FedInvent™ Patents
Patent Details for Tuesday, December 24, 2019
This page was updated on Monday, March 27, 2023 at 05:58 AM GMT
Department of Defense (DOD)
| US 10512425 | Pascoguin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America as represented by the Secretary of the Navy (San Diego, California) |
| ASSIGNEE(S) | United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Bienvenido Melvin L. Pascoguin (La Mesa, California); Ryan P. Lu (San Diego, California); Ayax D. Ramirez (Chula Vista, California) |
| ABSTRACT | An apparatus, method and system for dermatologically noninvasive testing for blood sugar concentration using an interferometry optical design. The present apparatus, method and system are used to measure the optical properties of blood, without puncturing the skin or drawing blood samples. They incorporate the use of an electromagnetic light source and two optical polarizers. A dermatological sample, e.g., the earlobe, webbing between fingers, is illuminated with polarized electromagnetic light. When the linearly polarized light passes through this dermatological sample, the blood in the dermatological sample acts as an optical rotator due to the optical interaction with the blood sample. The presence of molecular chirality in the blood sample induces optical activity. After the skin is illuminated, a second polarizer finds the orientation of the polarization by maximizing the intensity on the photo detector. As a result, the blood sugar concentration may be determined. |
| FILED | Thursday, August 04, 2016 |
| APPL NO | 15/228187 |
| ART UNIT | 3783 — Body Treatment, Kinestherapy, and Exercising |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/1455 (20130101) A61B 5/4839 (20130101) A61B 5/6816 (20130101) A61B 5/6826 (20130101) A61B 5/7225 (20130101) A61B 5/14532 (20130101) Original (OR) Class Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/14244 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512606 | Reshetnyak et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rhode Island Council on Postsecondary Education (Warwick, Rhode Island); Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yana K. Reshetnyak (South Kingstown, Rhode Island); Oleg A. Andreev (South Kingstown, Rhode Island); Donald M. Engelman (New Haven, Connecticut) |
| ABSTRACT | The present application relates to compositions comprising and methods of using a liposome comprising a pHLIP polypeptide, wherein a lipid bilayer of the liposome is substantially free of the pHLIP polypeptide. |
| FILED | Wednesday, August 30, 2017 |
| APPL NO | 15/691130 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/127 (20130101) A61K 9/1271 (20130101) Original (OR) Class A61K 31/20 (20130101) A61K 31/337 (20130101) A61K 31/704 (20130101) A61K 31/711 (20130101) A61K 31/713 (20130101) A61K 31/7105 (20130101) A61K 47/6911 (20170801) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512630 | Pietras et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents Of The University Of California (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Richard J. Pietras (Sherman Oaks, California); Michael E. Jung (Los Angeles, California); Diana C. Marquez-Garban (Los Angeles, California); Gang Deng (Los Angeles, California) |
| ABSTRACT | Provided herein, inter alia, are compositions and methods useful for treating hyperproliferative diseases, including cancer and non-malignant hyperproliferative diseases. |
| FILED | Thursday, September 29, 2016 |
| APPL NO | 15/764724 |
| ART UNIT | 1629 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/33 (20130101) A61K 31/343 (20130101) A61K 31/365 (20130101) Original (OR) Class A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Heterocyclic Compounds C07D 493/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512647 | O'Malley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BAYLOR COLLEGE OF MEDICINE (Houston, Texas) |
| ASSIGNEE(S) | BAYLOR COLLEGE OF MEDICINE (Houston, Texas) |
| INVENTOR(S) | Bert W. O'Malley (Houston, Texas); David Michael Lonard (Pearland, Texas); Jin Wang (Sugar Land, Texas); Jianming Xu (Bellaire, Texas); Jianwei Chen (Houston, Texas) |
| ABSTRACT | Small molecule regulators of steroid receptor coactivator (SRC) family proteins are provided, as well as methods for their use in treating or preventing SRC-related diseases. The SRC-related diseases can include cancer, metabolic disorders, human immunodeficiency virus, neurodegenerative disorders, and/or inflammatory diseases. Also provided are methods for regulating SRC family proteins in a cell. |
| FILED | Friday, March 22, 2019 |
| APPL NO | 16/361600 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/426 (20130101) A61K 31/506 (20130101) Original (OR) Class A61K 31/4184 (20130101) A61K 31/4402 (20130101) Heterocyclic Compounds C07D 401/12 (20130101) C07D 401/14 (20130101) C07D 403/12 (20130101) C07D 405/12 (20130101) C07D 409/12 (20130101) C07D 413/12 (20130101) C07D 417/12 (20130101) C07D 471/04 (20130101) C07D 487/04 (20130101) C07D 498/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512682 | Richardson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | TAKEDA VACCINES, INC. (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Takeda Vaccines, Inc. (Cambridge, Massachusetts) |
| INVENTOR(S) | Charles Richardson (Cambridge, Massachusetts); Thomas S. Vedvick (Cambridge, Massachusetts); Thomas R. Foubert (Cambridge, Massachusetts); William T. Tino (Cambridge, Massachusetts) |
| ABSTRACT | The present invention relates to antigenic and vaccine compositions comprising Norovirus antigens and adjuvants, in particular, mixtures of monovalent VLPs and mixtures of multivalent VLPs, and to a process for the production of both monovalent and multivalent VLPs, the VLPs comprising capsid proteins from one or more Norovirus genogroups. |
| FILED | Thursday, May 31, 2018 |
| APPL NO | 15/994887 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/12 (20130101) Original (OR) Class A61K 39/39 (20130101) A61K 39/125 (20130101) A61K 2039/54 (20130101) A61K 2039/70 (20130101) A61K 2039/543 (20130101) A61K 2039/5258 (20130101) A61K 2039/55572 (20130101) Peptides C07K 16/10 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 2770/16023 (20130101) C12N 2770/16034 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512696 | Sengupta et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts) |
| ASSIGNEE(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts) |
| INVENTOR(S) | Shiladitya Sengupta (Waltham, Massachusetts); Abhimanyu Paraskar (Belmont, Massachusetts); Shivani Soni (La Canada Flintridge, California); Sudipta Basu (Cambridge, Massachusetts); Poulomi Sengupta (Belmont, Massachusetts) |
| ABSTRACT | The invention is directed to biocompatible conjugated polymer nanoparticles including a copolymer backbone, a plurality of sidechains covalently linked to said backbone, and a plurality of platinum compounds dissociably linked to said backbone. The invention is also directed to dicarbonyl-lipid compounds wherein a platinum compound is dissociably linked to the dicarbonyl compound. The invention is also directed to methods of treating cancer or metastasis. The methods includes selecting a subject in need of treatment for cancer or metastasis and administering to the subject an effective amount of any of the nanoparticles, compounds, or compositions of the invention. |
| FILED | Wednesday, June 15, 2016 |
| APPL NO | 15/182967 |
| ART UNIT | 1611 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/282 (20130101) A61K 31/382 (20130101) A61K 33/24 (20130101) A61K 47/16 (20130101) A61K 47/24 (20130101) A61K 47/58 (20170801) A61K 47/60 (20170801) A61K 47/489 (20130101) Original (OR) Class A61K 47/543 (20170801) A61K 47/544 (20170801) A61K 47/6933 (20170801) Steroids C07J 41/0055 (20130101) Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 8/32 (20130101) C08F 22/06 (20130101) C08F 222/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512707 | Whalen, III et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF SOUTHERN CALIFORNIA (Los Angeles, California) |
| ASSIGNEE(S) | University of Southern California (Los Angeles, California) |
| INVENTOR(S) | John J. Whalen, III (Pasadena, California); Niki Bayat (Los Angeles, California); Yi Zhang (Cypress, California); Paulo Falabella (Newton, Massachusetts); Mark E. Thompson (Anaheim, California); Mark S. Humayun (Glendale, California) |
| ABSTRACT | The present disclosure describes, among other things, a thermo-responsive hydrogel comprising a PNIPAM copolymer having adhesive properties that are temperature dependent, as well as a device for administering the hydrogel, and methods for making and using the foregoing. |
| FILED | Tuesday, February 02, 2016 |
| APPL NO | 15/013632 |
| ART UNIT | 1764 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 2017/005 (20130101) Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 9/007 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 15/60 (20130101) A61L 15/60 (20130101) A61L 24/06 (20130101) A61L 24/06 (20130101) A61L 24/0015 (20130101) A61L 24/0031 (20130101) Original (OR) Class A61L 2430/16 (20130101) Compositions of Macromolecular Compounds C08L 33/26 (20130101) C08L 33/26 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513330 | Kirchen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sikorsky Aircraft Corporation (Stratford, Connecticut) |
| ASSIGNEE(S) | SIKORSKY AIRCRAFT CORPORATION (Stratford, Connecticut) |
| INVENTOR(S) | Adrial Kirchen (Stamford, Connecticut); James Orbon (New Haven, Connecticut) |
| ABSTRACT | A blade damper with a magnetic contaminants trap includes, a housing defining a cavity, a piston in operable communication with the housing dividing the cavity into at least a first chamber and a second chamber, a passageway in operable communication with the cavity configured to allow fluid within the cavity to move between the first chamber and the second chamber through the passageway, and at least one magnet in operable communication with fluid in at least one of the cavity and the passageway, such that magnetic contaminants are prevented from freely moving about within the fluid after having been attracted toward the at least one magnet by a magnetic field of the at least one magnet. |
| FILED | Monday, August 03, 2015 |
| APPL NO | 15/516442 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Magnetic or Electrostatic Separation of Solid Materials From Solid Materials or Fluids; Separation by High-voltage Electric Fields B03C 1/30 (20130101) Aeroplanes; Helicopters B64C 27/51 (20130101) Original (OR) Class B64C 27/635 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513462 | Feigelson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Boris N. Feigelson (Springfield, Virginia); James A. Wollmershauser (Alexandria, Virginia); Kedar Manandhar (Alexandria, Virginia); Francis J. Kub (Arnold, Maryland) |
| ABSTRACT | A method for making transparent nanocomposite ceramics and other solid bulk materials from nanoparticle powders and transparent nanocomposite ceramics and other solid bulk materials formed using that method. A nanoparticle powder is placed into a reaction chamber and is treated to produce a clean surface powder. The clean surface powder is coated with a second material by means of p-ALD to produce core/shell or core multi shell nanoparticles having a coating or coatings of a other material surrounding the nanoparticle. The core/shell nanoparticles are cleaned and formed into green compact which is sintered to produce a transparent nanocomposite ceramic or other solid bulk material consisting of nanoparticles or core/shell nanoparticles uniformly embedded in a matrix of a different material, particularly in a matrix of a different ceramic material, formed by outer shell of initial core/shell. All steps are performed without exposing the material to the ambient. |
| FILED | Friday, September 09, 2016 |
| APPL NO | 15/260487 |
| ART UNIT | 1712 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 35/115 (20130101) C04B 35/117 (20130101) C04B 35/443 (20130101) Original (OR) Class C04B 35/645 (20130101) C04B 35/62813 (20130101) C04B 35/62884 (20130101) C04B 2235/80 (20130101) C04B 2235/656 (20130101) C04B 2235/3217 (20130101) C04B 2235/3222 (20130101) C04B 2235/6567 (20130101) C04B 2235/9653 (20130101) Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/403 (20130101) C23C 16/4417 (20130101) C23C 16/45525 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513535 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | Xiaojin He (New York City, New York); Ruojie Sha (Basking Ridge, New Jersey); Yongli Mi (Kowloon, China Hong Kong); Paul Chaikin (New York, New York); Nadrian C. Seeman (New York, New York) |
| ABSTRACT | The present invention provides a method for self-replication of multimers of nucleic acid origami tiles by exponentially amplifying the multimer from initial seeds of monomeric units of nucleic acid origami tiles and also provides for the selective exponential amplification of a designated multimer, such as with specific properties or characteristics, over one or more competing multimers in the presence of a mixture of monomers for each of the possible multimers. The selection of the designated multimer based on an environmental change allows the designated multimer to outgrow all competing multimers. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923361 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 21/04 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/11 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6816 (20130101) C12Q 1/6816 (20130101) C12Q 2565/113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513546 | Watters et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| ASSIGNEE(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| INVENTOR(S) | Alexander L. Watters (North Andover, Massachusetts); Donald E. Ingber (Boston, Massachusetts); Mark J. Cartwright (West Newton, Massachusetts); Michael Super (Lexington, Massachusetts); Martin Rottman (St. Cloud, France); Evangelia Murray (Worcester, Massachusetts); Brendon Dusel (West Roxbury, Massachusetts) |
| ABSTRACT | Described herein are engineered microbe-targeting molecules, microbe-targeting articles, kits comprising the same, and uses thereof. Such microbe-targeting molecules, microbe-targeting articles, or the kits comprising the same can bind or capture of a microbe or microbial matter thereof, and can thus be used in various applications, such as diagnosis or treatment of an infection caused by microbes in a subject or any environmental surface. |
| FILED | Thursday, December 18, 2014 |
| APPL NO | 15/105298 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 47/42 (20130101) Peptides C07K 14/4726 (20130101) C07K 14/4737 (20130101) Original (OR) Class C07K 2319/30 (20130101) C07K 2319/33 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/569 (20130101) G01N 33/6854 (20130101) G01N 33/56911 (20130101) G01N 33/56916 (20130101) G01N 33/56938 (20130101) G01N 33/56944 (20130101) G01N 2333/4737 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513702 | Kennedy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California) |
| INVENTOR(S) | Andrew Bodnar Kennedy (Sunnyvale, California); Christina D. Smolke (Menlo Park, California) |
| ABSTRACT | A ligand-responsive hammerhead ribozyme is provided. In some embodiments, the ribozyme comprises: i. a first loop that has been replaced by an RNA aptamer that binds to a ligand; and ii. a second loop comprising a modified sequence, wherein the aptamer and the second loop interact in a ligand-dependent manner and autocatalytic cleavage of the ribozyme is ligand-responsive. |
| FILED | Friday, June 17, 2016 |
| APPL NO | 15/737687 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/63 (20130101) C12N 15/111 (20130101) C12N 15/113 (20130101) Original (OR) Class C12N 15/115 (20130101) C12N 2310/16 (20130101) C12N 2310/121 (20130101) C12N 2310/531 (20130101) C12N 2310/3519 (20130101) C12N 2330/31 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513733 | Georgiou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| INVENTOR(S) | George Georgiou (Austin, Texas); Erik L. Johnson (Austin, Texas) |
| ABSTRACT | Methods for determining the VH:VL antibody repertoire from cells, such as antigen-specific B cells, in a high throughput manner. In some aspects, methods are provided for the capture of mRNA transcripts from single B cells that secreted antigen-specific antibodies followed by sequencing of the corresponding cDNAs encoding antibody VH and VL sequences. Libraries of antibodies produced by such methods are also provided. |
| FILED | Wednesday, March 23, 2016 |
| APPL NO | 15/078507 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6804 (20130101) C12Q 1/6806 (20130101) C12Q 1/6806 (20130101) C12Q 1/6869 (20130101) C12Q 1/6874 (20130101) Original (OR) Class C12Q 2521/107 (20130101) C12Q 2563/159 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513802 | Omenetto et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Tufts University (Medford, Massachusetts) |
| ASSIGNEE(S) | Tufts University (Medford, Massachusetts) |
| INVENTOR(S) | Fiorenzo G. Omenetto (Lexington, Massachusetts); David L. Kaplan (Concord, Massachusetts); Benedetto Marelli (Lexington, Massachusetts); Alexander Nicholas Mitropoulos (Winchester, Massachusetts) |
| ABSTRACT | Disclosed herein are nanofibrillar materials and aerogel-like materials comprised of nanofibrils, and methods for making such materials. |
| FILED | Friday, November 07, 2014 |
| APPL NO | 15/034983 |
| ART UNIT | 1786 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 27/56 (20130101) A61L 27/227 (20130101) A61L 27/3604 (20130101) A61L 2400/12 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Peptides C07K 14/78 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 9/28 (20130101) C08J 2205/022 (20130101) C08J 2207/10 (20130101) C08J 2389/02 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/26 (20130101) C12Q 1/28 (20130101) Chemical Features in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons; Apparatus Specially Adapted for the Manufacture of Carbon Filaments D01F 4/00 (20130101) D01F 4/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513938 | Witlicki et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Russell B. Witlicki (Wethersfield, Connecticut); Todd A. Davis (Tolland, Connecticut); Francis Parnin (Suffield, Connecticut) |
| ABSTRACT | Aspects of the disclosure are directed to a system associated with an engine having a central longitudinal axis, including a first shaft axially extending along the central longitudinal axis, a second shaft coaxial with the first shaft, a first air seal that seals between the first shaft and the second shaft at a first axial location, a second air seal that seals between the first shaft and the second shaft at a second axial location, a first oil seal that provides intershaft sealing between the first shaft and the second shaft at a third axial location, a second oil seal that provides intershaft sealing between the first shaft and the second shaft at a fourth axial location axially adjacent to the third axial location, and a high pressure compressor that provides pressurized air to a first radially exterior side of the first air seal and to a second radially exterior side the second air seal. |
| FILED | Tuesday, April 25, 2017 |
| APPL NO | 15/496399 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/026 (20130101) F01D 11/003 (20130101) Original (OR) Class F01D 25/162 (20130101) F01D 25/183 (20130101) Non-positive-displacement Pumps F04D 27/009 (20130101) F04D 29/054 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2240/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513939 | Roberge |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Gary D. Roberge (Tolland, Connecticut) |
| ABSTRACT | Aspects of the disclosure are directed an engine having a central longitudinal axis, comprising: a first case that at least partially defines a first flow path, a second case located radially outward of the first case, where the second case and the first case at least partially define a second flowpath, and an assembly that includes a first duct wall, a second duct wall, a finger seal disposed in a gap defined between the first duct wall and the second duct wall such that a first flow in the first flow path is isolated from a second flow in the second flowpath, a stop that projects from the first duct wall towards the second duct wall, and a diaphragm coupled to the second duct wall. |
| FILED | Wednesday, September 13, 2017 |
| APPL NO | 15/703164 |
