ABSTRACT | The present disclosure provides methods and apparatus to improve the dynamic coherent length of a sweep velocity-locked laser pulse generator (SV-LLPG) in an all-electronic fashion. A digital SV-LLPG is disclosed with two operation modes, i.e., unidirectional and bidirectional sweep modes; self-adaptive and time-dependent loop parameters (gain and location of poles/zeros); and, self-adaptive initial input curve. High frequency locking architectures, both single-side band (SSB) modulation method and direct phase measurement method, are provided to suppress the linewidth, or improve the coherent length, of the swept laser. A combination of high and low frequency locking, or a combination of multiple architectures disclosed in this invention, is utilized to achieve a higher level of linewidth reduction. The enhanced laser coherence extends the measurement range by at least one order of magnitude for applications including frequency-modulated continuous wave (FMCW) light detection and ranging (LiDAR) and optical fiber distributed sensing applications. |
| FILED | Friday, July 21, 2017 |
| APPL NO | 15/656255 |
| ART UNIT | 2828 — Semiconductors/Memory |
| CURRENT CPC | Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 5/042 (20130101) H01S 5/06223 (20130101) Original (OR) Class H01S 5/06817 (20130101) H01S 5/06821 (20130101) H01S 5/06835 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224835 | Singh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | IOWA STATE UNIVERSITY RESEARCH FOUNDATION, INC. (Ames, Iowa) |
| ASSIGNEE(S) | Iowa State University Research Foundation, Inc. (Ames, Iowa) |
| INVENTOR(S) | Kanishka Aman Singh (Ames, Iowa); Ratnesh Kumar (Ames, Iowa); Robert J. Weber (Boone, Iowa) |
| ABSTRACT | The invention relates to a bistable piezoelectric cantilever-based vibration energy harvester that increases the energy harvested over a broad frequency of vibrations by introducing bistability to the cantilever through use of two repelling magnets, one mounted on the cantilever and one at a location facing the first. This increases the amplitude and velocity of cantilever vibration, hence harvested power, while nonlinearity makes the system efficient over almost the entire range of frequencies, lower than the natural resonant frequency of the linear version without the magnets. Such improved performance is seen while the cantilever remains in the bistable mode. To broaden the range of vibration amplitudes over which the harvester continues to operate in bistable mode, the harvester includes a mechanical way of tuning the magnetic force, by spring-loading the magnet facing the mounted one, enabling self-adjustment of the distance between the magnets automatically that favors bistable operation over a larger range of excitations, and that too without needing any extra energy. |
| FILED | Monday, April 11, 2016 |
| APPL NO | 15/095836 |
| ART UNIT | 2837 — Electrical Circuits and Systems |
| CURRENT CPC | Dynamo-electric Machines H02K 35/02 (20130101) Electric Machines Not Otherwise Provided for H02N 2/181 (20130101) H02N 2/186 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225036 | Noorzad et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California); The Research Foundation for the State University of New York (Amherst, New York) |
| ASSIGNEE(S) | California Institute of Technology (Pasadena, California); The Research Foundation for the State University of New York (Amherst, New York) |
| INVENTOR(S) | Parham Noorzad (San Diego, California); Michelle Effros (San Marino, California); Michael Langberg (Clarence, New York) |
| ABSTRACT | Systems and methods for improved data transmission utilizing a communication facilitator are described in accordance with embodiments of the invention. One embodiment includes a plurality of nodes, that each comprise: a transmitter; a receiver; and an encoder that encodes message data for transmission using a plurality of codewords; a cooperation facilitator node comprising: a transmitter; and a receiver; wherein the nodes are configured to transmit data parameters to the cooperation facilitator; wherein the cooperation facilitator is configured to generate cooperation parameters based upon the data parameters received from the nodes; wherein the cooperation facilitator is configured to transmit cooperation parameters to the nodes; and wherein the encoder in each of the nodes selects a codeword from the plurality of codewords based at least in part upon the cooperation parameters received from the communication facilitator and transmit the selected codeword via the multiple access channel. |
| FILED | Monday, June 13, 2016 |
| APPL NO | 15/181393 |
| ART UNIT | 2412 — Multiplex and VoIP |
| CURRENT CPC | Transmission H04B 7/2637 (20130101) Multiplex Communication H04J 13/16 (20130101) Original (OR) Class Wireless Communication Networks H04W 4/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10225906 | Coe-Sullivan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Seth Coe-Sullivan (Belmont, Massachusetts); Jonathan S. Steckel (Cambridge, Massachusetts); LeeAnn Kim (Dover, Massachusetts); Moungi G. Bawendi (Cambridge, Massachusetts); Vladimir Bulovic (Lexington, Massachusetts) |
| ASSIGNEE(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Seth Coe-Sullivan (Belmont, Massachusetts); Jonathan S. Steckel (Cambridge, Massachusetts); LeeAnn Kim (Dover, Massachusetts); Moungi G. Bawendi (Cambridge, Massachusetts); Vladimir Bulovic (Lexington, Massachusetts) |
| ABSTRACT | A light emitting device includes a semiconductor nanocrystal in a layer. The layer can be a monolayer of semiconductor nanocrystals. The monolayer can form a pattern on a substrate. |
| FILED | Thursday, October 20, 2005 |
| APPL NO | 11/253595 |
| ART UNIT | 2875 — Optics |
| CURRENT CPC | Typewriters; Selective Printing Mechanisms,, i.e Mechanisms Printing Otherwise Than From a Forme; Correction of Typographical Errors B41J 2/0057 (20130101) Printing, Duplicating, Marking, or Copying Processes; Colour Printing, B41M 1/02 (20130101) B41M 3/003 (20130101) B41M 5/0256 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) B82Y 30/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/6715 (20130101) H01L 51/56 (20130101) H01L 51/502 (20130101) H01L 51/5012 (20130101) Electric Heating; Electric Lighting Not Otherwise Provided for H05B 33/10 (20130101) Original (OR) Class H05B 33/145 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
United States Postal Service (USPS)
| US 10220416 | Bomgaugh |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Postal Service (Washington, District of Columbia) |
| ASSIGNEE(S) | United States Postal Service (Washington, District of Columbia) |