| ART UNIT | 3747 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 11/003 (20130101) Original (OR) Class F01D 11/005 (20130101) F01D 25/30 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 7/28 (20130101) Jet-propulsion Plants F02K 1/805 (20130101) F02K 3/077 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2240/35 (20130101) F05D 2240/55 (20130101) F05D 2240/57 (20130101) F05D 2250/61 (20130101) F05D 2300/175 (20130101) Pistons; Cylinders; Sealings F16J 15/0887 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513942 | Strock et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNITED TECHNOLOGIES CORPORATION (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Christopher W. Strock (Kennebunk, Maine); Enzo DiBenedetto (Kensington, Connecticut) |
| ABSTRACT | A seal comprises a housing. A coating has at least two layers with a bond layer to be positioned between a housing and a second hard layer. The second hard layer is formed to be harder than the bond layer. The bond layer has a bond strength greater than or equal to 200 psi and less than or equal to 2000 psi. A gas turbine engine, and a method of forming a coating layer are also disclosed. |
| FILED | Tuesday, November 04, 2014 |
| APPL NO | 15/037127 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 4/134 (20160101) Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/12 (20130101) F01D 11/08 (20130101) Original (OR) Class F01D 11/12 (20130101) F01D 25/24 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2230/31 (20130101) F05D 2230/90 (20130101) F05D 2300/173 (20130101) F05D 2300/212 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513947 | Clum et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Carey Clum (East Hartford, Connecticut); Adam Generale (Dobbs Ferry, New York) |
| ABSTRACT | A turbine assembly may comprise a platform defining a platform cavity cooled by a platform flow with a vane extending from the platform. A platform-fed through cavity is defined by the vane and cooled by a first portion of the platform flow. A direct-fed through flow cavity is defined in the vane and cooled by a direct-fed through flow. The direct-fed through flow cavity and the platform-fed through cavity meet at an outlet to expel an outgoing through flow from the outlet. A platform-fed serpentine cavity may be defined in the vane and separated from the platform-fed through cavity by a divider. The platform-fed serpentine cavity is cooled by a second portion of the platform flow. |
| FILED | Monday, June 05, 2017 |
| APPL NO | 15/613686 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 9/041 (20130101) F01D 17/105 (20130101) F01D 25/12 (20130101) Original (OR) Class Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 3/04 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2240/12 (20130101) F05D 2240/35 (20130101) F05D 2240/81 (20130101) F05D 2250/185 (20130101) F05D 2260/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513977 | DeFelice et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Hamilton Sundstrand Corporation (Charlotte, North Carolina) |
| ASSIGNEE(S) | Hamilton Sundstrand Corporation (Charlotte, North Carolina) |
| INVENTOR(S) | Robert DeFelice (South Windsor, Connecticut); Scott W. Simpson (Easthampton, Massachusetts); Josh Kamp (Glastonbury, Connecticut) |
| ABSTRACT | A valve assembly includes a piston housing inside a flow duct between an inlet and an outlet so as to form an annular flow passage between the flow duct and the piston housing. The piston housing is axially aligned with a center axis of the flow duct. A piston is inside the piston housing and is configured to extend downstream of the piston housing in a closed position. A spring biases the piston to the open position. A fluid chamber is between the piston and an upstream end of the piston housing. A control opening extends through the upstream end of the piston housing and fluidically communicates with the flow duct and the fluid chamber. A control piston and a control spring are inside the piston housing. The control spring biases the control piston toward a first position that obstructs the control opening. |
| FILED | Tuesday, March 06, 2018 |
| APPL NO | 15/913023 |
| ART UNIT | 3753 — Fluid Handling and Dispensing |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 17/105 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 6/08 (20130101) Original (OR) Class F02C 7/26 (20130101) F02C 9/52 (20130101) Non-positive-displacement Pumps F04D 27/023 (20130101) F04D 27/0215 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2260/38 (20130101) Valves; Taps; Cocks; Actuating-floats; Devices for Venting or Aerating F16K 1/126 (20130101) F16K 15/026 (20130101) F16K 21/04 (20130101) Technical Subjects Covered by Former US Classification Y10T 137/3421 (20150401) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514002 | Moon et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Francis R. Moon (Granby, Connecticut); Daniel B. Kupratis (Wallingford, Connecticut) |
| ABSTRACT | A gas turbine engine includes an outer case structure around a central longitudinal engine axis. An intermediate case structure is included inboard of the outer case structure. An inner case structure is included inboard of the intermediate case structure. A variable area exhaust mixer is included, which is movable between a closed position adjacent to the intermediate case structure and an open position adjacent to the inner case structure. |
| FILED | Wednesday, September 21, 2016 |
| APPL NO | 15/271541 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Jet-propulsion Plants F02K 1/06 (20130101) F02K 1/12 (20130101) Original (OR) Class F02K 1/36 (20130101) F02K 1/38 (20130101) F02K 1/46 (20130101) F02K 1/386 (20130101) F02K 3/06 (20130101) F02K 3/077 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/323 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514102 | Ward |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Eric J. Ward (West Palm Beach, Florida) |
| ABSTRACT | A gas turbine engine includes a first rotor shaft and a second rotor shaft around the first rotor shaft. A knife edge seal is radially between the first rotor shaft and the second rotor shaft, and is connected to one of the first rotor shaft or the second rotor shaft. The knife edge seal is sized radially to form a gap between the knife edge seal and the other of the first rotor shaft or the second rotor shaft. A plurality of blades having a general airfoil shape is between the first rotor shaft and the second rotor shaft proximate the knife edge seal. The plurality of blades is connected to the first rotor shaft or the second rotor shaft, and a second gap is formed radially between the plurality of blades and the other of the first rotor shaft or the second rotor shaft. |
| FILED | Friday, July 14, 2017 |
| APPL NO | 15/650364 |
| ART UNIT | 3675 — Wells, Earth Boring/Moving/Working, Excavating, Mining, Harvesters, Bridges, Roads, Petroleum, Closures, Connections, and Hardware |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 5/06 (20130101) F01D 11/003 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 7/28 (20130101) Pistons; Cylinders; Sealings F16J 15/002 (20130101) F16J 15/3232 (20130101) F16J 15/3292 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514241 | Reimann et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | Raytheon Company (Waltham, Massachusetts) |
| INVENTOR(S) | Daniel D. Reimann (Tucson, Arizona); Jeffrey R. Richards (Tucson, Arizona); Charles M. Hoke (Reno, Nevada); Robert D. Travis (Tucson, Arizona) |
| ABSTRACT | A missile or other flight vehicle has a stage separation mechanism for separating a downstream stage from an upstream portion of the missile. The mechanism includes one or more holes in fluid communication with a cavity between the upstream and downstream portions of the missile. The holes are located downstream of one or more shocks produced by one or more local variations in the outer surface shape of the missile. The one or more local variations in outer surface shapes produce the one or more shocks as the missile is flown at supersonic speeds. These shock(s) produce downstream pressure rises, and these pressure increases are communicated to the cavity by the hole(s). The increased pressure in the cavity provides a mechanism for separating the downstream stage from the upstream portion of the missile, after release of a mechanical coupling between the upstream portion and downstream stage. |
| FILED | Monday, January 28, 2019 |
| APPL NO | 16/258819 |
| ART UNIT | 3641 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Explosive Charges, e.g for Blasting, Fireworks, Ammunition F42B 15/36 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514296 | Han et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SAMSUNG ELECTRONICS CO., LTD. (Suwon-si, South Korea); CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| ASSIGNEE(S) | SAMSUNG ELECTRONICS CO., LTD. (Suwon-si, South Korea); CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| INVENTOR(S) | Seunghoon Han (Seoul, South Korea); Amir Arbabi (Pasadena, California); Andrei Faraon (Pasadena, California); Ehsan Arbabi (Pasadena, California) |
| ABSTRACT | A spectrometer includes a substrate; a slit which is provided on the substrate and through which light is incident onto the substrate; a metasurface including nanostructures that is configured to reflect and focus the light incident thereon through the slit, at different angles based on respective wavelengths; and a sensor which is provided on one side of the substrate that is opposite to another side of the substrate at which the metasurface is disposed, and configured to receive the light from the metasurface. |
| FILED | Wednesday, July 27, 2016 |
| APPL NO | 15/221184 |
| ART UNIT | 2886 — Optics |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 3/0205 (20130101) G01J 3/0208 (20130101) Original (OR) Class G01J 3/0224 (20130101) G01J 3/0256 (20130101) G01J 3/0259 (20130101) G01J 3/447 (20130101) G01J 3/2803 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514418 | Deslandes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | FEI Company (Hillsboro, Oregon) |
| ASSIGNEE(S) | FEI Company (Hillsboro, Oregon) |
| INVENTOR(S) | Herve Deslandes (Sunnyvale, California) |
| ABSTRACT | A method for emission testing of a semiconductor device (DUT), by mounting the DUT onto an test bench of an emission tester, the emission tester having an optical detector; electrically connecting the DUT to an electrical tester; applying electrical test signals to the DUT while keeping test parameters constant; inserting an optical filters into an optical path of the emission tester and collecting emission test signal from the optical detector; removing the filter from the optical path and collecting emission test signal from the optical detector. Comparing the images obtained with and without the filter. The filter may be shortpass to obtain emission signal, a bandpass for detecting forward bias, or longpass to obtain thermal signal. |
| FILED | Wednesday, October 05, 2016 |
| APPL NO | 15/286371 |
| ART UNIT | 2866 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/311 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514429 | Berggren et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States of America as represented by the Secretary of the Navy (San Diego, California) |
| ASSIGNEE(S) | United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Susan Anne Elizabeth Berggren (San Diego, California); Robert Lewis Fagaly (Carlsbad, California); Anna Leese de Escobar (Encinitas, California); Marcio de Andrade (San Diego, California); Benjamin Jeremy Taylor (Escondido, California) |
| ABSTRACT | An intrinsic superconducting gradiometer comprising: a first array having at least two superconducting devices, wherein the first array has upper and lower terminals located on opposite sides of the first array, wherein the upper terminal is configured to receive a bias signal; and a second array that is identical to, oriented the same as, and located in close proximity to the first array, wherein the second array's upper terminal is grounded and its lower terminal is electrically connected to the first array's lower terminal such that a measured voltage difference between the first array's upper terminal and the second array's upper terminal represents a net current generated by a gradient magnetic field where near-field measurements are cancelled, and wherein the intrinsic superconducting gradiometer is designed to provide the measured voltage difference that is directly proportional to the magnetic field gradient without being connected to any external coils or flux transducers. |
| FILED | Thursday, May 03, 2018 |
| APPL NO | 15/970134 |
| ART UNIT | 2867 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 15/18 (20130101) G01R 33/02 (20130101) G01R 33/022 (20130101) G01R 33/035 (20130101) G01R 33/0354 (20130101) Original (OR) Class G01R 33/0356 (20130101) G01R 33/0358 (20130101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 248/901 (20130101) Y10S 505/845 (20130101) Y10S 505/846 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514502 | Lee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Oracle International Corporation (Redwood Shores, California) |
| ASSIGNEE(S) | Oracle International Corporation (Redwood Shores, California) |
| INVENTOR(S) | Jin-Hyoung Lee (San Diego, California); Ivan Shubin (San Diego, California); Xuezhe Zheng (San Diego, California); Ashok V. Krishnamoorthy (San Diego, California) |
| ABSTRACT | A fabrication technique for cleaving a substrate in an integrated circuit is described. During this fabrication technique, a trench is defined on a back side of a substrate. For example, the trench may be defined using photoresist and/or a mask pattern on the back side of the substrate. The trench may extend from the back side to a depth less than a thickness of the substrate. Moreover, a buried-oxide layer and a semiconductor layer may be disposed on a front side of the substrate. In particular, the substrate may be included in a silicon-on-insulator technology. By applying a force proximate to the trench, the substrate may be cleaved to define a surface, such as an optical facet. This surface may have high optical quality and may extend across the substrate, the buried-oxide layer and the semiconductor layer. |
| FILED | Friday, July 29, 2016 |
| APPL NO | 15/223509 |
| ART UNIT | 2812 — Semiconductors/Memory |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/13 (20130101) Original (OR) Class G02B 6/122 (20130101) G02B 6/136 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/3065 (20130101) H01L 21/7806 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514504 | Orcutt et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Jason Scott Orcutt (Katonah, New York); Karan Kartik Mehta (Cambridge, Massachusetts); Rajeev Jagga Ram (Arlington, Massachusetts); Amir Hossein Atabaki (Medford, Massachusetts) |
| ABSTRACT | Conventional approaches to integrating waveguides within standard electronic processes typically involve using a dielectric layer, such as polysilicon, single-crystalline silicon, or silicon nitride, within the in-foundry process or depositing and patterning a dielectric layer in the backend as a post-foundry process. In the present approach, the back-end of the silicon handle is etched away after in-foundry processing to expose voids or trenches defined using standard in-foundry processing (e.g., complementary metal-oxide-semiconductor (CMOS) processing). Depositing dielectric material into a void or trench yields an optical waveguide integrated within the front-end of the wafer. For example, a shallow trench isolation (STI) layer formed in-foundry may serve as a high-resolution patterning waveguide template in a damascene process within the front end of a die or wafer. Filling the trench with a high-index dielectric material yields a waveguide that can guide visible and/or infrared light, depending on the waveguide's dimensions and refractive index contrast. |
| FILED | Thursday, February 22, 2018 |
| APPL NO | 15/902455 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/122 (20130101) G02B 6/132 (20130101) G02B 6/136 (20130101) Original (OR) Class G02B 6/305 (20130101) G02B 6/1225 (20130101) G02B 6/12004 (20130101) G02B 2006/121 (20130101) G02B 2006/12061 (20130101) G02B 2006/12097 (20130101) G02B 2006/12107 (20130101) G02B 2006/12123 (20130101) Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/025 (20130101) G02F 1/0147 (20130101) G02F 2001/0151 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514509 | Popovic et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Colorado (Denver, Colorado); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | The Regents of the University of Colorado, a Body Corporate (Denver, Colorado); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Milos Popovic (Boulder, Colorado); Vladimir Marko Stojanovic (Berkeley, California); Jason Scott Orcutt (Katonah, New York) |
| ABSTRACT | An optical coupler has a waveguide coupled to a grating of multiple scattering units, each scattering unit having a first scattering element formed of a shape in a polysilicon gate layer and a second scattering element formed of a shape in a body silicon layer of a metal-oxide-semiconductor (MOS) integrated circuit (IC). The couplers may be used in a system having a coupler on each of a first and second IC, infrared light being formed into a beam passing between the couplers. Vias may be interposed in third ICs between the first and second ICs. The couplers may be configured with nonuniform width of scattering elements to produce Gaussian or focused beams. |
| FILED | Friday, January 10, 2014 |
| APPL NO | 14/152898 |
| ART UNIT | 2883 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/34 (20130101) Original (OR) Class G02B 6/124 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514973 | Milor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | Linda Milor (Atlanta, Georgia); Taizhi Liu (Atlanta, Georgia); Chang-Chih Chen (Atlanta, Georgia) |
| ABSTRACT | Aspects of the disclosed technology include a method including extracting, by a processor, a plurality of features from one from among a layout of a circuit, a netlist of the circuit, and the layout and the netlist of the circuit; computing, by the processor, respective lifetime distributions of the plurality of extracted features based on at least one circuit profile; and estimating, by the processor, a lifetime of the circuit by combining the respective lifetime distributions of the plurality of extracted features. |
| FILED | Wednesday, March 01, 2017 |
| APPL NO | 15/446799 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 11/008 (20130101) G06F 11/073 (20130101) G06F 11/079 (20130101) Original (OR) Class G06F 17/5022 (20130101) G06F 17/5036 (20130101) Static Stores G11C 29/02 (20130101) G11C 29/24 (20130101) G11C 29/70 (20130101) G11C 29/12005 (20130101) G11C 29/50004 (20130101) G11C 29/50016 (20130101) G11C 2029/1208 (20130101) G11C 2029/3602 (20130101) G11C 2029/5002 (20130101) G11C 2029/5004 (20130101) G11C 2029/5006 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515046 | Fleming et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | Intel Corporation (Santa Clara, California) |
| INVENTOR(S) | Kermin Fleming (Hudson, Massachusetts); Kent D. Glossop (Merrimack, New Hampshire); Simon C. Steely, Jr. (Hudson, New Hampshire) |
| ABSTRACT | Systems, methods, and apparatuses relating to a configurable spatial accelerator are described. In one embodiment, a processor includes a synchronizer circuit coupled between an interconnect network of a first tile and an interconnect network of a second tile and comprising storage to store data to be sent between the interconnect network of the first tile and the interconnect network of the second tile, the synchronizer circuit to convert the data from the storage between a first voltage or a first frequency of the first tile and a second voltage or a second frequency of the second tile to generate converted data, and send the converted data between the interconnect network of the first tile and the interconnect network of the second tile |
| FILED | Saturday, July 01, 2017 |
| APPL NO | 15/640543 |
| ART UNIT | 2185 — Computer Architecture and I/O |
| CURRENT CPC | Electric Digital Data Processing G06F 9/5027 (20130101) G06F 13/423 (20130101) Original (OR) Class G06F 15/825 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515049 | Fleming et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | intel corporation (Santa Clara, California) |
| INVENTOR(S) | Kermin E. Fleming (Hudson, Massachusetts); Simon C. Steely (Hudson, New Hampshire); Kent D. Glossop (Merrimack, New Hampshire) |
| ABSTRACT | Methods and apparatuses relating to distributed memory hazard detection and error recovery are described. In one embodiment, a memory circuit includes a memory interface circuit to service memory requests from a spatial array of processing elements for data stored in a plurality of cache banks; and a hazard detection circuit in each of the plurality of cache banks, wherein a first hazard detection circuit for a speculative memory load request from the memory interface circuit, that is marked with a potential dynamic data dependency, to an address within a first cache bank of the first hazard detection circuit, is to mark the address for tracking of other memory requests to the address, store data from the address in speculative completion storage, and send the data from the speculative completion storage to the spatial array of processing elements when a memory dependency token is received for the speculative memory load request. |
| FILED | Saturday, July 01, 2017 |
| APPL NO | 15/640541 |
| ART UNIT | 2827 — Semiconductors/Memory |
| CURRENT CPC | Electric Digital Data Processing G06F 9/38 (20130101) G06F 9/3001 (20130101) G06F 9/3004 (20130101) G06F 9/3802 (20130101) G06F 9/30036 (20130101) G06F 9/30076 (20130101) G06F 15/7892 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515282 | Rowland et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America as represented by the Secretary of the Navy (Newport, Rhode Island) |
| ASSIGNEE(S) | The United States of America as represented by the Secretary of Navy (, None) |
| INVENTOR(S) | Raymond J Rowland (Noank, Connecticut); Matthew C Puterio (Newport, Rhode Island); Matthew J Gilchrest (Warwick, Rhode Island); James M Kasischke (Portsmouth, Rhode Island) |
| ABSTRACT | A method for multi-user recognition for a multi-touch display is provided. The method identifies a user by using metrics from a hand touch on the display. A hand based menu system is provided on the display in response. Menu system can be oriented in accordance with the hand touch. Stored user preferences can be retrieved for the identified user. The display can recognize an additional hand from the same user or an additional user's hand. These can be used to provide a collaborative display. Optionally additional metrics can be utilized for user identification. |
| FILED | Thursday, April 05, 2018 |
| APPL NO | 15/945800 |
| ART UNIT | 2663 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Electric Digital Data Processing G06F 2203/04104 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/00013 (20130101) G06K 9/00087 (20130101) G06K 9/00288 (20130101) G06K 9/00892 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515292 | Harwath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | David F. Harwath (Boston, Massachusetts); James R. Glass (Winchester, Massachusetts) |
| ABSTRACT | An approach to joint acoustic and visual processing associates images with corresponding audio signals, for example, for the retrievals of images according to voice queries. A set of paired images and audio signals are processed without requiring transcription, segmentation, or annotation of either the images or the audio. This processing of the paired images and audio is used to determine parameters of an image processor and an audio processor, with the outputs of these processors being comparable to determine a similarity across acoustic and visual modalities. In some implementations, the image processor and the audio processor make use of deep neural networks. Further embodiments associate parts of images with corresponding parts of audio signals. |
| FILED | Thursday, June 15, 2017 |
| APPL NO | 15/623682 |
| ART UNIT | 2668 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Electric Digital Data Processing G06F 3/167 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/00684 (20130101) G06K 9/6215 (20130101) Original (OR) Class G06K 9/6256 (20130101) G06K 9/6293 (20130101) Computer Systems Based on Specific Computational Models G06N 3/08 (20130101) G06N 3/0454 (20130101) G06N 3/0481 (20130101) Speech Analysis or Synthesis; Speech Recognition; Speech or Voice Processing; Speech or Audio Coding or Decoding G10L 15/1815 (20130101) G10L 25/30 (20130101) G10L 25/54 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515458 | Yakimenko et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| INVENTOR(S) | Oleg A. Yakimenko (Seaside, California); Ryan J. Decker (Lake Hopatcong, New Jersey) |
| ABSTRACT | A method and apparatus for estimating the position and attitude of an aerial vehicle transiting over terrain through a combination of steps combining image registration and the inherent image coordinate system of the camera. The aerial vehicle captures an image of the terrain and extracts features from the camera image and pre-existing aerial imagery, and determines a perspective transform between the images. Image reference points are projected with the 2D perspective transform and an elevation map provides estimated 3D coordinates of the image reference points. Subsequently a camera position and orientation necessary for the camera to obtain the initial camera image is determined by projecting reference points with locations defined by the image coordinate system of the camera to define terrain points, and conducting an optimization to minimize displacements between the estimated coordinates and the terrain coordinates. The estimated camera position provides a location and attitude for the aerial vehicle. |
| FILED | Wednesday, February 28, 2018 |
| APPL NO | 15/907453 |
| ART UNIT | 2483 — Recording and Compression |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 7/66 (20170101) G06T 7/74 (20170101) Original (OR) Class G06T 17/05 (20130101) G06T 2207/30181 (20130101) G06T 2207/30241 (20130101) Pictorial Communication, e.g Television H04N 7/183 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515872 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | HRL Laboratories, LLC (Malibu, California) |
| ASSIGNEE(S) | HRL Laboratories, LLC (Malibu, California) |
| INVENTOR(S) | James Chingwei Li (Simi Valley, California); Yakov Royter (Santa Monica, California); Pamela R. Patterson (Los Angeles, California); Donald A. Hitko (Olney, Maryland) |
| ABSTRACT | A transistor having an emitter, a base, and a collector, the transistor includes a substrate, a collector contact, a metallic sub-collector coupled to the collector contact, and the metallic sub-collector electrically and thermally coupled to the collector, and an adhesive layer between the substrate and the metallic sub-collector, the adhesive layer bonded to the substrate and in direct contact with the substrate and bonded to the metallic sub-collector and in direct contact with the metallic sub-collector, wherein the adhesive layer comprises an electrically conductive material. |
| FILED | Thursday, October 20, 2016 |
| APPL NO | 15/298609 |
| ART UNIT | 2898 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/74 (20130101) H01L 21/304 (20130101) H01L 21/743 (20130101) H01L 21/2007 (20130101) H01L 21/6835 (20130101) H01L 23/481 (20130101) Original (OR) Class H01L 23/535 (20130101) H01L 23/3732 (20130101) H01L 23/3738 (20130101) H01L 29/401 (20130101) H01L 29/452 (20130101) H01L 29/495 (20130101) H01L 29/7371 (20130101) H01L 29/41708 (20130101) H01L 29/66242 (20130101) H01L 29/66265 (20130101) H01L 29/66318 (20130101) H01L 33/64 (20130101) H01L 2221/6835 (20130101) H01L 2221/68368 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516043 | Sriram et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cree, Inc. (Durham, North Carolina) |
| ASSIGNEE(S) | Cree, Inc. (Durham, North Carolina) |
| INVENTOR(S) | Saptharishi Sriram (Cary, North Carolina); Jennifer Qingzhu Gao (Raleigh, North Carolina); Jeremy Fisher (Raleigh, North Carolina); Scott Sheppard (Chapel Hill, North Carolina) |
| ABSTRACT | A gallium nitride based monolithic microwave integrated circuit includes a substrate, a channel layer on the substrate and a barrier layer on the channel layer. A recess is provided in a top surface of the barrier layer. First gate, source and drain electrodes are provided on the barrier layer opposite the channel layer, with a bottom surface of the first gate electrode in direct contact with the barrier layer. Second gate, source and drain electrodes are also provided on the barrier layer opposite the channel layer. A gate insulating layer is provided in the recess in the barrier layer, and the second gate electrode is on the gate insulating layer opposite the barrier layer and extending into the recess. The first gate, source and drain electrodes comprise the electrodes of a depletion mode transistor, and the second gate, source and drain electrodes comprise the electrodes of an enhancement mode transistor. |
| FILED | Thursday, July 19, 2018 |
| APPL NO | 16/039370 |
| ART UNIT | 2818 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 29/2003 (20130101) H01L 29/7787 (20130101) Original (OR) Class H01L 29/66462 (20130101) Amplifiers H03F 1/0261 (20130101) H03F 3/21 (20130101) H03F 3/1935 (20130101) H03F 2200/451 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516156 | Ruth et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Government, as represented by the Secretary of the Army (Aberdeen Proving Ground, Maryland) |
| ASSIGNEE(S) | The Government of the United States as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Ashley L. Ruth (Bel Air, Maryland); Terrill B. Atwater (Bel Air, Maryland); Paula C. Latorre (Bel Air, Maryland) |
| ABSTRACT | A process for preparing a stable LixMn2-yMeyO4-zClz material with a MOb or MMnaOb charge transfer catalyst coating is provided, where Me is Fe, Co, or Ni and M is Bi, As, or Sb. In addition, a LixMn2-yMeyO4-zClz material with a MOb or MMnaOb charge transfer catalyst coating is provided. Furthermore, a lithium or lithium ion rechargeable electrochemical cell is provided, which includes a cathode material (in a positive electrode) containing a LixMn2-yMeyO4-zClz material with a MOb or MMnaOb charge transfer catalyst coating. |
| FILED | Wednesday, May 25, 2016 |
| APPL NO | 15/164068 |
| ART UNIT | 1727 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Compounds Containing Metals Not Covered by Subclasses C01D or C01F C01G 49/009 (20130101) C01G 51/006 (20130101) C01G 53/006 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/62 (20130101) H01M 4/0471 (20130101) H01M 4/505 (20130101) H01M 4/1315 (20130101) Original (OR) Class H01M 4/13915 (20130101) H01M 10/0525 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516177 | Wynne et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Teledyne Energy Systems, Inc. (Thousand Oaks, California) |
| ASSIGNEE(S) | TELEDYNE ENERGY SYSTEMS, INC. (Thousand Oaks, California) |
| INVENTOR(S) | Robert K. Wynne (New Freedom, Pennsylvania); Patrick Scott Ferguson (Baltimore, Maryland); Robert Christopher Utz (Phoenix, Maryland) |
| ABSTRACT | A fuel cell purge system includes a primary fuel cell in fluid communication with a purge cell. Fuel and oxidant purged with inert gas impurities from the primary fuel cell react in the purge cell, thereby decreasing the volume of purged gases and facilitating storage while maintaining fuel cell electrochemical performance. |
| FILED | Tuesday, November 15, 2016 |
| APPL NO | 15/351664 |
| ART UNIT | 1723 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 8/0662 (20130101) H01M 8/04179 (20130101) H01M 8/04231 (20130101) Original (OR) Class H01M 8/04291 (20130101) H01M 2008/1095 (20130101) H01M 2250/20 (20130101) Climate Change Mitigation Technologies Related to Transportation Y02T 90/32 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516195 | McKay et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Ian Salmon McKay (Seattle, Washington); Ruaridh R. Macdonald (London, United Kingdom); Thomas B. Milnes (Beverly, Massachusetts) |
| ABSTRACT | An anaerobic aluminum-water electrochemical cell is provided. The electrochemical cell includes: a plurality of electrode stacks, each electrode stack featuring an aluminum or aluminum alloy anode, and at least one cathode configured to be electrically coupled to the anode; one or more physical separators between each electrode stack adjacent to the cathode; a housing configured to hold the electrode stacks, an electrolyte, and the physical separators; a water injection port, in the housing, configured to introduce water into the housing; and an amount of hydroxide base sufficient to form an electrolyte having a hydroxide base concentration of at least 0.5% to at most 13% of the saturation concentration when water is introduced between the anode and the least one cathode. |
| FILED | Tuesday, August 07, 2018 |
| APPL NO | 16/057086 |
| ART UNIT | 1723 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/469 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 2/14 (20130101) H01M 2/0255 (20130101) H01M 4/463 (20130101) H01M 8/04828 (20130101) H01M 12/04 (20130101) H01M 12/08 (20130101) Original (OR) Class H01M 2300/0014 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516214 | Boryssenko |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SI2 Technologies, Inc. (N. Billerica, Massachusetts) |
| ASSIGNEE(S) | SI2 Technologies, Inc. (North Billerica, Massachusetts) |
| INVENTOR(S) | Anatoliy Boryssenko (Belchertown, Massachusetts) |
| ABSTRACT | Antenna elements are described that may include a radiator, a feeding portion, a first impedance transformer, a balun, and a second impedance transformer. The first impedance transformer, balun, and second impedance transformer may be disposed above a ground plane of an antenna array to reduce a bulk of the array. The array can also include a dielectric top layer for loading apertures of the antenna array. The antenna elements can also include anomaly suppressors can be provided to cancel common-mode resonances from the radiators. |
| FILED | Tuesday, November 05, 2013 |
| APPL NO | 14/072432 |
| ART UNIT | 2845 — Electrical Circuits and Systems |
| CURRENT CPC | Antennas, i.e Radio Aerials H01Q 9/16 (20130101) Original (OR) Class H01Q 9/065 (20130101) H01Q 21/0006 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516248 | Taylor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE NAVY (San Diego, California) |
| ASSIGNEE(S) | United States of America as represented by Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Benjamin J. Taylor (Escondido, California); Teresa H. Emery (San Diego, California) |
| ABSTRACT | A system includes a substrate, a high-temperature superconductor compound film disposed on the substrate, an array of superconducting regions formed within the film, a plurality of Josephson junctions formed within the film, where each Josephson junction of the plurality of Josephson junctions is formed between adjacent superconducting regions within the array of superconducting regions, and a voltage source connected to the array of superconducting regions. The plurality of Josephson junctions are separated by a distance such that they emit coherent radiation in the terahertz frequency range responsive to a voltage applied to the array of superconducting regions. |
| FILED | Friday, June 30, 2017 |
| APPL NO | 15/638928 |
| ART UNIT | 1735 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 39/025 (20130101) H01L 39/223 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/1683 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516642 | Cansever |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia) |
| ASSIGNEE(S) | The Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Derya Cansever (Havre de Grace, Maryland) |
| ABSTRACT | Priority assignment embodiments are discussed. In one embodiment, a system comprises a comparison component configured to make a first comparison of a first message of a message set against a mission with regard to a similarity of the first message to the mission to produce a first message similarity result and make a second comparison of a second message of the message set against the mission with regard to a similarity of the second message to the mission to produce a second message similarity result. The system also comprises a priority component configured to assign a transfer priority order among the first message and the second message through use of the first message similarity result and the second message similarity result, where the transfer priority order is based, at least in part, on the more similar a message is to the mission the higher priority given to the message. |
| FILED | Thursday, October 12, 2017 |
| APPL NO | 15/730769 |
| ART UNIT | 2455 — Computer Networks |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 41/026 (20130101) H04L 51/14 (20130101) H04L 51/16 (20130101) H04L 51/26 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516857 | Lam et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of the Navy (Crane, Indiana) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Jack Lam (Rancho Cucamonga, California); Philippe Navarro (Pasadena, California); Bryan Stewart (Oxnard, California); Michael Virbia (Oxnard, California); Jacky Wong (Chino Hills, California) |
| ABSTRACT | A system and method for using the system comprising a head mounted device (HMD), a remote maintenance server (RMS), and a control section operable to identify the system under test (SUT) using an image recognition function, to identify a plurality of subsystems (PLoS) within the SUT in a data library, to create three dimensional models of the PLoS and displaying the same on a visual interface of the HMD using an augmented reality function, to connect to the RMS using an encryption algorithm via streaming video or images sent to the RMS, to collect SUT data and external (to the SUT) sensor data, to conduct a prognostics and/or health, maintenance, and/or management (HMM) service on the collected data to determine system health and projected health of the SUT and/or PLoS, to authenticate remote user access to the RMS, to update the data library, and to insert a plurality of (HMM) designators on the visual interface. |
| FILED | Friday, October 12, 2018 |
| APPL NO | 16/158766 |
| ART UNIT | 2486 — Recording and Compression |
| CURRENT CPC | Electric Digital Data Processing G06F 11/0709 (20130101) G06F 11/0748 (20130101) G06F 11/0793 (20130101) Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/10 (20130101) G06Q 10/20 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 63/08 (20130101) H04L 63/0428 (20130101) Pictorial Communication, e.g Television H04N 7/185 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Health and Human Services (HHS)
| US 10512253 | Feinstein et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Research Foundation of the City University of New York (New York, New York) |
| ASSIGNEE(S) | Research Foundation of the City University of New York (New York, New York) |
| INVENTOR(S) | Paul Feinstein (New York, New York); Charlotte D'Hulst (Brooklyn, New York) |
| ABSTRACT | A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA. |
| FILED | Wednesday, August 03, 2016 |
| APPL NO | 15/749007 |
| ART UNIT | 1632 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 67/0275 (20130101) Original (OR) Class A01K 2217/072 (20130101) A01K 2227/10 (20130101) A01K 2267/02 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8509 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512606 | Reshetnyak et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rhode Island Council on Postsecondary Education (Warwick, Rhode Island); Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yana K. Reshetnyak (South Kingstown, Rhode Island); Oleg A. Andreev (South Kingstown, Rhode Island); Donald M. Engelman (New Haven, Connecticut) |
| ABSTRACT | The present application relates to compositions comprising and methods of using a liposome comprising a pHLIP polypeptide, wherein a lipid bilayer of the liposome is substantially free of the pHLIP polypeptide. |
| FILED | Wednesday, August 30, 2017 |
| APPL NO | 15/691130 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/127 (20130101) A61K 9/1271 (20130101) Original (OR) Class A61K 31/20 (20130101) A61K 31/337 (20130101) A61K 31/704 (20130101) A61K 31/711 (20130101) A61K 31/713 (20130101) A61K 31/7105 (20130101) A61K 47/6911 (20170801) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512642 | Azam |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Children's Hospital Medical Center (Cincinnati, Ohio) |
| ASSIGNEE(S) | CHILDREN'S HOSPITAL MEDICAL CENTER (Cincinnati, Ohio) |
| INVENTOR(S) | Mohammad Azam (Mason, Ohio) |