| INVENTOR(S) | Scott R. Bomgaugh (Burke, Virginia) |
| ABSTRACT | Embodiments of a system and method for sorting and sequencing articles in a processing facility are disclosed. Delivery endpoints are divided and grouped into stop groups. A first sorter sorts items according to stop group and outputs the items to trays. The output trays from the first sorter are loaded to a second sorter in stop group order. The second sorter sorts items for each stop group into separate lanes. Each lane can then be sorted into output bins in delivery sequence order. |
| FILED | Monday, October 09, 2017 |
| APPL NO | 15/727866 |
| ART UNIT | 3655 — Material and Article Handling |
| CURRENT CPC | Postal Sorting; Sorting Individual Articles, or Bulk Material Fit to be Sorted Piece-meal, e.g by Picking B07C 1/025 (20130101) B07C 3/02 (20130101) Original (OR) Class B07C 3/08 (20130101) B07C 3/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221990 | Yang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Postal Service (Washington, District of Columbia) |
| ASSIGNEE(S) | United States Postal Service (Washington, District of Columbia) |
| INVENTOR(S) | Dongliang Yang (Ellicott City, Maryland); Matthew G. Good (Marriottsville, Maryland); Leung M. Shiu (Gaithersburg, Maryland) |
| ABSTRACT | A system of mitigating force in a mechanical system, the system comprising a frame member, a first rail connected to the frame member, a second rail connected to the frame member and extending along the frame member in parallel to the first rail, an assembly movably engaging the first and second rails, and a first bracket located between the first and second rails, with at least one first bracket attachment secured to the frame member, the first bracket sharing an upper edge with a lower edge of the first rail, such that a downward force applied on the first rail is distributed to the first bracket and the frame member via the at least one first bracket attachment. |
| FILED | Thursday, March 30, 2017 |
| APPL NO | 15/474898 |
| ART UNIT | 3632 — Static Structures, Supports and Furniture |
| CURRENT CPC | Postal Sorting; Sorting Individual Articles, or Bulk Material Fit to be Sorted Piece-meal, e.g by Picking B07C 1/02 (20130101) B07C 9/00 (20130101) Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/141 (20170801) Transport or Storage Devices, e.g Conveyors for Loading or Tipping, shop Conveyor Systems Or pneumatic Tube Conveyors B65G 59/00 (20130101) Handling Thin or Filamentary Material, e.g Sheets, Webs, Cables B65H 1/00 (20130101) B65H 3/00 (20130101) B65H 5/24 (20130101) B65H 2402/20 (20130101) B65H 2402/30 (20130101) B65H 2402/40 (20130101) Frames, Casings or Beds of Engines, Machines or Apparatus, Not Specific to Engines, Machines or Apparatus Provided for Elsewhere; Stands; Supports F16M 1/026 (20130101) Original (OR) Class F16M 11/043 (20130101) F16M 11/2085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223665 | Krause et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Postal Service (Washington, District of Columbia) |
| ASSIGNEE(S) | UNITED STATES POSTAL SERVICE (Washington, District of Columbia) |
| INVENTOR(S) | Robert Krause (Severna Park, Maryland); Wayne Orbke (Germantown, Maryland); Michael Selnick (Reston, Virginia); Michael Murphy (Collierrville, Tennessee); Harry Aldstadt (Woodbridge, Virginia); Gerald Matthews (Germantown, Tennessee); Audrey K. Conley (Memphis, Tennessee) |
| ABSTRACT | This disclosure describes systems and methods for collecting and processing change of address data and providing change of address services to a customer using a computer network. The address data can include a physical address, an electronic address, or both. The systems and methods may also provide additional services to the customer to assist in changing addresses. |
| FILED | Tuesday, May 26, 2015 |
| APPL NO | 14/721093 |
| ART UNIT | 3629 — Business Methods - Incentive Programs, Coupons; Operations Research; Electronic Shopping; Health Care; Point of Sale, Inventory, Accounting; Cost/ Price, Reservations, Shipping and Transportation; Business Processing |
| CURRENT CPC | Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/10 (20130101) G06Q 10/107 (20130101) G06Q 10/0838 (20130101) Original (OR) Class G06Q 20/401 (20130101) G06Q 20/4016 (20130101) G06Q 50/32 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 51/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223841 | Bentley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Postal Service (Washington, District of Columbia) |
| ASSIGNEE(S) | United States Postal Service (Washington, District of Columbia) |
| INVENTOR(S) | Daniel Mark Bentley (Washington, District of Columbia); Nii-Kwashie Aryeetey (Washington, District of Columbia) |
| ABSTRACT | Systems and methods for processing distribution items having unique identifiers affixed thereon. The unique identifiers can include computer readable codes and written alphanumeric strings generated by a user. A system receives the unique identifier and requests payment information from a user, and stores an association between the unique identifier and the payment information, and processes the item according to the payment information. |
| FILED | Friday, May 18, 2018 |
| APPL NO | 15/983984 |
| ART UNIT | 2667 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Postal Sorting; Sorting Individual Articles, or Bulk Material Fit to be Sorted Piece-meal, e.g by Picking B07C 3/14 (20130101) B07C 3/18 (20130101) Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/08 (20130101) G06Q 20/042 (20130101) Ticket-issuing Apparatus; Fare-registering Apparatus; Franking Apparatus G07B 17/00661 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223900 | Mendonca et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNITED STATES POSTAL SERVICE (Washington, District of Columbia) |
| ASSIGNEE(S) | UNITED STATES POSTAL SERVICE (Washington, District of Columbia) |
| INVENTOR(S) | Pat Mendonca (Damascus, Maryland); Jonathan C. Pruett (Arlington, Virginia) |
| ABSTRACT | The invention includes systems, methods, and software applications for centrally maintaining information and automatically distributing relevant portions of the information to remote users. In one embodiment, a central server stores the information, which is maintained on the central server. Periodically, or each time the server information is updated, the server identifies the portion of the information that is relevant to each user and downloads the relevant portion of information to each user, for example to a mobile device such as a Blackberry™. The invention may be used to maintain and timely distribute information related to emergency response procedures, sales or servicing schedules, and delivery schedules, among other things. |