| ABSTRACT | Methods and compositions disclosed herein generally relate to methods, compounds, and compositions for treating myeloproliferative neoplasms (MPNs) or a symptom thereof, comprising administering, to a subject in need thereof, a therapeutically effective amount of a DUSP1 inhibiting compound, or of a pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof. Embodiments of the invention also relate to use of a compound, or pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof, for the preparation of a composition or medicament for the treatment of a myeloproliferative neoplasm (MPN), wherein the compound is an inhibitor of DUSP1. |
| FILED | Friday, June 03, 2016 |
| APPL NO | 15/579531 |
| ART UNIT | 1621 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/137 (20130101) A61K 31/357 (20130101) A61K 31/4375 (20130101) A61K 31/4741 (20130101) Original (OR) Class A61K 45/06 (20130101) A61K 2300/00 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512647 | O'Malley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BAYLOR COLLEGE OF MEDICINE (Houston, Texas) |
| ASSIGNEE(S) | BAYLOR COLLEGE OF MEDICINE (Houston, Texas) |
| INVENTOR(S) | Bert W. O'Malley (Houston, Texas); David Michael Lonard (Pearland, Texas); Jin Wang (Sugar Land, Texas); Jianming Xu (Bellaire, Texas); Jianwei Chen (Houston, Texas) |
| ABSTRACT | Small molecule regulators of steroid receptor coactivator (SRC) family proteins are provided, as well as methods for their use in treating or preventing SRC-related diseases. The SRC-related diseases can include cancer, metabolic disorders, human immunodeficiency virus, neurodegenerative disorders, and/or inflammatory diseases. Also provided are methods for regulating SRC family proteins in a cell. |
| FILED | Friday, March 22, 2019 |
| APPL NO | 16/361600 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/426 (20130101) A61K 31/506 (20130101) Original (OR) Class A61K 31/4184 (20130101) A61K 31/4402 (20130101) Heterocyclic Compounds C07D 401/12 (20130101) C07D 401/14 (20130101) C07D 403/12 (20130101) C07D 405/12 (20130101) C07D 409/12 (20130101) C07D 413/12 (20130101) C07D 417/12 (20130101) C07D 471/04 (20130101) C07D 487/04 (20130101) C07D 498/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512662 | Deng et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Memorial Sloan Kettering Cancer Center (New York, New York) |
| ASSIGNEE(S) | Memorial Sloan Kettering Cancer Center (New York, New York) |
| INVENTOR(S) | Liang Deng (New York, New York); Stewart Shuman (New York, New York); Jedd Wolchok (New York, New York); Taha Merghoub (New York, New York); Weiyi Wang (New York, New York); Peihong Dai (New York, New York); Ning Yang (New York, New York) |
| ABSTRACT | The present invention relates generally to the fields of oncology, virology and immunotherapy. More particularly, it concerns the use of poxviruses, specifically the replication competent attenuated vaccinia virus with deletion of thymidine kinase (VC-TK−) with and without the expression of human Flt3L or GM-CSF as oncolytic and immunotherapy. The foregoing poxviruses can also be used in combination with immune checkpoint blocking agents. The foregoing poxviruses can also be inactivated via Heat or UV-treatment and the inactivated virus can be used as immunotherapy either alone or in combination with immune checkpoint blocking agents. |
| FILED | Saturday, February 25, 2017 |
| APPL NO | 16/079217 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/76 (20130101) A61K 35/768 (20130101) Original (OR) Class A61K 39/3955 (20130101) A61K 39/3955 (20130101) A61K 48/00 (20130101) A61K 2039/505 (20130101) A61K 2300/00 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 14/521 (20130101) C07K 14/535 (20130101) C07K 16/2818 (20130101) C07K 16/2827 (20130101) C07K 2317/76 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/86 (20130101) C12N 2710/24121 (20130101) C12N 2710/24132 (20130101) C12N 2710/24133 (20130101) C12N 2710/24143 (20130101) C12N 2710/24161 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512665 | Kay et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Utah Research Foundation (Salt Lake City, Utah) |
| ASSIGNEE(S) | UNIVERSITY OF UTAH RESEARCH FOUNDATION (Salt Lake City, Utah) |
| INVENTOR(S) | Michael S. Kay (Salt Lake City, Utah); Brett D. Welch (Salt Lake City, Utah) |
| ABSTRACT | Disclosed are compositions and methods for inhibiting viral entry. |
| FILED | Thursday, June 02, 2016 |
| APPL NO | 15/171753 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/10 (20130101) Original (OR) Class A61K 45/06 (20130101) A61K 47/55 (20170801) A61K 47/60 (20170801) A61K 47/641 (20170801) Peptides C07K 5/1024 (20130101) C07K 7/06 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5008 (20130101) G01N 33/56983 (20130101) G01N 2333/005 (20130101) G01N 2333/162 (20130101) G01N 2500/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512667 | Kerppola et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Michigan (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Tom K. Kerppola (Ann Arbor, Michigan); Veronica E. Burns (Ann Arbor, Michigan) |
| ABSTRACT | Provided herein are methods for treating subjects having conditions related to adrenocortical activity and/or excessive steroid production. In particular, provided herein are methods for treating subjects having conditions related to adrenocortical activity and/or excessive steroid production through administration of at least one of the following agents: 1) an agent capable of inhibiting cholesterol efflux related to ABCA1 and/or ABCG1; 2) an agent capable of inhibiting MDR1 related cortisol secretion and/or MDR1 P-glycoprotein multiple drug transporter activity; and 3) an agent capable of inhibiting mitochondrial activity. |
| FILED | Wednesday, June 27, 2018 |
| APPL NO | 16/020457 |
| ART UNIT | 1629 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/17 (20130101) A61K 31/17 (20130101) A61K 31/18 (20130101) A61K 31/64 (20130101) A61K 31/64 (20130101) A61K 31/277 (20130101) A61K 31/277 (20130101) A61K 31/352 (20130101) A61K 31/352 (20130101) A61K 31/496 (20130101) A61K 31/496 (20130101) A61K 31/4725 (20130101) A61K 31/4725 (20130101) A61K 31/4965 (20130101) A61K 31/4965 (20130101) A61K 31/5685 (20130101) A61K 31/5685 (20130101) A61K 35/04 (20130101) A61K 38/12 (20130101) Original (OR) Class A61K 38/12 (20130101) A61K 38/13 (20130101) A61K 38/13 (20130101) A61K 45/06 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 5/42 (20180101) A61P 5/46 (20180101) A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512671 | Caspi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE UNITED STATES OF AMERICA, as represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland) |
| ASSIGNEE(S) | THE UNITED STATES OF AMERICA, as represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland) |
| INVENTOR(S) | Rachel R. Caspi (Bethesda, Maryland); Wai Po Chong (Mongkok, China Hong Kong); Reiko Yamane (Rockville, Maryland); Mary Mattapallil (Rockville, Maryland) |
| ABSTRACT | Methods are provided for treating ocular surface inflammation and/or uveitis in a subject. The methods can include selecting a subject with uveitis and/or ocular surface disease. The methods can then include administering to the subject a therapeutically effective amount of an interleukin 24 (IL-24) polypeptide or nucleic acid encoding the IL-24 polypeptide. In some examples, the administered IL-24 polypeptide suppresses production of effector cytokines by Th17 cells. A pharmaceutical composition is further provided here that includes an IL-24 polypeptide or nucleic acid encoding the polypeptide. In some examples, the IL-24 polypeptide is a variant of IL-24 or an Fc fusion protein that includes IL-24. The pharmaceutical composition can be used in any of the methods provided herein to treat ocular surface inflammation and/or uveitis. |
| FILED | Thursday, April 19, 2018 |
| APPL NO | 15/957019 |
| ART UNIT | 1647 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/0048 (20130101) A61K 38/20 (20130101) Original (OR) Class A61K 38/22 (20130101) A61K 38/1774 (20130101) A61K 47/68 (20170801) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 27/02 (20180101) A61P 37/06 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512672 | Chavez et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Xalud Therapeutics, Inc. (Oakland, California); The Regents of the University of Colorado, a Body Corporate (Denver, Colorado) |
| ASSIGNEE(S) | Xalud Therapeutics, Inc. (Berkeley, California); The Regents of the University of Colorado, a Body Corporate (Denver, Colorado) |
| INVENTOR(S) | Raymond A. Chavez (San Francisco, California); Linda R. Watkins (Boulder, California); Robert Landry (Erie, Colorado) |
| ABSTRACT | This invention provides compositions and methods for preventing inflammatory diseases of the joints, including rheumatoid and osteoarthritis, tendonitis, bursitis, inflammation of the ligament, synovitis, gout, and systemic lupus erythematosus, wherein the methods include injecting into the inflamed joint a therapeutic anti-inflammatory composition comprising a bacterial or viral IL-10 expression construct, wherein the IL-10 expression construct comprises a bacterial or viral backbone and a nucleic acid sequence encoding interleukin-10. |
| FILED | Thursday, July 17, 2014 |
| APPL NO | 14/905915 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/2066 (20130101) Original (OR) Class A61K 48/005 (20130101) A61K 48/0075 (20130101) A61K 48/0091 (20130101) Peptides C07K 14/5428 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512673 | Tarasova et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as Represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland); Colorado State University Research Foundation (Fort Collins, Colorado) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland); Colorado State University Research Foundation (Fort Collins, Colorado) |
| INVENTOR(S) | Nadya I. Tarasova (Frederick, Maryland); Mercedes Gonzalez-Juarrero (Fort Collins, Colorado) |
| ABSTRACT | The invention provides a method of treating pathogenic bacterial infection (e.g., tuberculosis infection) in an animal comprising administering a peptide-based inhibitor of the STAT3-IL10 pathway or a nucleic acid encoding the peptide-based inhibitor to the animal. The invention also provides methods of treating chronic granulomatous disease and Wegener's granulomatosis in an animal comprising administering a peptide-based inhibitor of the STAT3-IL10 pathway or a nucleic acid encoding the peptide-based inhibitor to the animal. |
| FILED | Thursday, January 07, 2016 |
| APPL NO | 15/541871 |
| ART UNIT | 1654 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/007 (20130101) A61K 9/12 (20130101) A61K 38/1709 (20130101) A61K 38/1793 (20130101) A61K 38/2066 (20130101) Original (OR) Class A61K 45/06 (20130101) Peptides C07K 7/06 (20130101) C07K 7/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10512691 | Kalifa et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan); Jerome Kalifa (Oak Park, Michigan); Raoul Kopelman (Ann Arbor, Michigan); Uma Mahesh R. Avula (Ypsilanti, Michigan); Gwangseong Kim (Ann Arbor, Michigan); Yong-Eun Koo Lee (Seoul, South Korea); Hyung Ki Yoon (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Jerome Kalifa (Oak Park, Michigan); Raoul Kopelman (Ann Arbor, Michigan); Uma Mahesh R. Avula (Ypsilanti, Michigan); Gwangseong Kim (Ann Arbor, Michigan); Yong-Eun Koo Lee (Seoul, South Korea); Hyung Ki Yoon (Ann Arbor, Michigan) |
| ABSTRACT | The present invention relates to nanoparticles. In particular, the present invention provides nanoparticles for clinical (e.g., targeted therapeutic), diagnostic (e.g., imaging), and research applications in the field of cardiology. For example, in some embodiments, the present invention provides a method of treating (e.g., ablating) cardiac tissue, comprising: a) contacting an animal with a nanoparticle comprising a matrix, a toxic (e.g., ablative) agent (e.g., sonosensitizer, chemotherapeutic agent (e.g., doxorubicin or cisplatin), or photosensitizer), and a cardiac targeting moiety; and b) administering an activator of the toxic agent (e.g., light, chemical (e.g., pharmaceutical agent) or ultrasound) to at least a portion of the cardiac tissue (e.g., heart) of the animal to activate the toxic agent. |
| FILED | Tuesday, April 23, 2013 |
| APPL NO | 14/396533 |
| ART UNIT | 1618 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5138 (20130101) A61K 31/704 (20130101) A61K 31/5415 (20130101) A61K 33/24 (20130101) A61K 38/10 (20130101) A61K 38/18 (20130101) A61K 38/20 (20130101) A61K 38/21 (20130101) A61K 41/0057 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513434 | Seger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | R. Adam Seger (Santa Cruz, California); Paolo Actis (London, United Kingdom); Boaz Vilozny (Santa Cruz, California); Nader Pourmand (Scotts Valley, California) |
| ABSTRACT | Disclosed herein are methods and systems for controlled ejection of desired material onto surfaces including in single cells using nanopipettes, as well as ejection onto and into cells. Some embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller for depositing a user defined pattern on an arbitrary substrate for the purpose of controlled cell adhesion and growth. Alternate embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller and electronic control of a voltage differential in a bore of the nanopipette electroosmotically injecting material into a cell in a high-throughput manner and with minimal damage to the cell. Yet other embodiments are directed to method and system comprising functionalized nanopipettes combined with scanning ion conductance microscopy for studying molecular interactions and detection of biomolecules inside a single living cell. |
| FILED | Monday, March 20, 2017 |
| APPL NO | 15/463860 |
| ART UNIT | 1641 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 2219/00371 (20130101) Chemical or Physical Laboratory Apparatus for General Use B01L 3/50273 (20130101) B01L 3/502715 (20130101) B01L 2300/0645 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Original (OR) Class B82Y 15/00 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/48728 (20130101) Scanning-probe Techniques or Apparatus; Applications of Scanning-probe Techniques, e.g Scanning Probe Microscopy [SPM] G01Q 60/44 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513516 | Issa et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Temple University Of The Commonwealth System of Higher Education (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | Temple University Of The Commonwealth System of Higher Education (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Jean-Pierre J. Issa (Philadelphia, Pennsylvania); Hanghang Zhang (Philadelphia, Pennsylvania); Magid Abu-Gharbia (Exton, Pennsylvania); Wayne E. Childers (New Hope, Pennsylvania); George C. Morton (Collegeville, Pennsylvania) |
| ABSTRACT | The present invention includes novel aminothiazole compounds of formula (I) useful in preventing or treating cancer in a subject in need thereof. The present invention also includes methods of preventing or treating cancer in a subject in need thereof by administering to the subject a therapeutically effective amount of a compound of the invention. |
| FILED | Thursday, July 21, 2016 |
| APPL NO | 15/746838 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/427 (20130101) A61K 31/427 (20130101) A61K 31/706 (20130101) A61K 31/706 (20130101) A61K 45/06 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) A61K 2300/00 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Heterocyclic Compounds C07D 417/06 (20130101) C07D 417/14 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513520 | Wagner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Regents of the University of Minnesota (Minneapolis, Minnesota) |
| ASSIGNEE(S) | Regents of the University of Minnesota (Minneapolis, Minnesota) |
| INVENTOR(S) | Carston R. Wagner (St. Paul, Minnesota); Rachit Shah (Minneapolis, Minnesota) |
| ABSTRACT | Embodiments provide, among things, compounds of the formula I: wherein Het, Y, Rx, Z, X, R1-R3, R6, and R7 are defined herein; and methods for using such compounds to reduce pain (e.g., neuronal pain), treat a mammal's addiction to nicotine or anti-pain drugs, and increase a mammal's sensitivity to drugs that bind MOR or NMDAR. |
| FILED | Wednesday, August 09, 2017 |
| APPL NO | 15/673297 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 405/14 (20130101) C07D 473/18 (20130101) C07D 473/34 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513521 | Lee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Brigham and Women's Hospital, Inc. (Boston, Massachusetts); The United States of America, as Represented by the Secretary, Department of Health and Human Services, National Institutes of Health (Bethesda, Maryland); University of Houston System (Houston, Texas) |
| ASSIGNEE(S) | The Brigham and Women's Hospital, Inc. (Boston, Massachusetts); University of Houston System (Houston, Texas); The United States of America, as Represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland) |
| INVENTOR(S) | Arthur Lee (San Jose, California); John C. McKew (Boyds, Maryland); Paresma R. Patel (Rockville, Maryland); Paul B. Yu (Boston, Massachusetts); Agustin H. Mohedas (Somerville, Massachusetts); Philip E. Sanderson (Bethesda, Maryland); Gregory D. Cuny (Houston, Texas); Wei Zheng (Potomac, Maryland); Xiuli Huang (Potomac, Maryland) |
| ABSTRACT | The present invention provides bicyclic heteroaryl inhibitors of BMP signaling and compositions and methods for inhibiting BMP signaling. Exemplary compounds include those of Formula I: These compounds and compositions may be used to modulate cell growth, differentiation, proliferation, and apoptosis, and thus may be useful for treating diseases or conditions associated with BMP signaling, including inflammation, cardiovascular disease, hematological disease, cancer, and bone disorders, as well as for modulating cellular differentiation and/or proliferation. These compounds and compositions may also be used to reduce circulating levels of ApoB-100 or LDL and treat or prevent acquired or congenital hypercholesterolemia or hyperlipoproteinemia; diseases, disorders, or syndromes associated with defects in lipid absorption or metabolism; or diseases, disorders, or syndromes caused by hyperlipidemia. |
| FILED | Tuesday, July 14, 2015 |
| APPL NO | 15/326262 |
| ART UNIT | 1624 — Organic Chemistry |
| CURRENT CPC | Heterocyclic Compounds C07D 487/04 (20130101) Original (OR) Class C07D 519/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513525 | Du Bois et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Palo Alto, California) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California) |
| INVENTOR(S) | Justin Du Bois (Menlo Park, California); John Mulcahy (Redwood City, California); Brian Andresen (Sharon, Massachusetts); David C. Yeomans (Sunnyvale, California); Sandip Biswal (Stanford, California) |
| ABSTRACT | Saxitoxin analogue compounds, compositions, pharmaceutical compositions, methods of synthesis of saxitoxin analogues, methods of imaging, methods of treatment, including methods of treating pain, are provided. Saxitoxin (STX), gonyautoxin (GTX), and zetekitoxin, and variant STX compounds bind to sodium channels and are effective to reduce or block flow of sodium ions through such channels. Such channel block affects nerve and muscle action, and may be effective to reduce or block pain sensations, relax muscles, reduce muscle spasm, and reduce wrinkles. STX analogue binding to sodium channels may also be useful to locate, image, or mark sodium channels, and so be useful in studying sodium channels and sodium channel disorders, and in the diagnosis and treatment of patients suffering from sodium channel disorders. In embodiments, the variant STX compounds include conjugates having increased serum half-life as compared to STX when administered to a subject. Also provided are methods for alleviating pain in a subject in need of treatment. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923349 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 8/4953 (20130101) A61K 49/0002 (20130101) A61K 49/0004 (20130101) A61K 49/0032 (20130101) A61K 49/0052 (20130101) A61K 51/0459 (20130101) Specific Use of Cosmetics or Similar Toilet Preparations A61Q 19/02 (20130101) A61Q 19/08 (20130101) Heterocyclic Compounds C07D 487/14 (20130101) C07D 487/16 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513535 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | Xiaojin He (New York City, New York); Ruojie Sha (Basking Ridge, New Jersey); Yongli Mi (Kowloon, China Hong Kong); Paul Chaikin (New York, New York); Nadrian C. Seeman (New York, New York) |
| ABSTRACT | The present invention provides a method for self-replication of multimers of nucleic acid origami tiles by exponentially amplifying the multimer from initial seeds of monomeric units of nucleic acid origami tiles and also provides for the selective exponential amplification of a designated multimer, such as with specific properties or characteristics, over one or more competing multimers in the presence of a mixture of monomers for each of the possible multimers. The selection of the designated multimer based on an environmental change allows the designated multimer to outgrow all competing multimers. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923361 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 21/04 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/11 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6816 (20130101) C12Q 1/6816 (20130101) C12Q 2565/113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513540 | Blumberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts) |
| ASSIGNEE(S) | The Brigham and Women's Hospital, Inc. (Boston, Massachusetts) |
| INVENTOR(S) | Richard S. Blumberg (Waltham, Massachusetts); Vijay K. Kuchroo (Newton, Massachusetts); Yu-Hwa Huang (Boston, Massachusetts); Chen Zhu (Brookline, Massachusetts); Ana C. Anderson (Brookline, Massachusetts) |
| ABSTRACT | Described herein are compositions and methods for the modulation of T-cell tolerance, which can be upregulated or down regulated by concurrent enhancement or inhibition of CEACAM1/TIM3 interactions. As described herein, the discovery that CEACAM1 is a direct ligand of TIM3 and vice versa has been shown in cis and in trans. In addition, as demonstrated herein, CEACAM1 and TIM3 are co-regulated during the course of T-cell activation. |
| FILED | Tuesday, July 30, 2013 |
| APPL NO | 14/418726 |
| ART UNIT | 1644 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/10 (20130101) A61K 39/3955 (20130101) A61K 2039/505 (20130101) A61K 2039/507 (20130101) Peptides C07K 7/08 (20130101) Original (OR) Class C07K 14/70503 (20130101) C07K 16/30 (20130101) C07K 16/2803 (20130101) C07K 2317/31 (20130101) C07K 2317/73 (20130101) C07K 2319/30 (20130101) Technologies for Adaptation to Climate Change Y02A 50/463 (20180101) Y02A 50/466 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513563 | Shen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wei-Chiang Shen (San Marino, California); Yan Wang (Alhambra, California); Jennica Krankel (Studio City, California) |
| ASSIGNEE(S) | University of Southern California (Los Angeles, California) |
| INVENTOR(S) | Wei-Chiang Shen (San Marino, California); Yan Wang (Alhambra, California); Jennica Krankel (Studio City, California) |
| ABSTRACT | The present invention provides compositions useful as prodrugs and methods for making the same. The compositions include a fusion protein having a first delivery domain and a second protein precursor domain linked together via a linker sequence. The delivery domain is a protein capable of facilitating entry to a target cells via the endocytotic pathway, such as transferrin. The protein precursor is a prohormone or a profactor, such as proinsulin. Methods of this invention include the steps of selecting a protein suitable as the delivery domain, constructing a vector to encode the fusion protein, and expressing the fusion protein in a suitable expression host. Also disclosed is a method for targeted-delivery of prodrugs to livers and a method of reducing hepatic glucose production. |
| FILED | Monday, May 21, 2012 |
| APPL NO | 13/476812 |
| ART UNIT | 1646 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/28 (20130101) A61K 47/644 (20170801) Peptides C07K 14/62 (20130101) C07K 14/79 (20130101) C07K 19/00 (20130101) Original (OR) Class C07K 2319/00 (20130101) C07K 2319/31 (20130101) C07K 2319/33 (20130101) C07K 2319/74 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513587 | Ma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | The Regents of the University of Michigan (Ann Arbor, Michigan) |
| INVENTOR(S) | Peter X. Ma (Ann Arbor, Michigan); Sen Hou (Beijing, China PRC) |
| ABSTRACT | A self-integrating hydrogel includes a water-soluble polymer. The water-soluble polymer includes a repeating unit having at least one functional group that includes an oxygen atom, a sulfur atom, or a nitrogen atom, and a pendant chain covalently attached to the oxygen atom, the sulfur atom, or the nitrogen atom of the at least one functional group of the repeating unit. The pendant chain includes ureido-pyrimidinone. |
| FILED | Friday, September 29, 2017 |
| APPL NO | 15/720430 |
| ART UNIT | 1613 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/28 (20130101) A61K 35/32 (20130101) Heterocyclic Compounds C07D 239/47 (20130101) Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 271/02 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 3/24 (20130101) C08J 3/075 (20130101) Original (OR) Class C08J 2205/022 (20130101) C08J 2301/02 (20130101) C08J 2305/02 (20130101) C08J 2305/08 (20130101) C08J 2329/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513688 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Cincinnati (Cincinnati, Ohio) |
| ASSIGNEE(S) | University of Cincinnati (Cincinnati, Ohio) |
| INVENTOR(S) | Yi-Gang Wang (Cincinnati, Ohio); Ha Won Kim (Cincinnati, Ohio); Ruilian Ma (Cincinnati, Ohio) |
| ABSTRACT | Methods of generating cardiomyocytes from induced pluripotent stem cells (IPSCs) are provided. More specifically, the present disclosure relates to methods of generating cardiomyocytes from iPSCs using electrical stimulation. In some aspects, uses of such cells for therapeutics and in methods of treatment are provided. |
| FILED | Monday, December 11, 2017 |
| APPL NO | 15/837366 |
| ART UNIT | 1632 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/34 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0657 (20130101) Original (OR) Class C12N 5/0696 (20130101) C12N 2506/45 (20130101) C12N 2529/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513692 | Kawaoka et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (WARF) (Madison, Wisconsin) |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (“WARF”) (Madison, Wisconsin) |
| INVENTOR(S) | Yoshihiro Kawaoka (Middleton, Wisconsin); Gabriele Neumann (Madison, Wisconsin); Makoto Ozawa (Kagoshima, Japan) |
| ABSTRACT | The invention provides a recombinant biologically contained influenza virus that is a PB2 knockout virus, e.g., one that is useful to generate a multivalent vaccine, and methods of making and using that virus. |
| FILED | Wednesday, April 29, 2015 |
| APPL NO | 14/699213 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/76 (20130101) A61K 39/0011 (20130101) A61K 39/12 (20130101) A61K 39/092 (20130101) A61K 39/145 (20130101) A61K 2039/70 (20130101) A61K 2039/543 (20130101) A61K 2039/5252 (20130101) A61K 2039/5254 (20130101) A61K 2039/5256 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) Original (OR) Class C12N 2760/16121 (20130101) C12N 2760/16134 (20130101) C12N 2760/16143 (20130101) C12N 2760/16151 (20130101) C12N 2760/16171 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56983 (20130101) G01N 2333/11 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513702 | Kennedy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California) |
| INVENTOR(S) | Andrew Bodnar Kennedy (Sunnyvale, California); Christina D. Smolke (Menlo Park, California) |
| ABSTRACT | A ligand-responsive hammerhead ribozyme is provided. In some embodiments, the ribozyme comprises: i. a first loop that has been replaced by an RNA aptamer that binds to a ligand; and ii. a second loop comprising a modified sequence, wherein the aptamer and the second loop interact in a ligand-dependent manner and autocatalytic cleavage of the ribozyme is ligand-responsive. |
| FILED | Friday, June 17, 2016 |
| APPL NO | 15/737687 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/63 (20130101) C12N 15/111 (20130101) C12N 15/113 (20130101) Original (OR) Class C12N 15/115 (20130101) C12N 2310/16 (20130101) C12N 2310/121 (20130101) C12N 2310/531 (20130101) C12N 2310/3519 (20130101) C12N 2330/31 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513706 | Romesberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Scripps Research Institute (La Jolla, California) |
| ASSIGNEE(S) | The Scripps Research Institute (La Jolla, California) |
| INVENTOR(S) | Floyd E. Romesberg (La Jolla, California); Denis A. Malyshev (La Jolla, California) |
| ABSTRACT | A recombinantly expressed nucleotide triphosphate transporter efficiently imports the triphosphates of unnatural nucleotides into cells, and the endogenous cellular machinery incorporates those nucleotides into cellular nucleic acids. UBPs can therefore form within the cell's nucleic acids. Moreover, neither the presence of the unnatural triphosphates nor the replication of the UBP represents a significant growth burden. The UBP is not efficiently excised by nucleic acid repair pathways, and therefore can be retained as long as the unnatural triphosphates are available in the growth medium. Thus, the resulting cell is the first organism to stably propagate an expanded genetic alphabet. |
| FILED | Thursday, April 09, 2015 |
| APPL NO | 15/302874 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Peptides C07K 14/295 (20130101) C07K 14/405 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/70 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513710 | Khvorova et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Massachusetts (Boston, Massachusetts) |
| ASSIGNEE(S) | University of Massachusetts (Boston, Massachusetts) |
| INVENTOR(S) | Anastasia Khvorova (Westborough, Massachusetts); Neil Aronin (Newtonville, Massachusetts); Marie Cecile Didiot (Worcester, Massachusetts); Reka Haraszti (Tubingen, Germany) |
| ABSTRACT | In one aspect, the invention relates to a method of loading exosomes with oligonucleotide cargo, by incubating an oligonucleotide comprising one or more hydrophobic modifications with a population of exosomes for a period of time sufficient to allow loading of the exosomes with the oligonucleotide. Exosomes loaded with hydrophobic ally modified oligonucleotide cargo, and uses thereof, are also provided. |
| FILED | Friday, April 17, 2015 |
| APPL NO | 15/304943 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 2267/0337 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/88 (20130101) Original (OR) Class C12N 15/1137 (20130101) C12N 2310/11 (20130101) C12N 2310/14 (20130101) C12N 2310/141 (20130101) C12N 2310/311 (20130101) C12N 2310/313 (20130101) C12N 2310/315 (20130101) C12N 2310/321 (20130101) C12N 2310/322 (20130101) C12N 2310/351 (20130101) C12N 2310/531 (20130101) C12N 2310/3181 (20130101) C12N 2310/3231 (20130101) C12N 2310/3515 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513719 | Buller et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | THE CALIFORNIA INSTITUTE OF TECHNOLOGY (Pasadena, California) |
| INVENTOR(S) | Andrew Richard Buller (Pasadena, California); Sabine Brinkmann-Chen (Alhambra, California); Michael Herger (Pasadena, California); David K. Romney (Pasadena, California); Javier Murciano Calles (Ubeda Jaen, Spain); Paul van Roye (Darmstadt, Germany) |
| ABSTRACT | This disclosure relates to modified tryptophan synthase and more particularly to modified beta-subunits of tryptophan synthase. The disclosure further relates to cells expressing such modified subunits and methods of producing non-canonical amino acids. |
| FILED | Friday, April 08, 2016 |
| APPL NO | 15/094458 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/88 (20130101) Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 13/04 (20130101) C12P 13/227 (20130101) Original (OR) Class Enzymes C12Y 402/0102 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513802 | Omenetto et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Tufts University (Medford, Massachusetts) |
| ASSIGNEE(S) | Tufts University (Medford, Massachusetts) |
| INVENTOR(S) | Fiorenzo G. Omenetto (Lexington, Massachusetts); David L. Kaplan (Concord, Massachusetts); Benedetto Marelli (Lexington, Massachusetts); Alexander Nicholas Mitropoulos (Winchester, Massachusetts) |
| ABSTRACT | Disclosed herein are nanofibrillar materials and aerogel-like materials comprised of nanofibrils, and methods for making such materials. |
| FILED | Friday, November 07, 2014 |
| APPL NO | 15/034983 |
| ART UNIT | 1786 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 27/56 (20130101) A61L 27/227 (20130101) A61L 27/3604 (20130101) A61L 2400/12 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Peptides C07K 14/78 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 9/28 (20130101) C08J 2205/022 (20130101) C08J 2207/10 (20130101) C08J 2389/02 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/26 (20130101) C12Q 1/28 (20130101) Chemical Features in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons; Apparatus Specially Adapted for the Manufacture of Carbon Filaments D01F 4/00 (20130101) D01F 4/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514347 | Yu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF MARYLAND, BALTIMORE (Baltimore, Maryland) |
| ASSIGNEE(S) | University of Maryland, Baltimore (Baltimore, Maryland) |
| INVENTOR(S) | Yihua Bruce Yu (Ellicott City, Maryland); Marc Taraban (Gaithersburg, Maryland); Yue Feng (Niantic, Connecticut) |
| ABSTRACT | The present invention generally relates to a method of using NMR relaxation rates (R2) of water molecules as an indicator of the extent of aggregation of biopharmaceutical formulations. The biopharmaceutical can be evaluated nondestructively without the vial or container being opened or protective seal compromised (i.e., broken). The method is applicable to all biopharmaceuticals and the water signal obtained by magnetic resonance relaxometry is very strong and sensitive because water is used as the solvent and is present in high (>90%) concentrations in every biopharmaceutical formulation. |
| FILED | Friday, March 29, 2019 |
| APPL NO | 16/369534 |
| ART UNIT | 2852 — Printing/Measuring and Testing |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 24/08 (20130101) Original (OR) Class G01N 33/15 (20130101) Measuring Electric Variables; Measuring Magnetic Variables G01R 33/50 (20130101) G01R 33/448 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514366 | Bailey et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BOARD OF TRUSTEES OF THE UNIVERSITY OF ILLINOIS (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Ryan C. Bailey (Urbana, Illinois); James H. Wade (Champaign, Illinois) |
| ABSTRACT | A liquid chromatograph comprising a column coupled to a microring resonator array and methods of using the same are disclosed. The microring resonator array measures the bulk refractive index of the mobile phase and any sample injected onto and separated in the column. While carrying out the methods, the composition of a mobile phase passing through the chromatography column may remain substantially constant (isocratic elution) or it may vary (gradient elution). One or more microrings may comprise a covering to act as a thermal control. In addition, the sensor surface may be modified with some type of capture agent that can interact with one or more components in the sample. |
| FILED | Thursday, September 03, 2015 |
| APPL NO | 15/508960 |
| ART UNIT | 2861 — Printing/Measuring and Testing |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/4133 (20130101) G01N 30/74 (20130101) Original (OR) Class G01N 2021/414 (20130101) G01N 2021/7789 (20130101) G01N 2030/027 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514380 | Takulapalli |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Bharath Takulapalli (Chandler, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Bharath Takulapalli (Chandler, Arizona) |
| ABSTRACT | The present disclosure provides an improved field effect transistor and device that can be used to sense and characterize a variety of materials. The field effect transistor and/or device including the transistor may be used for a variety of applications, including genome sequencing, protein sequencing, biomolecular sequencing, and detection of ions, molecules, chemicals, biomolecules, metal atoms, polymers, nanoparticles and the like. |
| FILED | Monday, May 16, 2016 |
| APPL NO | 15/156213 |
| ART UNIT | 2893 — Semiconductors/Memory |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6874 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/414 (20130101) G01N 27/4145 (20130101) G01N 27/4146 (20130101) G01N 33/552 (20130101) G01N 33/48721 (20130101) G01N 33/54366 (20130101) G01N 33/54373 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/30604 (20130101) H01L 29/0665 (20130101) H01L 29/0692 (20130101) H01L 29/1054 (20130101) H01L 29/66666 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514381 | Chiu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington through its Center for Commercialization (Seattle, Washington) |
| ASSIGNEE(S) | UNIVERSITY OF WASHINGTON THROUGH ITS CENTER FOR COMMERCIALIZATION (Seattle, Washington) |
| INVENTOR(S) | Daniel T. Chiu (Seattle, Washington); Wei Sun (Seattle, Washington); Jiangbo Yu (Seattle, Washington); Changfeng Wu (Changchun, China PRC); Fangmao Ye (Seattle, Washington) |
| ABSTRACT | Lyophilized chromophoric polymer dot compositions are provided. Also disclosed are methods of making and using the lyophilized compositions, methods of dispersing the lyophilized compositions in aqueous solutions and kits supplying the compositions. |
| FILED | Friday, March 14, 2014 |
| APPL NO | 14/774971 |
| ART UNIT | 1641 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 61/02 (20130101) C08G 73/00 (20130101) C08G 75/32 (20130101) C08G 2261/11 (20130101) C08G 2261/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/533 (20130101) G01N 33/582 (20130101) G01N 33/588 (20130101) G01N 33/54393 (20130101) Original (OR) Class G01N 2650/00 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/2982 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514384 | Kleinfeld et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alan Kleinfeld (La Jolla, California) |
| ASSIGNEE(S) | Alan Kleinfeld (La Jolla, California) |
| INVENTOR(S) | Alan Marc Kleinfeld (La Jolla, California); Andrew Henry Huber (Encinitas, California); James Patrick Kampf (San Diego, California); Thomas Kwan (San Diego, California); Baolong Zhu (San Diego, California) |
| ABSTRACT | A method for high throughput discovery of proteins fluorescently labeled at a cysteine residue and that undergo a change in fluorescence ratio at 2 wavelengths upon binding an unbound analyte is described. Probes are disclosed which are labeled at a cysteine residue and also probes labeled at both cysteine and lysine with two different fluorophores. These probes are useful for characterization and measurement of hydrophobic species in a fluid sample, particularly characterization and measurement of levels of unbound free fatty acids. A profile of unbound free fatty acids can be determined for an individual which can be used to determine the individual's relative risk for disease. |
| FILED | Friday, September 29, 2017 |
| APPL NO | 15/720260 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Peptides C07K 14/00 (20130101) C07K 14/47 (20130101) Combinatorial Chemistry; Libraries, e.g Chemical Libraries C40B 30/04 (20130101) C40B 40/10 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/68 (20130101) G01N 33/92 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516470 | Ma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Yunfei Ma (Santa Clara, California); Nicholas Selby (Cambridge, Massachusetts); Fadel Adib (Cambridge, Massachusetts) |
| ABSTRACT | A method may comprise relaying a wireless signal via a bi-directional, full-duplex relay. The relay may comprise an analog uplink relay and an analog downlink relay, and may relay signals between a transmitter and a backscatter node. The spectrum of the downlink signal transmitted by the downlink relay may be different than the spectrum of the uplink signal received by the uplink relay. Filtering may attenuate leakage from the downlink relay to the uplink relay, and vice versa. The uplink relay may create a phase offset that is opposite in sign and substantially equal in magnitude to the phase offset created by the downlink relay. The downlink and uplink relays, taken together, may create a substantially constant net phase offset. The full-duplex relay may be housed in a vehicle that moves, and may be used to determine spatial coordinates of backscatter sources that are located in the relay's environment. |