| FILED | Tuesday, July 17, 2018 |
| APPL NO | 16/038087 |
| ART UNIT | 2445 — Computer Networks |
| CURRENT CPC | Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/107 (20130101) G06Q 10/1095 (20130101) G06Q 40/04 (20130101) Signalling or Calling Systems; Order Telegraphs; Alarm Systems G08B 27/006 (20130101) Original (OR) Class Transmission of Digital Information, e.g Telegraphic Communication H04L 51/00 (20130101) H04L 67/025 (20130101) H04L 67/34 (20130101) Wireless Communication Networks H04W 4/02 (20130101) H04W 4/90 (20180201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Aeronautics and Space Administration (NASA)
| US 10219748 | Terry et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NUtech Ventures (Lincoln, Nebraska) |
| ASSIGNEE(S) | NUtech Ventures (Lincoln, Nebraska) |
| INVENTOR(S) | Benjamin Terry (Lincoln, Nebraska); Weston Lewis (Williamsburg, Virginia); Wanchuan Xie (Lincoln, Nebraska); Pengbo Li (Lincoln, Nebraska); Alfred Tsubaki (Omaha, Nebraska) |
| ABSTRACT | A gastrointestinal (GI) sensor deployment device is disclosed. In implementations, the sensor deployment device includes an orally-administrable capsule with a tissue capture device removably coupled to the orally-administrable capsule. The tissue capture device includes a plurality of fasteners for connecting the tissue capture device to GI tissue within a body. A biometric sensor is coupled to the tissue capture device for continuous or periodic monitoring of the GI tract of the body at the GI tissue attachment location. A chamber within the orally-administrable capsule is configured to draw gastrointestinal tissue towards the plurality of fasteners when a fluid pressure of the chamber is increased. An actuator can be configured to cause an increase of the fluid pressure of the chamber. Control circuitry coupled to the actuator can be configured to trigger the actuator to cause the increase of the fluid pressure of the chamber at a selected time. |
| FILED | Wednesday, January 21, 2015 |
| APPL NO | 15/113521 |
| ART UNIT | 3791 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 1/041 (20130101) A61B 1/273 (20130101) A61B 5/073 (20130101) A61B 5/4233 (20130101) A61B 5/4238 (20130101) A61B 5/4255 (20130101) A61B 5/6861 (20130101) Original (OR) Class A61B 5/6873 (20130101) A61B 5/6882 (20130101) A61B 5/6884 (20130101) A61B 5/6885 (20130101) A61B 10/04 (20130101) A61B 10/0266 (20130101) A61B 10/0283 (20130101) A61B 2562/162 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10219870 | Mondry et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nabraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Jack Mondry (Edina, Minnesota); Shane Farritor (Lincoln, Nebraska); Eric Markvicka (Brush, Colorado); Thomas Frederick (Lincoln, Nebraska); Joe Bartels (Lincoln, Nebraska) |
| ABSTRACT | Disclosed herein are various medical device components, including components that can be incorporated into robotic and/or in vivo medical devices. Also disclosed are various medical devices for in vivo medical procedures. Included herein, for example, is a surgical robotic device having an elongate device body, a right robotic arm coupled to a right shoulder assembly, and a left robotic arm coupled to a left shoulder assembly. |
| FILED | Monday, November 21, 2016 |
| APPL NO | 15/357663 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/00234 (20130101) A61B 34/20 (20160201) A61B 34/30 (20160201) Original (OR) Class A61B 90/361 (20160201) A61B 2017/2906 (20130101) A61B 2034/302 (20160201) A61B 2034/2048 (20160201) A61B 2034/2051 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/0084 (20130101) B25J 9/0087 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220520 | Hawkes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| INVENTOR(S) | Elliot W. Hawkes (San Francisco, California) |
| ABSTRACT | Grasping devices and mechanisms are provided capable of grasping onto flat or curved surfaces repeatably and releasably using synthetic dry adhesives. Applications of these devices can be found in a large variety of robotic applications. |
| FILED | Wednesday, May 20, 2015 |
| APPL NO | 15/308472 |
| ART UNIT | 1785 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Manipulators; Chambers Provided With Manipulation Devices B25J 15/008 (20130101) Original (OR) Class Aeroplanes; Helicopters B64C 25/52 (20130101) B64C 39/028 (20130101) B64C 2201/12 (20130101) B64C 2201/18 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/24802 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224111 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | California Institute of Technology (Pasadena, California) |
| INVENTOR(S) | Yue Li (Pasadena, California); Jehoshua Bruck (La Cañada-Flintridge, California) |
| ABSTRACT | A data device includes a memory having a plurality of memory cells configured to store data values in accordance with a predetermined rank modulation scheme that is optional and a memory controller that receives a current error count from an error decoder of the data device for one or more data operations of the flash memory device and selects an operating mode for data scrubbing in accordance with the received error count and a program cycles count. |
| FILED | Wednesday, December 20, 2017 |
| APPL NO | 15/849423 |
| ART UNIT | 2825 — Semiconductors/Memory |
| CURRENT CPC | Static Stores G11C 16/10 (20130101) G11C 16/16 (20130101) G11C 16/0466 (20130101) G11C 16/3495 (20130101) Original (OR) Class G11C 29/44 (20130101) G11C 2029/0409 (20130101) G11C 2211/5641 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Agriculture (USDA)
| US 10219832 | Bagwell et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Actuated Medical, Inc. (Bellefonte, Pennsylvania) |
| ASSIGNEE(S) | Actuated Medical, Inc. (Bellefonte, Pennsylvania) |
| INVENTOR(S) | Roger B. Bagwell (Bellefonte, Pennsylvania); Ryan S. Clement (State College, Pennsylvania); Andrew J. Meehan (Warriors Mark, Pennsylvania); Casey A. Scruggs (Middleburg, Pennsylvania); Ryan M. Sheehan (Pittsburgh, Pennsylvania); Maureen L. Mulvihill (Bellefonte, Pennsylvania) |
| ABSTRACT | A device for penetrating tissue is provided that has a driving actuator with a body and motor shaft that is reciprocated. A coupler is attached to the motor shaft, and a key engages the driving actuator and coupler and limits rotational motion of the motor shaft and permits linear motion of the motor shaft. A penetrating member is carried by the coupler, and linear motion of the motor shaft is translated to the penetrating member to linearly reciprocate the penetrating member. |
| FILED | Friday, October 24, 2014 |
| APPL NO | 14/522681 |