| FILED | Wednesday, July 03, 2019 |
| APPL NO | 16/503105 |
| ART UNIT | 2688 — Dynamic Storage Systems; Mechanical parts of Disk Drives |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 19/067 (20130101) Transmission H04B 7/145 (20130101) Original (OR) Class H04B 7/15564 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516946 | Puria et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | EarLens Corporation (Menlo Park, California) |
| ASSIGNEE(S) | Earlens Corporation (Menlo Park, California) |
| INVENTOR(S) | Sunil Puria (Boston, Massachusetts); Micha Rosen (Tzur Hadassah, Israel); Jonathan P. Fay (Dexter, Michigan); Paul Rucker (San Francisco, California); James Stone (Saratoga, California) |
| ABSTRACT | A device to transmit an audio signal to a user comprises a transducer and a support. The support is configured for placement on the eardrum to drive the eardrum. The transducer is coupled to the support at a first location to decrease occlusion and a second location to drive the eardrum. The transducer may comprise one or more of an electromagnetic balanced armature transducer, a piezoelectric transducer, a magnetostrictive transducer, a photostrictive transducer, or a coil and magnet. The device may find use with open canal hearing aids. |
| FILED | Friday, September 15, 2017 |
| APPL NO | 15/706208 |
| ART UNIT | 3791 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Loudspeakers, Microphones, Gramophone Pick-ups or Like Acoustic Electromechanical Transducers; Deaf-aid Sets; Public Address Systems H04R 11/02 (20130101) Original (OR) Class H04R 17/00 (20130101) H04R 23/008 (20130101) H04R 25/02 (20130101) H04R 25/65 (20130101) H04R 25/554 (20130101) H04R 25/606 (20130101) H04R 25/652 (20130101) H04R 2225/025 (20130101) H04R 2460/09 (20130101) H04R 2460/13 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Science Foundation (NSF)
| US 10512774 | Dixon et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| ASSIGNEE(S) | UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INCORPORATED (Gainesville, Florida) |
| INVENTOR(S) | Warren Dixon (Gainesville, Florida); Matthew J. Bellman (Gainesville, Florida) |
| ABSTRACT | Hybrid orthotic devices configured to apply electrical stimulation to one or more body parts of a person are generally described. A hybrid orthotic device may comprise one or more sensors, one or more electrodes, and a controller configured to receive input signals from the one or more sensors and deliver output signals to the one or more electrodes. In certain cases, the controller may be configured to store one or more programs associated with functional activities (e.g., standing, sitting, and/or walking), and the programs may be configured to enable one or more body parts of the person to track a desired trajectory. In some embodiments, a program may implement a Robust Integral of the Sign of the Error (RISE) control method. The program may further implement control methods to compensate for electromechanical delay and/or muscle fatigue. In certain embodiments, a program may further implement neural network (NN)-based methods. |
| FILED | Thursday, December 18, 2014 |
| APPL NO | 15/105149 |
| ART UNIT | 3786 — Body Treatment, Kinestherapy, and Exercising |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 5/0125 (20130101) A61F 5/0127 (20130101) Physical Therapy Apparatus, e.g Devices for Locating or Stimulating Reflex Points in the Body; Artificial Respiration; Massage; Bathing Devices for Special Therapeutic or Hygienic Purposes or Specific Parts of the Body A61H 1/024 (20130101) A61H 3/00 (20130101) A61H 2201/164 (20130101) A61H 2201/5005 (20130101) A61H 2201/5007 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/36003 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513442 | Fulton et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Oregon (Eugene, Oregon); Oregon State University (Corvallis, Oregon) |
| ASSIGNEE(S) | University of Oregon (Eugene, Oregon); Oregon State University (Corvallis, Oregon) |
| INVENTOR(S) | Brantly Fulton (Eugene, Oregon); Milton N. Jackson, Jr. (Eugene, Oregon); Darren W. Johnson (Eugene, Oregon); Shannon W. Boettcher (Eugene, Oregon); Cory K. Perkins (Corvallis, Oregon); Douglas A. Keszler (Eugene, Oregon); James E. Hutchison (Eugene, Oregon) |
| ABSTRACT | A method comprising reacting an aluminum mineral polymorph or a gallium mineral polymorph with an acid at an aluminum metal to acid molar ratio or gallium metal to acid molar ratio sufficient to produce M13 nanoscale clusters, M nano-agglomerates, or a M13 slurry, wherein M is Al or Ga. |
| FILED | Friday, July 08, 2016 |
| APPL NO | 15/742412 |
| ART UNIT | 1736 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) Compounds of the Metals Beryllium, Magnesium, Aluminium, Calcium, Strontium, Barium, Radium, Thorium, or of the Rare-earth Metals C01F 7/20 (20130101) C01F 7/24 (20130101) Original (OR) Class Compounds Containing Metals Not Covered by Subclasses C01D or C01F C01G 15/00 (20130101) Indexing Scheme Relating to Structural and Physical Aspects of Solid Inorganic Compounds C01P 2002/70 (20130101) C01P 2002/82 (20130101) C01P 2004/50 (20130101) C01P 2004/64 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513482 | Sibi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Mukund P. Sibi (Fargo, North Dakota); Selvakumar Sermadurai (Kyoto, Japan); Nicolas Zimmermann (Treillères, France); Eric Serum (Eau Claire, Wisconsin); Gaoyuan Ma (Irvine, California); Ramkumar Moorthy (Saint Paul, Minnesota); Krystal Kalliokoski (Fargo, North Dakota) |
| ASSIGNEE(S) | NDSU RESEARCH FOUNDATION (Fargo, North Dakota) |
| INVENTOR(S) | Mukund P. Sibi (Fargo, North Dakota); Selvakumar Sermadurai (Kyoto, Japan); Nicolas Zimmermann (Treillères, France); Eric Serum (Eau Claire, Wisconsin); Gaoyuan Ma (Irvine, California); Ramkumar Moorthy (Saint Paul, Minnesota); Krystal Kalliokoski (Fargo, North Dakota) |
| ABSTRACT | Compounds derived from biomass, e.g., cellulose and lignins, methods of forming such compounds and polymers and products formed using such compounds. |
| FILED | Friday, August 07, 2015 |
| APPL NO | 15/502653 |
| ART UNIT | 1762 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Acyclic or Carbocyclic Compounds C07C 57/34 (20130101) Original (OR) Class C07C 57/40 (20130101) C07C 59/64 (20130101) C07C 59/84 (20130101) Heterocyclic Compounds C07D 307/54 (20130101) Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 63/065 (20130101) C08G 63/181 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513531 | Toutov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute Of Technology (Pasadena, California) |
| ASSIGNEE(S) | California Institute of Technology (Pasadena, California) |
| INVENTOR(S) | Anton Toutov (Pasadena, California); Kerry Betz (Boulder, Colorado); Alexey Fedorov (Wallisellen, Switzerland); Brian M. Stoltz (San Marino, California); Wenbo Liu (Pasadena, California); Robert H. Grubbs (South Pasadena, California) |
| ABSTRACT | The present disclosure describes novel silylated heteroaromatic derivatives, including those prepared by methods comprising the use of hydrosilanes and at least one strong base, the definition of strong base now also including hydroxide, especially KOH. |
| FILED | Friday, October 12, 2018 |
| APPL NO | 16/159298 |
| ART UNIT | 1766 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Heterocyclic Compounds C07D 209/12 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 7/0801 (20130101) Original (OR) Class C07F 7/0827 (20130101) C07F 7/0832 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513535 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | Xiaojin He (New York City, New York); Ruojie Sha (Basking Ridge, New Jersey); Yongli Mi (Kowloon, China Hong Kong); Paul Chaikin (New York, New York); Nadrian C. Seeman (New York, New York) |
| ABSTRACT | The present invention provides a method for self-replication of multimers of nucleic acid origami tiles by exponentially amplifying the multimer from initial seeds of monomeric units of nucleic acid origami tiles and also provides for the selective exponential amplification of a designated multimer, such as with specific properties or characteristics, over one or more competing multimers in the presence of a mixture of monomers for each of the possible multimers. The selection of the designated multimer based on an environmental change allows the designated multimer to outgrow all competing multimers. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923361 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 21/04 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/11 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6816 (20130101) C12Q 1/6816 (20130101) C12Q 2565/113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513567 | Finn et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | M. G. Finn (Atlanta, Georgia); Jennifer Marie Beveridge (Atlanta, Georgia); Allison Frances Geoghan (Atlanta, Georgia); Zhishuai Geng (Atlanta, Georgia) |
| ABSTRACT | Disclosed are polycationic polymers. The polycationic polymers can include a plurality of positively charged centers, each of which is formed by condensation of cyclic bis-electrophile (e.g., a 9-thia/aza/selenabicyclo[3.3.1]nonyl electrophile) with a nucleophile. The resulting polycationic polymers can efficiently bind nucleic acids. The polycations can also exhibit properties of cytotoxicity and DNA transfection with interesting structure-activity characteristics. |
| FILED | Wednesday, May 31, 2017 |
| APPL NO | 15/610354 |
| ART UNIT | 1764 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 25/10 (20130101) A01N 25/10 (20130101) A01N 33/12 (20130101) A01N 43/40 (20130101) Heterocyclic Compounds C07D 495/08 (20130101) Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 8/32 (20130101) Original (OR) Class C08F 120/60 (20130101) Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 5/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514347 | Yu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF MARYLAND, BALTIMORE (Baltimore, Maryland) |
| ASSIGNEE(S) | University of Maryland, Baltimore (Baltimore, Maryland) |
| INVENTOR(S) | Yihua Bruce Yu (Ellicott City, Maryland); Marc Taraban (Gaithersburg, Maryland); Yue Feng (Niantic, Connecticut) |
| ABSTRACT | The present invention generally relates to a method of using NMR relaxation rates (R2) of water molecules as an indicator of the extent of aggregation of biopharmaceutical formulations. The biopharmaceutical can be evaluated nondestructively without the vial or container being opened or protective seal compromised (i.e., broken). The method is applicable to all biopharmaceuticals and the water signal obtained by magnetic resonance relaxometry is very strong and sensitive because water is used as the solvent and is present in high (>90%) concentrations in every biopharmaceutical formulation. |
| FILED | Friday, March 29, 2019 |
| APPL NO | 16/369534 |
| ART UNIT | 2852 — Printing/Measuring and Testing |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 24/08 (20130101) Original (OR) Class G01N 33/15 (20130101) Measuring Electric Variables; Measuring Magnetic Variables G01R 33/50 (20130101) G01R 33/448 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514366 | Bailey et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BOARD OF TRUSTEES OF THE UNIVERSITY OF ILLINOIS (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Ryan C. Bailey (Urbana, Illinois); James H. Wade (Champaign, Illinois) |
| ABSTRACT | A liquid chromatograph comprising a column coupled to a microring resonator array and methods of using the same are disclosed. The microring resonator array measures the bulk refractive index of the mobile phase and any sample injected onto and separated in the column. While carrying out the methods, the composition of a mobile phase passing through the chromatography column may remain substantially constant (isocratic elution) or it may vary (gradient elution). One or more microrings may comprise a covering to act as a thermal control. In addition, the sensor surface may be modified with some type of capture agent that can interact with one or more components in the sample. |
| FILED | Thursday, September 03, 2015 |
| APPL NO | 15/508960 |
| ART UNIT | 2861 — Printing/Measuring and Testing |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/4133 (20130101) G01N 30/74 (20130101) Original (OR) Class G01N 2021/414 (20130101) G01N 2021/7789 (20130101) G01N 2030/027 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514418 | Deslandes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | FEI Company (Hillsboro, Oregon) |
| ASSIGNEE(S) | FEI Company (Hillsboro, Oregon) |
| INVENTOR(S) | Herve Deslandes (Sunnyvale, California) |
| ABSTRACT | A method for emission testing of a semiconductor device (DUT), by mounting the DUT onto an test bench of an emission tester, the emission tester having an optical detector; electrically connecting the DUT to an electrical tester; applying electrical test signals to the DUT while keeping test parameters constant; inserting an optical filters into an optical path of the emission tester and collecting emission test signal from the optical detector; removing the filter from the optical path and collecting emission test signal from the optical detector. Comparing the images obtained with and without the filter. The filter may be shortpass to obtain emission signal, a bandpass for detecting forward bias, or longpass to obtain thermal signal. |
| FILED | Wednesday, October 05, 2016 |
| APPL NO | 15/286371 |
| ART UNIT | 2866 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/311 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514485 | Kostuk et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Arizona Board of Regents on behalf of The University of Arizona (Tucson, Arizona) |
| ASSIGNEE(S) | Arizona Board of Regents on Behalf of the University of Arizona (Tucson, Arizona) |
| INVENTOR(S) | Raymond K. Kostuk (Tucson, Arizona); Shelby D. Vorndran (Tucson, Arizona); Deming Zhang (Gilbert, Arizona); Juan Manuel Russo (Tucson, Arizona); Michael Gordon (Tucson, Arizona) |
| ABSTRACT | An apparatus for obtaining energy from a polychromatic energy source that emits radiation in a first and a second wavelength band comprises a reflector or an energy receiver having an aperture therein; and a holographic lens that diffracts and focuses the radiation within the first wavelength band from the energy source through said aperture towards a first energy receiver, and transmits the radiation within the second wavelength band from the energy source to the reflector or energy receiver. If a reflector is used, the reflector reflects the radiation transmitted by the holographic lens towards a second energy receiver. |
| FILED | Tuesday, November 05, 2013 |
| APPL NO | 14/072443 |
| ART UNIT | 1721 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Horticulture; Cultivation of Vegetables, Flowers, Rice, Fruit, Vines, Hops or Seaweed; Forestry; Watering A01G 33/00 (20130101) New Plants or Processes for Obtaining Them; Plant Reproduction by Tissue Culture Techniques A01H 3/02 (20130101) Apparatus for Enzymology or Microbiology; C12M 21/02 (20130101) C12M 31/06 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/12 (20130101) C12N 13/00 (20130101) Solar Heat Collectors; Solar Heat Systems F24S 23/00 (20180501) Optical Elements, Systems, or Apparatus G02B 5/32 (20130101) Original (OR) Class G02B 19/0042 (20130101) G02B 27/1086 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 31/0549 (20141201) Generation of Electric Power by Conversion of Infra-red Radiation, Visible Light or Ultraviolet Light, e.g Using Photovoltaic [PV] Modules H02S 40/22 (20141201) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/44 (20130101) Y02E 10/52 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 60/12 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514509 | Popovic et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Colorado (Denver, Colorado); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | The Regents of the University of Colorado, a Body Corporate (Denver, Colorado); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Milos Popovic (Boulder, Colorado); Vladimir Marko Stojanovic (Berkeley, California); Jason Scott Orcutt (Katonah, New York) |
| ABSTRACT | An optical coupler has a waveguide coupled to a grating of multiple scattering units, each scattering unit having a first scattering element formed of a shape in a polysilicon gate layer and a second scattering element formed of a shape in a body silicon layer of a metal-oxide-semiconductor (MOS) integrated circuit (IC). The couplers may be used in a system having a coupler on each of a first and second IC, infrared light being formed into a beam passing between the couplers. Vias may be interposed in third ICs between the first and second ICs. The couplers may be configured with nonuniform width of scattering elements to produce Gaussian or focused beams. |
| FILED | Friday, January 10, 2014 |
| APPL NO | 14/152898 |
| ART UNIT | 2883 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/34 (20130101) Original (OR) Class G02B 6/124 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514585 | Geiger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northwestern University (Evanston, Illinois); Battelle Memorial Institute (Columbus, Ohio); The Trustees of Columbia University in the City of New York (New York, New York) |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois); Battelle Memorial Institute (Columbus, Ohio); The Trustees of Columbia University in the City of New York (, New York) |
| INVENTOR(S) | Franz M. Geiger (Evanston, Illinois); Paul E. Ohno (Evanston, Illinois); Hong-fei Wang (Richland, Washington); Kenneth B. Eisenthal (New York City, New York) |
| ABSTRACT | An apparatus for probing an interface via second harmonic generation (SHG) spectroscopy is provided. The apparatus comprises a sample cell comprising a noncentrosymmetric material having a selected orientation angle with respect to a reference axis; optics configured to illuminate an interface formed between the noncentrosymmetric material and a different material, or formed between two different materials and disposed over the noncentrosymmetric material, with light having a frequency ω under conditions to generate a second harmonic generation (SHG) signal having frequency 2ω; a detector configured to detect the SHG signal, the SHG signal comprising a bulk second harmonic signal from the noncentrosymmetric material and an interfacial second harmonic signal from the interface; and a device comprising a processor and a computer-readable medium operably coupled to the processor, the computer-readable medium having computer-readable instructions stored thereon that, when executed by the processor, cause the apparatus to: illuminate the interface to generate the SHG signal and detect the SHG signal. |
| FILED | Tuesday, March 12, 2019 |
| APPL NO | 16/299383 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/84 (20130101) G01N 21/636 (20130101) G01N 21/8422 (20130101) Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/35 (20130101) G02F 1/37 (20130101) G02F 1/355 (20130101) G02F 1/377 (20130101) G02F 1/3532 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514586 | Tzang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Colorado, a body corporate (Denver, Colorado) |
| ASSIGNEE(S) | The Regents of the University of Colorado, a body corporate (Denver, Colorado) |
| INVENTOR(S) | Omer Tzang (Boulder, Colorado); Rafael Piestun (Boulder, Colorado); Antonio Miguel Caravaca-Aguirre (Boulder, Colorado); Kelvin Wagner (Boulder, Colorado) |
| ABSTRACT | Recent remarkable progress in wave-front shaping has enabled control of light propagation inside linear media to focus and image through scattering objects. In particular, light propagation in multimode fibers comprises complex intermodal interactions and rich spatiotemporal dynamics. Control of physical phenomena in multimode fibers and its applications is in its infancy, opening opportunities to take advantage of complex mode interactions. Various embodiments of the present technology provide wave-front shaping for controlling nonlinear phenomena in multimode fibers. Using a spatial light modulator at the fiber's input and a genetic algorithm optimization, some embodiments control a highly nonlinear stimulated Raman scattering cascade and its interplay with four wave mixing via a flexible implicit control on the superposition of modes that are coupled into the fiber. |
| FILED | Wednesday, July 18, 2018 |
| APPL NO | 16/039156 |
| ART UNIT | 2883 — Optics |
| CURRENT CPC | Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/365 (20130101) Original (OR) Class G02F 1/3501 (20130101) G02F 1/3536 (20130101) G02F 2201/02 (20130101) G02F 2201/05 (20130101) G02F 2201/58 (20130101) G02F 2203/26 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514805 | Li |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | AITECH, LLC (Buffalo Grove, Illinois) |
| ASSIGNEE(S) | AITECH, LLC (Buffalo Grove, Illinois) |
| INVENTOR(S) | Dong Ge Li (Hoffman Estates, Illinois) |
| ABSTRACT | A method and apparatus for inputting data for an electronic data entry device are provided. In one embodiment, identification of an input object such as the particular fingers of a user that are used to actuate a key region is performed. The symbol associated with the actuated key region and the finger (or other input object) used is determined. In other embodiments, virtual input devices with interfaces such as QWERTY style keyboards, phone keypads, and multi-touch capable touchpads or tablets are provided in input regions. One or more video capturing devices remotely acquire actuation information from the input regions during data entry. User inputted symbols or functions are determined based on the actuations, their locations and identified input object sets that caused the actuations. |
| FILED | Thursday, August 24, 2017 |
| APPL NO | 15/685655 |
| ART UNIT | 2412 — Multiplex and VoIP |
| CURRENT CPC | Electric Digital Data Processing G06F 3/0423 (20130101) Original (OR) Class G06F 3/04883 (20130101) G06F 3/04886 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514973 | Milor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | Linda Milor (Atlanta, Georgia); Taizhi Liu (Atlanta, Georgia); Chang-Chih Chen (Atlanta, Georgia) |
| ABSTRACT | Aspects of the disclosed technology include a method including extracting, by a processor, a plurality of features from one from among a layout of a circuit, a netlist of the circuit, and the layout and the netlist of the circuit; computing, by the processor, respective lifetime distributions of the plurality of extracted features based on at least one circuit profile; and estimating, by the processor, a lifetime of the circuit by combining the respective lifetime distributions of the plurality of extracted features. |
| FILED | Wednesday, March 01, 2017 |
| APPL NO | 15/446799 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 11/008 (20130101) G06F 11/073 (20130101) G06F 11/079 (20130101) Original (OR) Class G06F 17/5022 (20130101) G06F 17/5036 (20130101) Static Stores G11C 29/02 (20130101) G11C 29/24 (20130101) G11C 29/70 (20130101) G11C 29/12005 (20130101) G11C 29/50004 (20130101) G11C 29/50016 (20130101) G11C 2029/1208 (20130101) G11C 2029/3602 (20130101) G11C 2029/5002 (20130101) G11C 2029/5004 (20130101) G11C 2029/5006 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515149 | Herr et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BLACKBOILER LLC (Arlington, Virginia) |
| ASSIGNEE(S) | BLACKBOILER, LLC (Arlington, Virginia) |
| INVENTOR(S) | Jonathan Herr (Washington, District of Columbia); Daniel Edward Simonson (Arlington, Virginia); Daniel P. Broderick (Arlington, Virginia) |
| ABSTRACT | A method for suggesting revisions to a document-under-analysis from a seed database, the seed database including a plurality of original texts each respectively associated with one of a plurality of final texts, the method for suggesting revisions including selecting a statement-under-analysis (“SUA”), selecting a first original text of the plurality of original texts, determining a first edit-type classification of the first original text with respect to its associated final text, generating a first similarity score for the first original text based on the first edit-type classification, the first similarity score representing a degree of similarity between the SUA and the first original text, selecting a second original text of the plurality of original texts, determining a second edit-type classification of the second original text with respect to its associated final text, generating a second similarity score for the second original text based on the second edit-type classification, the second similarity score representing a degree of similarity between the SUA and the second original text, selecting a candidate original text from one of the first original text and the second original text, and creating an edited SUA (“ESUA”) by modifying a copy of the first SUA consistent with a first candidate final text associated with the first candidate original text. |
| FILED | Friday, March 22, 2019 |
| APPL NO | 16/361781 |
| ART UNIT | 2144 — Graphical User Interface and Document Processing |
| CURRENT CPC | Electric Digital Data Processing G06F 16/35 (20190101) G06F 16/36 (20190101) G06F 16/383 (20190101) G06F 17/241 (20130101) G06F 17/274 (20130101) Original (OR) Class G06F 17/2755 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515483 | Dandekar et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Drexel University (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | Drexel University (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Kapil R. Dandekar (Philadelphia, Pennsylvania); Cem Sahin (Philadelphia, Pennsylvania); Logan J. Henderson (Philadelphia, Pennsylvania); Danh H. Nguyen (Philadelphia, Pennsylvania); James J. Chacko (Huntingdon Valley, Pennsylvania); Xaime Rivas Rey (Philadelphia, Pennsylvania) |
| ABSTRACT | Presenting a visualization of antenna radiation patterns may include sending a request to a server for up-to-date information regarding an antenna mode; receiving the request at the server and reading a register value for the antenna mode; responding, by the server, with updated antenna mode information; and overlaying antenna radiation patterns on an image based on the mode information. |
| FILED | Thursday, December 01, 2016 |
| APPL NO | 15/780391 |
| ART UNIT | 2611 — Computer Graphic Processing, 3D Animation, Display Color Attribute, Object Processing, Hardware and Memory |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 29/10 (20130101) Electric Digital Data Processing G06F 3/04847 (20130101) Image Data Processing or Generation, in General G06T 19/006 (20130101) Original (OR) Class Transmission H04B 17/336 (20150115) H04B 17/345 (20150115) Transmission of Digital Information, e.g Telegraphic Communication H04L 41/22 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515736 | Milliron et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| INVENTOR(S) | Delia Milliron (Austin, Texas); Byung Hyo Kim (Austin, Texas) |
| ABSTRACT | Disclosed herein are nanostructured conducting films. The nanostructured conducting films can comprise a nanocrystal phase comprising a plurality of nanocrystals comprising a first metal chalcogenide, the nanocrystal phase being dispersed within a continuous phase comprising a second metal chalcogenide, and wherein the nanocrystal phase, the continuous phase, or a combination thereof further comprises a dopant. In some examples, the first metal chalcogenide and/or the second metal chalcogenide comprise a metal oxide. Also disclosed herein are transparent conducting oxide films having heterogeneous dopant distributions, the films having high mobility, good conductivity, or combinations thereof. Also described herein are methods of making and methods of use of the nanostructured conducing films described herein. |
| FILED | Tuesday, December 13, 2016 |
| APPL NO | 15/377089 |
| ART UNIT | 1765 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 26/00 (20130101) Electric Digital Data Processing G06F 3/041 (20130101) G06F 2203/04103 (20130101) Cables; Conductors; Insulators; Selection of Materials for Their Conductive, Insulating or Dielectric Properties H01B 1/16 (20130101) Original (OR) Class H01B 5/14 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 31/022466 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515749 | Noyes et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Florida State University Research Foundation, Inc. (Tallahassee, Florida) |
| ASSIGNEE(S) | The Florida State University Research Foundation, Inc. (Tallahassee, Florida) |
| INVENTOR(S) | Patrick D. Noyes (Tallahassee, Florida); Kikelomo Ijagbemi (Tallahassee, Florida) |
| ABSTRACT | A protection system capable of safely quenching a high temperature superconductor (HTS) magnet coil. The protection circuit provides for a frequency loss induced quench design that advances the protection technology for HTS magnet coils and provides a protection system that is capable of quickly distributing the heat energy uniformly in all the coil sections when a localized hot-spot is created. |
| FILED | Monday, October 22, 2018 |
| APPL NO | 16/167068 |
| ART UNIT | 2836 — Electrical Circuits and Systems |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 33/3815 (20130101) Magnets; Inductances; Transformers; Selection of Materials for Their Magnetic Properties H01F 6/02 (20130101) Original (OR) Class H01F 6/04 (20130101) H01F 6/06 (20130101) Emergency Protective Circuit Arrangements H02H 7/001 (20130101) H02H 9/023 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 40/68 (20130101) Y02E 40/69 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515782 | Donnelly et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Houston System (Houston, Texas) |
| ASSIGNEE(S) | UNIVERSITY OF HOUSTON SYSTEM (Houston, Texas) |
| INVENTOR(S) | Vincent M. Donnelly (Houston, Texas); Demetre J. Economou (Houston, Texas) |
| ABSTRACT | A system and method for rapid atomic layer etching (ALET) including a pulsed plasma source, with a spiral coil electrode, a cooled Faraday shield, a counter electrode disposed at the top of the tube, a gas inlet and a reaction chamber including a substrate support and a boundary electrode. The method includes positioning an etchable substrate in a plasma etching chamber, forming a product layer on the surface of the substrate, removing a portion of the product layer by pulsing a plasma source, then repeating the steps of forming a product layer and removing a portion of the product layer to form an etched substrate. |
| FILED | Tuesday, April 10, 2018 |
| APPL NO | 15/949274 |
| ART UNIT | 1716 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 37/32036 (20130101) H01J 37/32045 (20130101) H01J 37/32082 (20130101) H01J 37/32146 (20130101) H01J 37/32174 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/30655 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516098 | Sayed et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| INVENTOR(S) | Shehrin Sayed (West Lafayette, Indiana); Vinh Quang Diep (Santa Clara, California); Kerem Y Camsari (Lafayette, Indiana); Supriyo Datta (West Lafayette, Indiana) |
| ABSTRACT | A switching device is disclosed. The switching device includes a spin-orbit coupling (SOC) layer, a pure spin conductor (PSC) layer disposed atop the SOC layer, a ferromagnetic (FM) layer disposed atop the PSC layer, and a normal metal (NM) layer sandwiched between the PSC layer and the FM layer. The PSC layer is a ferromagnetic insulator (FMI) is configured to funnel spins from the SOC layer onto the NM layer and to further provide a charge insulation so as to substantially eliminate current shunting from the SOC layer while allowing spins to pass through. The NM layer is configured to funnel spins from the PSC layer into the FM layer. |
| FILED | Friday, December 22, 2017 |
| APPL NO | 15/852371 |
| ART UNIT | 2897 — Semiconductors/Memory |
| CURRENT CPC | Magnets; Inductances; Transformers; Selection of Materials for Their Magnetic Properties H01F 10/329 (20130101) H01F 10/3286 (20130101) H01F 41/302 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 43/04 (20130101) Original (OR) Class H01L 43/06 (20130101) H01L 43/10 (20130101) H01L 43/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516140 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PIXELLIGENT TECHNOLOGIES, LLC (Baltimore, Maryland) |
| ASSIGNEE(S) | PIXELLIGENT TECHNOLOGIES, LLC (Baltimore, Maryland) |
| INVENTOR(S) | Zhiyun Chen (Rockville, Maryland); Gregory D. Cooper (Fulton, Maryland) |
| ABSTRACT | Light-emitting devices and methods of making the same are described whereby lenses of any array include a material with a higher refractive index than an encapsulation layer of a substrate layer, the refractive index of the material being in a range of greater than 1.7 to 1.9 at 400 nm. The material forming the lenses includes nanocomposite comprised of inorganic nanocrystals and a polymeric matrix, wherein the nanocrystals are selected from the group consisting of ZrO2, ZnO, MgO, HfO2, NbO5, Ta2O5 and Y2O3. A 3-4 micron thick sample of the nanocomposite has an optical transmittance of at least 80% over a range of 440 nm to 800 nm. |
| FILED | Tuesday, June 26, 2018 |
| APPL NO | 16/019300 |
| ART UNIT | 2811 — Semiconductors/Memory |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 3/0056 (20130101) G02B 3/0087 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/3211 (20130101) H01L 27/3244 (20130101) H01L 51/5253 (20130101) H01L 51/5275 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516378 | Morgan |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Associated Universities, Inc. (Washington, District of Columbia) |
| ASSIGNEE(S) | Associated Universities, Inc. (Washington, District of Columbia) |
| INVENTOR(S) | Matthew A. Morgan (Earlysville, Virginia) |
| ABSTRACT | Reflectionless low-pass, high-pass, band-pass, band-stop, all-pass, all-stop, and multi-band filters, as well as a method for designing such filters is disclosed, along with a method of enhancing the performance of such filters through the use of unmatched sub-networks to realize an optimal frequency response, such as the Chebyshev equal-ripple response. These filters preferably function by absorbing the stop-band portion of the spectrum rather than reflecting it back to the source, which has significant advantages in many different applications. The unmatched sub-networks preferably offer additional degrees of freedom by which element values can be assigned to realize improved cutoff sharpness, stop-band rejection, or other measures of performance. |
| FILED | Tuesday, April 02, 2019 |
| APPL NO | 16/373025 |
| ART UNIT | 2842 — Electrical Circuits and Systems |
| CURRENT CPC | Magnets; Inductances; Transformers; Selection of Materials for Their Magnetic Properties H01F 38/14 (20130101) H01F 2038/143 (20130101) Waveguides; Resonators, Lines, or Other Devices of the Waveguide Type H01P 1/201 (20130101) H01P 1/207 (20130101) Impedance Networks, e.g Resonant Circuits; Resonators H03H 7/06 (20130101) Original (OR) Class H03H 7/38 (20130101) H03H 7/42 (20130101) H03H 7/46 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516396 | Coole et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| ASSIGNEE(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| INVENTOR(S) | James R. Coole (Gainesville, Florida); Gregory M. Stitt (Gainesville, Florida) |
| ABSTRACT | An overlay architecture and an associated method that uses datapath merging to provide minimal-overhead support for multiple source netlists, and optionally provides an adjustable amount of flexibility through a secondary interconnect network is disclosed. |
| FILED | Friday, April 28, 2017 |
| APPL NO | 15/582342 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 13/4022 (20130101) Pulse Technique H03K 19/1731 (20130101) H03K 19/17728 (20130101) H03K 19/17736 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516452 | Pekoz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Berker Pekoz (Tampa, Florida); Mohammed Hafez (Lutz, Florida); Selcuk Kose (Tampa, Florida); Huseyin Arslan (Tampa, Florida) |
| ASSIGNEE(S) | University of South Florida (Tampa, Florida) |
| INVENTOR(S) | Berker Pekoz (Tampa, Florida); Mohammed Hafez (Lutz, Florida); Selcuk Kose (Tampa, Florida); Huseyin Arslan (Tampa, Florida) |
| ABSTRACT | A system and method for increasing the capacity of a Multiple-Input Multiple-Output (MIMO) system at desired user's locations and reducing the capacity at locations, other than that of the desired user, while also providing secrecy. Knowing the channel coefficient between each transmitter and receiver antenna pair at the transmitter, the method of the present invention calculates the artificial signal that minimizes the Euclidean distance between the desired and received data symbols if the precoding/combining matrix pair from the set that has the minimum Euclidean distance to the singular value decomposition (SVD) of the channel matrix is used for transmission and reception. The artificial signal may be fed to the precoder, instead of the actual desired data symbols, or may be transmitted directly to reduce computational complexity, power consumption and processing delay if the hardware configuration allows. |
| FILED | Thursday, January 03, 2019 |
| APPL NO | 16/239372 |
| ART UNIT | 2637 — Optical Communications |
| CURRENT CPC | Transmission H04B 7/046 (20130101) Original (OR) Class H04B 7/0417 (20130101) H04B 7/0626 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 1/0042 (20130101) H04L 25/0204 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516470 | Ma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Yunfei Ma (Santa Clara, California); Nicholas Selby (Cambridge, Massachusetts); Fadel Adib (Cambridge, Massachusetts) |
| ABSTRACT | A method may comprise relaying a wireless signal via a bi-directional, full-duplex relay. The relay may comprise an analog uplink relay and an analog downlink relay, and may relay signals between a transmitter and a backscatter node. The spectrum of the downlink signal transmitted by the downlink relay may be different than the spectrum of the uplink signal received by the uplink relay. Filtering may attenuate leakage from the downlink relay to the uplink relay, and vice versa. The uplink relay may create a phase offset that is opposite in sign and substantially equal in magnitude to the phase offset created by the downlink relay. The downlink and uplink relays, taken together, may create a substantially constant net phase offset. The full-duplex relay may be housed in a vehicle that moves, and may be used to determine spatial coordinates of backscatter sources that are located in the relay's environment. |
| FILED | Wednesday, July 03, 2019 |
| APPL NO | 16/503105 |
| ART UNIT | 2688 — Dynamic Storage Systems; Mechanical parts of Disk Drives |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 19/067 (20130101) Transmission H04B 7/145 (20130101) Original (OR) Class H04B 7/15564 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Energy (DOE)
| US 10513436 | Siriwardane et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Department of Energy (Washington, District of Columbia) |
| ASSIGNEE(S) | U.S. Department of Energy (Washington, District of Columbia) |
| INVENTOR(S) | Ranjani Siriwardane (Morgantown, West Virginia); Hanjing Tian (Morgantown, West Virginia) |
| ABSTRACT | Methods, systems and apparatus relate to producing synthesis gas or carbon and hydrogen utilizing a reduced catalyst CuO—Fe2O3. The method comprises introducing CH4; reducing the CuO—Fe2O3 with the introduced CH4, yielding at least a reduced metal catalyst; oxidizing the reduced metal with O2 yielding CuO—Fe2O3; and generating heat that would be used for the hydrogen and carbon or syngas production with the reduced catalyst CuO—Fe2O3. |
| FILED | Monday, December 12, 2016 |
| APPL NO | 15/375692 |
| ART UNIT | 1736 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 23/745 (20130101) Non-metallic Elements; Compounds Thereof; C01B 3/06 (20130101) C01B 3/24 (20130101) C01B 3/40 (20130101) Original (OR) Class C01B 2203/02 (20130101) C01B 2203/0233 (20130101) C01B 2203/0261 (20130101) C01B 2203/0277 (20130101) C01B 2203/0475 (20130101) C01B 2203/0838 (20130101) C01B 2203/1047 (20130101) C01B 2203/1241 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513480 | Shan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Trustees of Tufts College (Medford, Massachusetts) |
| ASSIGNEE(S) | Trustees of Tufts College (Medford, Massachusetts) |
| INVENTOR(S) | Junjun Shan (Medford, Massachusetts); Maria Flytzani-Stephanopoulos (Winchester, Massachusetts); Mengwei Li (Medford, Massachusetts) |