| ART UNIT | 3791 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 10/025 (20130101) A61B 17/3401 (20130101) A61B 17/3415 (20130101) A61B 17/3476 (20130101) Original (OR) Class A61B 17/3496 (20130101) A61B 17/320068 (20130101) A61B 2017/00115 (20130101) A61B 2017/00123 (20130101) A61B 2090/064 (20160201) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/3287 (20130101) A61M 25/0084 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220071 | Call et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington State University (Pullman, Washington) |
| ASSIGNEE(S) | Washington State University (Pullman, Washington) |
| INVENTOR(S) | Douglas R. Call (Pullman, Washington); Lisa Orfe (Pullman, Washington) |
| ABSTRACT | Microcin MccPDI and bacteria harboring the mcpM gene which encodes MccPDI limit growth of and/or kill pathogenic bacteria such as pathogenic Escherichia coli (E. coli) and/or Shigella bacteria via proximity-dependent inhibition (PDI). |
| FILED | Wednesday, May 30, 2018 |
| APPL NO | 15/992874 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 37/46 (20130101) A01N 63/00 (20130101) A01N 63/02 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 35/74 (20130101) A61K 38/164 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220084 | Ficht et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Texas A and M University System (College Station, Texas) |
| ASSIGNEE(S) | THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas) |
| INVENTOR(S) | Thomas A. Ficht (College Station, Texas); Allison Ficht (College Station, Texas); Renee Tsolis (Davis, California); Leslie Garry Adams (College Station, Texas) |
| ABSTRACT | Methods and compositions for the treatment of Brucella induced diseases and disorders are disclosed herein. In preferred embodiments, the invention relates to vaccines. In additional embodiments, the invention relates to formulations capable of releasing said vaccines at a controlled rate of release in vivo. In further embodiments, the invention relates to modified strains of the bacteria Brucella melitensis and Brucella abortus. In still further embodiments, the invention relates to compositions that do not induce clinical symptoms or splenomegaly in a subject receiving said compositions. |
| FILED | Tuesday, December 15, 2015 |
| APPL NO | 14/969882 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/098 (20130101) Original (OR) Class A61K 2039/54 (20130101) A61K 2039/522 (20130101) A61K 2039/541 (20130101) A61K 2039/622 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56911 (20130101) G01N 2333/23 (20130101) G01N 2469/20 (20130101) G01N 2800/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Veterans Affairs (DVA)
| US 10219694 | Samadani et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York); The United States of America as Represented by the Department of Veterans Affairs (Washinton, District of Columbia) |
| ASSIGNEE(S) | New York University (New York, New York); The United States of America as Represented by the Department of Veterans Affairs (Washington, District of Columbia) |
| INVENTOR(S) | Uzma Samadani (New York, New York); Shani Offen (New York, New York); Marisa Carrasco-Queijeiro (New York, New York); David Heeger (New York, New York) |
| ABSTRACT | The invention provides methods and kits for detecting, screening, quantifying or localizing the etiology for reduced or impaired cranial nerve function or conduction or associated cranial nucleus or supranuclear input, useful for detecting, diagnosing or screening for increased intracranial pressure, or useful for detecting, diagnosing, monitoring progression of or screening for a disease or condition featuring increased intracranial pressure by tracking eye movement of the subject. The methods may be performed by a) analyzing eye movement of the subject; b) comparing eye movement of the subject to eye movement of a control or the subject's own baseline eye movement; and c) identifying the subject as having eye movement significantly different from the control or the subject's own baseline eye movement. |
| FILED | Friday, February 10, 2017 |
| APPL NO | 15/429413 |
| ART UNIT | 3791 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 3/024 (20130101) A61B 3/0025 (20130101) A61B 3/113 (20130101) Original (OR) Class A61B 5/031 (20130101) A61B 5/4064 (20130101) A61B 5/4076 (20130101) A61B 5/7246 (20130101) A61B 5/7264 (20130101) A61B 5/7275 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220009 | Nicolls et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California); THE UNITED STATES OF AMERICA AS REPRESENTED BY THE DEPARTMENT OF VETERANS AFFAIRS (Washington, District of Columbia); THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California); The Johns Hopkins University (Baltimore, Maryland); The United States of America as Represented by the Department of Veterans Affairs (Washington, District of Columbia) |
| INVENTOR(S) | Mark R. Nicolls (Palo Alto, California); Jayakumar Rajadas (Cupertino, California); Geoffrey C. Gurtner (Woodside, California); Xinguo Jiang (Palo Alto, California); Gundeep Dhillon (Stanford, California); Gregg L. Semenza (Reisterstown, Maryland) |
| ABSTRACT | Formulations and methods are provided for improving the function, i.e. clinical outcome, of solid organ transplants. Lung transplantation is of particular interest. In the methods of the invention, a nanoparticle formulation comprising an effective dose of an iron chelator active agent in nanoparticle form, including without limitation, deferoxamine (DFO), deferasirox (DFX), and deferiprone (DFP), etc. suspended in a carrier compatible with the tissue of interest, is topically applied to the surface of tissues at the site of anastomosis. The nanoparticles are comprised of the active agent and a pharmaceutically acceptable stabilizer. |
| FILED | Friday, August 30, 2013 |
| APPL NO | 14/424994 |
| ART UNIT | 1619 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5123 (20130101) A61K 9/5138 (20130101) A61K 9/5146 (20130101) A61K 9/5161 (20130101) A61K 9/5169 (20130101) A61K 31/164 (20130101) Original (OR) Class A61K 31/436 (20130101) A61K 31/4196 (20130101) A61K 31/4412 (20130101) A61K 45/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10220205 | Bhadra et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Case Western Reserve University (Cleveland, Ohio) |
| ASSIGNEE(S) | CASE WESTERN RESERVE UNIVERSITY (Cleveland, Ohio) |
| INVENTOR(S) | Narendra Bhadra (Chesterland, Ohio); Kenneth J. Gustafson (Shaker Heights, Ohio); Jaime L. McCoin (Pittsburgh, Pennsylvania) |
| ABSTRACT | One aspect of the present disclosure relates to a system for electrical stimulation. A waveform generator can be configured to generate an electrical waveform. An electrode can be electrically coupled to the waveform generator and configured to deliver the electrical waveform to a nerve to reduce at least one reflex that affects a bodily function. |
| FILED | Thursday, December 15, 2016 |
| APPL NO | 15/380779 |
| ART UNIT | 3792 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/36007 (20130101) Original (OR) Class A61N 1/36014 (20130101) A61N 1/36017 (20130101) A61N 1/36057 (20130101) A61N 1/36171 (20130101) A61N 1/36178 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Security Agency (NSA)
| US 10223171 | Labasan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | Intel Corporation (Santa Clara, California) |
| INVENTOR(S) | Stephanie Labasan (Portland, Oregon); Federico Ardanaz (Hillsboro, Oregon); Jonathan M. Eastep (Portland, Oregon); Richard J. Greco (West Linn, Oregon) |
| ABSTRACT | Systems, apparatuses and methods may provide for obtaining, by a system level reallocator in a plurality of reallocators arranged in a hierarchical tree, resource budget information. Additionally, application performance information may be obtained by at least one of the plurality of reallocators. Moreover, a performance imbalance between a plurality of compute subtrees associate with the application performance information may be reduced by the at least one of the plurality of reallocators and based at least in part on the resource budget information and the application performance information. |
| FILED | Friday, March 25, 2016 |
| APPL NO | 15/081424 |
| ART UNIT | 2196 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 9/5083 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224392 | DiFonzo |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America as represented by the Director, National Security Agency (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America as represented by the Director, National Security Agency (Washington, District of Columbia) |
| INVENTOR(S) | Peter A. DiFonzo (New Windsor, Maryland) |
| ABSTRACT | A method of fabricating a semiconductor capacitor is disclosed. The method includes forming a first trench in a semiconductor substrate, forming a dielectric lining layer in the first trench, and depositing a first capacitor conductor plate layer on the dielectric lining layer. The method also includes forming a second trench such that the dielectric lining layer is exposed. The method also includes forming a third trench such that the dielectric lining layer is exposed within the third trench. The method also includes depositing a second capacitor conductor plate layer in the second trench and depositing a third capacitor conductor plate layer in the third trench. The method also includes forming a first electrical contact between the first capacitor conductor plate layer and the second capacitor conductor plate layer and forming a second electrical contact between the first capacitor conductor plate layer and the third capacitor conductor plate layer. |
| FILED | Monday, July 11, 2016 |
| APPL NO | 15/206529 |
| ART UNIT | 2899 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 28/60 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
U.S. State Government
| US 10219918 | LaBelle et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS, A BODY CORPORATE OF THE STATE OF ARIZONA, ACTING FOR AND ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Jeffrey LaBelle (Tempe, Arizona); Sarah McBryan (Phoenix, Arizona) |
| ABSTRACT | A prosthetic device including an internal frame assembled from multiple longitudinal members and multiple transverse members, wherein each member is substantially planar and defines peripheral slots, and wherein the longitudinal members and transverse members are arranged to mate with one another to join the longitudinal members with the transverse members. In certain embodiments, a first group of longitudinal members is radially arranged relative to a central axis extending through the transverse members, and a second group of longitudinal members is tangentially arranged relative to the central axis, preferably with lateral edges of the second group of longitudinal members extending between two different longitudinal members of the first group of longitudinal members to provide enhanced torsional rigidity. An outer shaping member, which may be tubular in shape, may be arranged to cover at least a portion of the internal frame. |
| FILED | Tuesday, September 06, 2016 |
| APPL NO | 15/257462 |
| ART UNIT | 3774 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/60 (20130101) A61F 2/5046 (20130101) Original (OR) Class A61F 2002/607 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223567 | Kozicki |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Michael N. Kozicki (Phoenix, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS, A BODY CORPORATE OF THE STATE OF ARIZONA ACTING FOR AND ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Michael N. Kozicki (Phoenix, Arizona) |
| ABSTRACT | The disclosure features dendritic tags, and methods and systems for fabricating and using such tags. The methods can include obtaining at least one image of a dendritic tag attached to an article, analyzing the at least one image to identify a set of features associated with the dendritic tag, and comparing the set of features to stored information to identify the article. |
| FILED | Thursday, September 17, 2015 |
| APPL NO | 14/857696 |
| ART UNIT | 2666 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 21/06 (20130101) G02B 21/365 (20130101) G02B 27/286 (20130101) Electric Digital Data Processing G06F 17/3028 (20130101) G06F 17/30879 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 7/1099 (20130101) Original (OR) Class G06K 9/46 (20130101) G06K 9/00147 (20130101) G06K 9/00577 (20130101) G06K 9/2027 (20130101) G06K 9/4671 (20130101) G06K 9/6202 (20130101) G06K 19/086 (20130101) G06K 19/06046 (20130101) G06K 19/07749 (20130101) Image Data Processing or Generation, in General G06T 7/0012 (20130101) G06T 7/12 (20170101) G06T 2207/10056 (20130101) G06T 2207/30024 (20130101) Ciphering or Deciphering Apparatus for Cryptographic or Other Purposes Involving the Need for Secrecy G09C 5/00 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/3278 (20130101) H04L 2209/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Commerce (DOC)
| US 10220103 | Zabow et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Depart. of Health and Human Services (Washington, District of Columbia); THE UNITED STATES OF AMERICA, REPRESENTED BY THE SECRETARY OF COMMERCE (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary, Department of Health and Human Services (Washington, District of Columbia); The United States of America, as represented by the Secretary of Commerce (Washington, District of Columbia) |
| INVENTOR(S) | Gary Zabow (Boulder, Colorado); Stephen Dodd (Rockville, Maryland); Alan Koretsky (Bethesda, Maryland); John Moreland (Louisville, Colorado) |
| ABSTRACT | The present invention relates to a magnetic resonance structure with a cavity or a reserved space that provides contrast and the additional ability to frequency-shift the spectral signature of the NMR-susceptible nuclei such as water protons by a discrete and controllable characteristic frequency shift that is unique to each MRS design. The invention also relates to nearly uniform solid magnetic resonance T2* contrast agents that have a significantly higher magnetic moment compared to similarly-sized existing MRI contrast agents. |
| FILED | Monday, June 15, 2015 |
| APPL NO | 14/739813 |
| ART UNIT | 1618 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/055 (20130101) A61B 5/0515 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 49/18 (20130101) A61K 49/1818 (20130101) Original (OR) Class Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) B82Y 30/00 (20130101) Measuring Electric Variables; Measuring Magnetic Variables G01R 33/281 (20130101) G01R 33/563 (20130101) G01R 33/5601 (20130101) G01R 33/5635 (20130101) G01R 33/56325 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/2982 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Transportation (USDOT)
| US 10221363 | Schabron et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The University of Wyoming Research Corporation (Laramie, Wyoming) |
| ASSIGNEE(S) | The University of Wyoming Research Corporation (Laramie, Wyoming) |
| INVENTOR(S) | John F. Schabron (Laramie, Wyoming); Ryan B. Boysen (Laramie, Wyoming); Eric W. Kalberer (Laramie, Wyoming); Joseph F. Rovani, Jr. (Laramie, Wyoming) |
| ABSTRACT | The inventive technology may involve, in particular embodiments, novel use of a non-porous, high surface energy stationary phase to adsorb, in reversible fashion, the most polar component of a resins fraction of an input hydrocarbon when a mobile phase is passed over the stationary phase. Such reversible adsorption prevents irreversibly adsorption of such components on active stationary phase(s) downflow of the non-porous, high surface energy stationary phase, thereby conserving stationary phase costs and increasing resolution of resins elutions, and accuracy of hydrocarbon component results. Aspects of the inventive technology may also involve a novel combination of a solubility based asphaltene component fractionating and analysis method and an adsorption chromatography method for separating and/or analyzing saturate, aromatics and resins components of an input hydrocarbon. |
| FILED | Friday, May 27, 2016 |
| APPL NO | 15/167766 |
| ART UNIT | 1772 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Separation B01D 15/00 (20130101) B01D 15/265 (20130101) Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 20/281 (20130101) B01J 20/283 (20130101) B01J 20/284 (20130101) B01J 20/286 (20130101) B01J 20/287 (20130101) Cracking Hydrocarbon Oils; Production of Liquid Hydrocarbon Mixtures, e.g by Destructive Hydrogenation, Oligomerisation, Polymerisation; Recovery of Hydrocarbon Oils From Oil-shale, Oil-sand, or Gases; Refining Mixtures Mainly Consisting of Hydrocarbons; Reforming of Naphtha; Mineral Waxes C10G 25/003 (20130101) Original (OR) Class C10G 25/12 (20130101) C10G 53/08 (20130101) C10G 2400/30 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 30/14 (20130101) G01N 30/461 (20130101) G01N 30/468 (20130101) G01N 33/2823 (20130101) G01N 33/2835 (20130101) G01N 2030/027 (20130101) G01N 2030/085 (20130101) G01N 2030/143 (20130101) G01N 2030/8854 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Small Business Administration (SBA)
| US 10224456 | Gaska et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sensor Electronic Technology, Inc. (Columbia, South Carolina) |
| ASSIGNEE(S) | Sensor Electronic Technology, Inc. (Columbia, South Carolina) |
| INVENTOR(S) | Remigijus Gaska (Columbia, South Carolina); Maxim S. Shatalov (Columbia, South Carolina); Michael Shur (Latham, New York); Alexander Dobrinsky (Silver Spring, Maryland) |
| ABSTRACT | A method of fabricating a light emitting diode, which includes an n-type contact layer and a light generating structure adjacent to the n-type contact layer, is provided. The light generating structure includes a set of quantum wells. The contact layer and light generating structure can be configured so that a difference between an energy of the n-type contact layer and an electron ground state energy of a quantum well is greater than an energy of a polar optical phonon in a material of the light generating structure. Additionally, the light generating structure can be configured so that its width is comparable to a mean free path for emission of a polar optical phonon by an electron injected into the light generating structure. |
| FILED | Monday, October 30, 2017 |
| APPL NO | 15/797282 |
| ART UNIT | 2822 — Semiconductors/Memory |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 33/04 (20130101) H01L 33/06 (20130101) Original (OR) Class H01L 33/10 (20130101) H01L 33/22 (20130101) H01L 33/0025 (20130101) H01L 33/32 (20130101) H01L 33/38 (20130101) H01L 33/46 (20130101) H01L 33/0075 (20130101) H01L 33/145 (20130101) H01L 33/385 (20130101) H01L 33/405 (20130101) H01L 2933/0058 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
U.S. Agency for International Development (USAID)
| US 10220087 | Parks et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International AIDS Vaccine Initiative (New York, New York) |
| ASSIGNEE(S) | INTERNATIONAL AIDS VACCINE INITIATIVE (New York, New York) |
| INVENTOR(S) | Christopher L. Parks (New York, New York); Maoli Yuan (New York, New York); Xinsheng Zhang (New York, New York); Aaron Wilson (New York, New York); Angela Grazia Lombardo (New York, New York); Eddy Sayeed (New York, New York); Josephine Helena Cox (New York, New York); Takashi Hironaka (Ibaraki, Japan); Makoto Inoue (Ibaraki, Japan); Hiroto Hara (Ibaraki, Japan) |
| ABSTRACT | The present invention relates to a vector(s) containing and expressing an optimized HIV EnvF gene, methods for making the same and cell substrates qualified for vaccine production which may comprise vector(s) containing optimized HIV genes. |
| FILED | Thursday, April 27, 2017 |
| APPL NO | 15/498556 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/12 (20130101) A61K 39/21 (20130101) Original (OR) Class A61K 2039/53 (20130101) A61K 2039/57 (20130101) A61K 2039/70 (20130101) A61K 2039/543 (20130101) A61K 2039/545 (20130101) A61K 2039/575 (20130101) A61K 2039/5256 (20130101) A61K 2039/55511 (20130101) A61K 2039/55555 (20130101) Peptides C07K 14/005 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 15/86 (20130101) C12N 2740/16034 (20130101) C12N 2740/16134 (20130101) C12N 2740/16234 (20130101) C12N 2740/16271 (20130101) C12N 2740/16334 (20130101) C12N 2760/18443 (20130101) C12N 2760/18843 (20130101) C12N 2760/18871 (20130101) C12N 2760/20243 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Government Rights Acknowledged
| US 10221938 | Flaxman |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | QINETIQ LIMITED (Farnborough, United Kingdom) |
| ASSIGNEE(S) | QINETIQ LIMITED (Hampshire, United Kingdom) |
| INVENTOR(S) | Robert John Bonner Flaxman (Guildford, United Kingdom) |
| ABSTRACT | Some embodiments are directed to an apparatus for managing fluid flow in a vehicle, that includes an epicyclic gear set having first, and second inputs configured to receive rotational drive input from a torque output feature of a powertrain and a rotary actuator respectively. A pump driver is provided for driving a fluid pump, the pump driver being configured to receive rotational drive input from an output of the epicyclic gear set. A controller is configured to determine information corresponding to the rotational speed of the torque output feature using information generated by a rotational speed sensor and based on this control the rotary actuator, such that the pump driver is caused to rotate at substantially a pre-specified speed. |
| FILED | Friday, May 22, 2015 |
| APPL NO | 15/310744 |
| ART UNIT | 3659 — Material and Article Handling |
| CURRENT CPC | Gearing F16H 48/10 (20130101) F16H 57/0412 (20130101) F16H 57/0435 (20130101) Original (OR) Class F16H 57/0439 (20130101) F16H 57/0483 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10221993 | Bullard et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | Raytheon Company (Waltham, Massachusetts) |
| INVENTOR(S) | Andrew L. Bullard (Manhattan Beach, California); Shane E. Wilson (Torrance, California) |
| ABSTRACT | A bi-directional spring member is mounted to a support platform, the bi-directional spring member being coupled to a payload. The bi-directional spring member includes a non-linear spring component having a rigid member enclosing at least a portion of a compliant planar member and a linear spring component. The compliant planar member flexes in a direction opposite a direction of low amplitude vibrational forces acting on the compliant planar member to reduce vibrational forces acting on the support platform and the linear spring member flexes to reduce high amplitude vibrational forces acting on the support platform. |
| FILED | Saturday, August 04, 2018 |
| APPL NO | 16/055079 |
| ART UNIT | 3631 — Static Structures, Supports and Furniture |
| CURRENT CPC | Springs; Shock-absorbers; Means for Damping Vibration F16F 1/18 (20130101) F16F 1/025 (20130101) F16F 3/02 (20130101) F16F 15/02 (20130101) F16F 15/046 (20130101) F16F 2228/066 (20130101) Frames, Casings or Beds of Engines, Machines or Apparatus, Not Specific to Engines, Machines or Apparatus Provided for Elsewhere; Stands; Supports F16M 11/24 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10222555 | Numata et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| ASSIGNEE(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| INVENTOR(S) | Hidetoshi Numata (Kawasaki, Japan); Masao Tokunari (Kawasaki, Japan) |
| ABSTRACT | An optoelectronic coupling system and methods of forming the same include an optoelectronic chip mounted on a substrate. The optoelectronic chip includes one or more optoelectronic components. A lower lens array is positioned over the optoelectronic chip and has a lower surface, with a first cut-away portion to accommodate the optoelectronic chip, and an upper surface that has one or more lower lenses positioned over respective optoelectronic components. An upper lens array is positioned over the lower lens array and has comprising one or more upper lenses positioned over respective lower lenses. |
| FILED | Tuesday, January 10, 2017 |
| APPL NO | 15/402735 |
| ART UNIT | 2883 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/32 (20130101) Original (OR) Class G02B 6/425 (20130101) G02B 6/428 (20130101) G02B 6/4214 (20130101) G02B 6/4244 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10223331 | Saquib et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Goodrich Corporation (Charlotte, North Carolina) |
| ASSIGNEE(S) | Goodrich Corporation (Charlotte, North Carolina) |
| INVENTOR(S) | Suhail Shabbir Saquib (Shrewsbury, Massachusetts); Matthew D. Egan (Westford, Massachusetts) |
| ABSTRACT | A method for modeling warp for registration of images includes receiving input warp data and performing a fitting process on the input warp data to produce at least one of reduced noise warp data or reduced noise warp uncertainty. The warp for the at least one of reduced noise warp data or reduced noise warp uncertainty is modeled with components including an offset that varies in time and a non-linear distortion that does not vary with time. The method also includes outputting at the least one of reduced noise warp data or reduced noise warp uncertainty. |
| FILED | Friday, April 08, 2016 |
| APPL NO | 15/094123 |
| ART UNIT | 2194 — Interprocess Communication and Software Development |
| CURRENT CPC | Electric Digital Data Processing G06F 17/11 (20130101) Original (OR) Class G06F 17/16 (20130101) Image Data Processing or Generation, in General G06T 7/32 (20170101) G06T 2207/10036 (20130101) G06T 2207/20182 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10224979 | Hunter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | William Hunter (Atlanta, Georgia); Bradford Baker (Atlanta, Georgia); Gregory Kiesel (Atlanta, Georgia); Efstrateos James Strates, II (Atlanta, Georgia); Matthew Habib (Atlanta, Georgia); Ryan S. Westafer (Fayetteville, Georgia) |
| ABSTRACT | Systems, methods, and devices relating to reconfigurable antennas are disclosed. |
| FILED | Tuesday, June 09, 2015 |
| APPL NO | 14/735009 |
| ART UNIT | 2845 — Electrical Circuits and Systems |
| CURRENT CPC | Antennas, i.e Radio Aerials H01Q 3/247 (20130101) H01Q 13/04 (20130101) H01Q 15/02 (20130101) Transmission H04B 3/542 (20130101) Original (OR) Class Transmission of Digital Information, e.g Telegraphic Communication H04L 27/0002 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
How To Use This Page
THE FEDINVENT PATENT DETAILS PAGE
Each week, FedInvent analyzes newly granted patents and published patent applications whose origins lead back to funding by the US Federal Government. The FedInvent Patent Details page is a companion to the weekly FedInvents Patents Report.
This week's information is published in the FedInvent Patents report for Tuesday, March 05, 2019.
The FedInvent Weekly Patent Details Page contains a subset of patent information to provide a deeper dive into the week’s taxpayer-funded patents to help the reader better understand where a patent fits in the federal innovation ecosphere.
HOW IS THE INFORMATION ORGANIZED?
Patents are organized by the funding agency. Within each group, the patents are organized in numeric order. A patent funded by more than one agency will appear in the section of each of the agencies that funded the research and development that resulted in the invention. This approach gives the reader a complete view of the department or agency activity for the week.
WHAT INFORMATION WILL I FIND?
THE PANEL
There is a panel for each patent that contains the patent number and the title of the patent. When you click the panel, it opens to reveal the following information:
FUNDED BY
The agencies that funded the grants, contracts, or other research agreements that resulted in the patent. FedInvent includes as much information on the source of the funding as possible. The information is presented in a hierarchy going from the Federal Department down to the agencies, subagencies, and offices that funded the work. Here are two examples:
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Army Research Office (ARO)
We do our best to provide detailed information about the funding. In some cases, the patent only reports limited information on the origins of the funding. FedInvents presents what it can confirm. We add the patents without the information required by the Bayh-Dole Act to our list of patents worthy of further investigation.
APPLICANT(S) and ASSIGNEES
FedInvent includes both the Applicants and the Assignees because having both provides more information about where the inventive work was done and by what organizations. Many organizations — universities, corporations, and federal agencies — standardize the Assignee/Owner information by the time a patent is granted. In the case of federal patents, many of the patents use the agency headquarters information for patent assignment.
Showing just the headquarters address would make Washington, DC the epicenter of all taxpayer-funded research and development. Providing both the applicant information and the assignee information provides a more accurate picture of where important taxpayer funded innovation is happening in America. Here are two examples from two different patents:
APPLICANT: U.S. Army Research Laboratory, Adelphi, MD
ASSIGNEE: The United States of America as represented by the Secretary of the Army Washington, DC
APPLICANT: Optech Ventures, LLC (Torrance, California)
ASSIGNEE(S): The Regents of the University of California (Oakland, California); Optech Ventures, LLC (Torrance, California)
INVENTOR(S)
The inventors appear in the same order as they appear on the patent. FedInvents presents the names in first name/last name order because they are easier to read than the last name/first name order of the names on the USPTO patent documents.
ABSTRACT
The abstract as it appears on the patent.
FILED
The date of the patent application including the day of the week.
APPL NO
This is the patent application serial number. If you’d like to learn more about how application serial numbers work you can go to the Lists Page.
ART UNIT
Patent data includes the Art Unit where a patent was examined. (The Art Unit isn’t available for published patent applications.) The Art Unit provides insight into what group of patent examiners prosecuted the patent application and the subject matter that the examiners work on. For example:
3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices
You can learn more about ART UNITS on the FedInvent Patents Weekly panel called About Tech Center or you can find information on the FedInvent Lists Page.
CURRENT CPC
Current CPC provides a list of the Cooperative Patent Classification symbols assigned to the patent. These are the CPC symbols assigned at the time the patent was granted.
The FedInvent Project is a patent classification maximalist endeavor or put another way, we believe that more you understand about patent classification the more you'll learn about the nature of the invention and the types of work that the federal government is funding.
The symbol presented in BOLD is the symbol identified as the "first" classification which is the most relevant classification on the patent. The date that follows the symbol is the date of the most recent revision to the art classed there.
- A61B 1/149 (20130101)
- A61B 1/71 (20130101)
- A61B 1/105 (20130101)
The CPC symbols match the classifications found on the PDF version of the patent. Over time, the classifications on the full-text version of the patent change to reflect how USPTO organizes patent art to support its examiners. The two sets of CPCs don’t always match.
VIEW PATENT
As of June 2021, we include two ways to view a patent at USPTO. FedInvent provides a link to the Full-Text Version of the patent and a link to the PDF version of the patent.
HOW DO I FIND A SPECIFIC PATENT ON A PAGE?
You can use the Command F or Control F to find a specific patent you are interested in.
HOW DO I GET HERE?
You navigate to the details of a patent by clicking the information icon that follows a patent on the FedInvent Patents Weekly Report.
You can also reach this page using the weekly page link that looks like this:
https://wayfinder.digital/fedinvent/patents-2022/fedinvent-patents-20190305.html
Just update the date portion of the URL. Tuesdays for patents. Thursdays for pre-grant publication of patent applications.
Download a copy of the How To Use This Page