| ABSTRACT | A method of converting methane to an oxygenate. The method includes converting methane to an oxygenate with a transition metal ion loaded zeolite catalyst in an aqueous medium in the presence of gaseous O2 and CO at a temperature lower than 200° C. Also disclosed are a two-metal ion zeolite catalyst for converting methane to methanol and a method for preparing the two-metal ion zeolite catalyst. |
| FILED | Wednesday, November 09, 2016 |
| APPL NO | 15/774862 |
| ART UNIT | 1622 — Organic Chemistry |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 23/464 (20130101) B01J 29/04 (20130101) B01J 29/06 (20130101) B01J 29/44 (20130101) B01J 29/46 (20130101) B01J 35/002 (20130101) B01J 2229/18 (20130101) Acyclic or Carbocyclic Compounds C07C 29/50 (20130101) Original (OR) Class C07C 29/50 (20130101) C07C 31/04 (20130101) C07C 51/215 (20130101) C07C 51/215 (20130101) C07C 51/215 (20130101) C07C 53/02 (20130101) C07C 53/08 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 20/52 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513535 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | Xiaojin He (New York City, New York); Ruojie Sha (Basking Ridge, New Jersey); Yongli Mi (Kowloon, China Hong Kong); Paul Chaikin (New York, New York); Nadrian C. Seeman (New York, New York) |
| ABSTRACT | The present invention provides a method for self-replication of multimers of nucleic acid origami tiles by exponentially amplifying the multimer from initial seeds of monomeric units of nucleic acid origami tiles and also provides for the selective exponential amplification of a designated multimer, such as with specific properties or characteristics, over one or more competing multimers in the presence of a mixture of monomers for each of the possible multimers. The selection of the designated multimer based on an environmental change allows the designated multimer to outgrow all competing multimers. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923361 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 21/04 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/11 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6816 (20130101) C12Q 1/6816 (20130101) C12Q 2565/113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513713 | Mukhopadhyay et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California); Total Marketing Services (Puteaux, France) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California); Total Marketing Services (Puteaux, France) |
| INVENTOR(S) | Aindrila Mukhopadhyay (Oakland, California); Florence Mingardon (Emeryville, California); Angelique Chanal (Paris, France) |
| ABSTRACT | The present invention provides methods for improving microbial tolerance to alpha olefin compounds, host cells having increased tolerance to such compounds, and method of using the host cells to produce alpha olefin compounds. |
| FILED | Wednesday, April 29, 2015 |
| APPL NO | 15/307783 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 14/245 (20130101) Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 5/026 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513987 | Hughes et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | General Electric Company (Schenectady, New York) |
| ASSIGNEE(S) | GENERAL ELECTRIC COMPANY (Schenectady, New York) |
| INVENTOR(S) | Michael John Hughes (State College, Pennsylvania); Jayaprakash Natarajan (Greer, South Carolina) |
| ABSTRACT | A system for dissipating fuel egress includes a fuel injector and a fuel supply assembly. The fuel supply assembly has a fuel supply line that provides fuel and a purge air conduit arranged co-axially around the fuel supply line, thereby defining an annular channel around the fuel supply line. The fuel injector includes a perimeter body, a fuel injection port associated with the perimeter body, and an internal mixing chamber downstream of the fuel injection port in a direction of fuel flow. The fuel supply line provides fuel to the fuel injection port. The perimeter body of the fuel injector defines a fuel egress passage therethrough, which has an inlet in fluid communication with the annular channel and an outlet in fluid communication with the mixing chamber. A gas turbine combustor having an axial fuel staging (AFS) system with the present fuel egress dissipation system is also provided. |
| FILED | Friday, December 30, 2016 |
| APPL NO | 15/395282 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 7/222 (20130101) F02C 9/26 (20130101) Original (OR) Class Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2240/35 (20130101) Generating Combustion Products of High Pressure or High Velocity, e.g Gas-turbine Combustion Chambers F23R 3/002 (20130101) F23R 3/34 (20130101) F23R 3/346 (20130101) F23R 2900/00004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514361 | Boyle et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico); STC.UNM (Albuquerque, New Mexico) |
| ASSIGNEE(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico); STC.UNM (Albuquerque, New Mexico) |
| INVENTOR(S) | Timothy J. Boyle (Albuquerque, New Mexico); Khalid Mikhiel Hattar (Albuquerque, New Mexico); Fernando Henry Garzon (Santa Fe, New Mexico); Stephen J. Bauer (Albuquerque, New Mexico) |
| ABSTRACT | Ion-doped metal or ceramic nanoparticles can be added into, for example, a component that upon exposure to an environmental stimulus, will release the ion and ‘tattle’ on any impending destruction. |
| FILED | Tuesday, August 21, 2018 |
| APPL NO | 16/107792 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 15/00 (20130101) B82Y 40/00 (20130101) Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 41/0027 (20130101) C04B 2235/3218 (20130101) C04B 2235/3225 (20130101) C04B 2235/3229 (20130101) Measuring Temperature; Measuring Quantity of Heat; Thermally-sensitive Elements Not Otherwise Provided for G01K 3/00 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/622 (20130101) Original (OR) Class Electric Discharge Tubes or Discharge Lamps H01J 37/08 (20130101) H01J 2237/31701 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514371 | Looney |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Savannah River Nuclear Solutions, LLC (Aiken, South Carolina) |
| ASSIGNEE(S) | Savannah River Nuclear Solutions, LLC (Aiken, South Carolina) |
| INVENTOR(S) | Brian B. Looney (Aiken, South Carolina) |
| ABSTRACT | Sampling devices for mercury speciation protocols are described. Devices can be utilized to separate mercury species from one another as a sample diffuses through a sampling device. Methods can determine the presence or quantity of targeted mercury species in a fluid sample. The devices are passive sampling devices based upon diffusion gradient in thin film (DGT) passive sampling devices. Devices include a reactant component and a sequesterant component that selectively react with a targeted species and retain a species (or a reaction product of a species) of a sample flow. Remaining mercury species can optionally be captured downgradient, for instance at an ion exchange resin. |
| FILED | Wednesday, November 01, 2017 |
| APPL NO | 15/800534 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/4044 (20130101) G01N 1/4077 (20130101) G01N 33/20 (20130101) Original (OR) Class G01N 2001/4016 (20130101) G01N 2001/4088 (20130101) Technical Subjects Covered by Former US Classification Y10T 436/255 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514412 | Kang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ABB Inc. (Cary, North Carolina) |
| ASSIGNEE(S) | ABB Inc. (Cary, North Carolina) |
| INVENTOR(S) | Ning Kang (Morrisville, North Carolina); Mirrasoul Mousavi (Cary, North Carolina) |
| ABSTRACT | Systems and methods for identifying faulted segment(s) in a multiphase power network may include receiving a current measurement that was measured during a fault, obtaining a set of equivalent sequence impedances for the segments, building a set of sequence bus impedance matrices, selecting a segment, calculating coefficients for the segment based on the set of equivalent sequence impedances for the segment and the sequence bus impedance matrices, calculating an estimated per unit fault distance for the segment based at least partially on the current measurement and the coefficients, identifying the segment as a potentially faulted segment if the estimated fault distance for the segment is between about zero and about one, and repeating for each of the segments the calculating coefficients, calculating an estimated per unit fault distance, and identifying as a potentially faulted segment if the estimated fault distance for the segment is between about zero and about one. |
| FILED | Monday, June 06, 2016 |
| APPL NO | 15/174687 |
| ART UNIT | 2858 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/08 (20130101) G01R 31/024 (20130101) Original (OR) Class G01R 31/086 (20130101) Emergency Protective Circuit Arrangements H02H 3/405 (20130101) H02H 7/28 (20130101) Systems Integrating Technologies Related to Power Network Operation, Communication or Information Technologies for Improving the Electrical Power Generation, Transmission, Distribution, Management or Usage, i.e Smart Grids Y04S 10/522 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514581 | Gillaspie et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SAGE ELECTROCHROMICS, INC. (Faribault, Minnesota); Alliance for Sustainable Energy, LLC (Golden, Colorado) |
| ASSIGNEE(S) | SAGE ELECTROCHROMICS, INC (Faribault, Minnesota); ALLIANCE FOR SUSTAINABLE ENERGY, LLC (Golden, Colorado) |
| INVENTOR(S) | Dane T. Gillaspie (Golden, Colorado); Douglas G. Weir (Northfield, Minnesota) |
| ABSTRACT | An electrochromic device comprising a counter electrode layer comprised of lithium metal oxide which provides a high transmission in the fully intercalated state and which is capable of long-term stability, is disclosed. Methods of making an electrochromic device comprising such a counter electrode are also disclosed. |
| FILED | Wednesday, April 05, 2017 |
| APPL NO | 15/479942 |
| ART UNIT | 2872 — Optics |
| CURRENT CPC | Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 9/00 (20130101) Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/155 (20130101) Original (OR) Class G02F 1/1523 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514585 | Geiger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northwestern University (Evanston, Illinois); Battelle Memorial Institute (Columbus, Ohio); The Trustees of Columbia University in the City of New York (New York, New York) |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois); Battelle Memorial Institute (Columbus, Ohio); The Trustees of Columbia University in the City of New York (, New York) |
| INVENTOR(S) | Franz M. Geiger (Evanston, Illinois); Paul E. Ohno (Evanston, Illinois); Hong-fei Wang (Richland, Washington); Kenneth B. Eisenthal (New York City, New York) |
| ABSTRACT | An apparatus for probing an interface via second harmonic generation (SHG) spectroscopy is provided. The apparatus comprises a sample cell comprising a noncentrosymmetric material having a selected orientation angle with respect to a reference axis; optics configured to illuminate an interface formed between the noncentrosymmetric material and a different material, or formed between two different materials and disposed over the noncentrosymmetric material, with light having a frequency ω under conditions to generate a second harmonic generation (SHG) signal having frequency 2ω; a detector configured to detect the SHG signal, the SHG signal comprising a bulk second harmonic signal from the noncentrosymmetric material and an interfacial second harmonic signal from the interface; and a device comprising a processor and a computer-readable medium operably coupled to the processor, the computer-readable medium having computer-readable instructions stored thereon that, when executed by the processor, cause the apparatus to: illuminate the interface to generate the SHG signal and detect the SHG signal. |
| FILED | Tuesday, March 12, 2019 |
| APPL NO | 16/299383 |
| ART UNIT | 2874 — Optics |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/84 (20130101) G01N 21/636 (20130101) G01N 21/8422 (20130101) Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/35 (20130101) G02F 1/37 (20130101) G02F 1/355 (20130101) G02F 1/377 (20130101) G02F 1/3532 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514663 | Lin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | United Technologies Corporation (Farmington, Connecticut) |
| INVENTOR(S) | Yiqing Lin (Glastonbury, Connecticut); Stella M. Oggianu (West Hartford, Connecticut) |
| ABSTRACT | A microgrid controller includes a database in communication with a processor. The processor is operable to receive at least one microgrid input, to determine a first plurality of optimal power characteristic levels at a corresponding one of a plurality of first time intervals for a first time period, and to determine a second plurality of optimal power characteristic levels of a device determined at a corresponding one of a plurality of second time intervals for a second time period. The first time intervals are found at a first frequency different than a second frequency of the second time intervals. One of the second plurality of optimal power characteristic level corresponds to one of the first plurality of optimal power characteristic levels at each first time interval. The processor is configured to control a device optimal power characteristic level in response to the second plurality of optimal power characteristic levels. |
| FILED | Friday, June 12, 2015 |
| APPL NO | 15/579990 |
| ART UNIT | 2119 — Computer Error Control, Reliability, & Control Systems |
| CURRENT CPC | Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 13/021 (20130101) Original (OR) Class Electric Digital Data Processing G06F 1/30 (20130101) Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 50/06 (20130101) Circuit Arrangements or Systems for Supplying or Distributing Electric Power; Systems for Storing Electric Energy H02J 3/06 (20130101) H02J 3/381 (20130101) H02J 13/0006 (20130101) H02J 2003/003 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 40/72 (20130101) Systems Integrating Technologies Related to Power Network Operation, Communication or Information Technologies for Improving the Electrical Power Generation, Transmission, Distribution, Management or Usage, i.e Smart Grids Y04S 10/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515173 | Roberts et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Advanced Micro Devices, Inc. (Santa Clara, California) |
| ASSIGNEE(S) | ADVANCED MICRO DEVICES, INC. (Santa Clara, California) |
| INVENTOR(S) | David A. Roberts (Wellesley, Massachusetts); Dean Gonzales (Fort Collins, Colorado) |
| ABSTRACT | An electronic device includes a first integrated circuit chip including a processing functional block, and a second integrated circuit chip including an input-output (IO) functional block. The IO functional block performs one or more IO processing operations on behalf of the processing functional block in the first integrated circuit chip. The first integrated circuit chip lacks at least some elements of the IO functional block, so that the processing functional block is unable to perform corresponding IO operations without the IO functional block. |
| FILED | Friday, December 29, 2017 |
| APPL NO | 15/859156 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 9/3881 (20130101) G06F 12/1081 (20130101) G06F 17/5068 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/60 (20130101) H01L 25/0657 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515436 | Habib |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| INVENTOR(S) | Ayman F. Habib (West Lafayette, Indiana) |
| ABSTRACT | A non-transitory computer-readable medium encoded with a computer-readable program, which when executed by a processor, will cause a computer to execute a computational method, the computational method including collecting an image data, wherein the collecting the image data comprises collecting a first plurality of RGB images and a second plurality of hyperspectral images. The method further includes orthorectifying the image data to produce an RGB based orthophoto and a partially rectified hyperspectral orthophoto. The method further includes selecting tie features from each of the RGB based orthophoto and the partially rectified hyperspectral orthophoto. Lastly, the method includes registering the features of the partially rectified hyperspectral orthophoto into the tie features of the RGB based orthophoto. |
| FILED | Monday, July 29, 2019 |
| APPL NO | 16/524467 |
| ART UNIT | 2665 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 3/60 (20130101) Original (OR) Class G06T 7/55 (20170101) G06T 7/337 (20170101) G06T 2207/10024 (20130101) G06T 2207/10036 (20130101) G06T 2207/20212 (20130101) G06T 2207/30188 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515671 | Roberts |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Advanced Micro Devices, Inc. (Sunnyvale, California) |
| ASSIGNEE(S) | Advanced Micro Devices, Inc. (Santa Clara, California) |
| INVENTOR(S) | David A. Roberts (Sunnyvale, California) |
| ABSTRACT | Logic such as a memory controller writes primary data from an incoming write request as well as corresponding replicated primary data (which is a copy of the primary data) to one or more different memory banks of random access memory in response to determining a memory access contention condition for the address (including a range of addresses) corresponding to the incoming write request. When the memory bank containing the primary data is busy servicing a write request, such as to another row of memory in the bank, a read request for the primary data is serviced by reading the replicated primary data from the different memory bank of the random access memory to service the incoming read request. |
| FILED | Thursday, September 22, 2016 |
| APPL NO | 15/272894 |
| ART UNIT | 2135 — Memory Access and Control |
| CURRENT CPC | Static Stores G11C 7/00 (20130101) Original (OR) Class G11C 7/222 (20130101) G11C 2029/0409 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515728 | Lahoda et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | WESTINGHOUSE ELECTRIC COMPANY, LLC (Cranberry Township, Pennsylvania) |
| ASSIGNEE(S) | Westinghouse Electric Company LLC (Cranberry Township, Pennsylvania) |
| INVENTOR(S) | Edward J. Lahoda (Edgewood, Pennsylvania); Frank A. Boylan (Ellwood City, Pennsylvania) |
| ABSTRACT | An improved, accident tolerant fuel for use in light water and lead fast reactors is described. The fuel includes a ceramic cladding, such as a multi-layered silicon carbide cladding, and fuel pellets formed from U15N and from 100 to 10000 ppm of a boron-containing integral fuel burnable absorber, such as UB2 or ZrB2. |
| FILED | Monday, September 18, 2017 |
| APPL NO | 15/706972 |
| ART UNIT | 3646 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Nuclear Reactors G21C 3/045 (20190101) G21C 3/626 (20130101) Original (OR) Class G21C 9/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515733 | Jing et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Euclid Techlabs, LLC (Solon, Ohio) |
| ASSIGNEE(S) | Euclid Techlabs, LLC (Solon, Ohio) |
| INVENTOR(S) | Chunguang Jing (Naperville, Illinois); Jiaqi Qiu (Zhejiang, China PRC); Ao Liu (Naperville, Illinois); Eric John Montgomery (Oak Park, Illinois); Yubin Zhao (Naperville, Illinois); Wade Rush (Lawrence, Kansas); Roman Kostin (Oak Park, Illinois); Alexei Kanareykin (Bethesda, Maryland) |
| ABSTRACT | An electromagnetic mechanical pulser implements a transverse wave metallic comb stripline TWMCS kicker having inwardly opposing teeth structured to retard a phase velocity of an RF traveling wave propagated therethrough to match the kinetic velocity of a continuous electron beam simultaneously propagated therethrough. The kicker imposes transverse oscillations onto the beam, which is subsequently chopped into pulses by an aperture. The RF phase velocity is substantially independent of RF frequency and amplitude, thereby enabling independent tuning of the electron pulse widths and repetition rate. The exterior surface of the kicker is conductive, thereby avoiding electron charging. In embodiments, various elements of the kicker and/or aperture can be mechanically varied to provide further tuning of the pulsed electron beam. A divergence suppression section can include a mirror TWMCS and/or magnetic quadrupoles. RF can be applied to a down-selecting TWMCS downstream of the aperture to reduce the pulse repetition rate. |
| FILED | Wednesday, April 24, 2019 |
| APPL NO | 16/393469 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Techniques for Handling Particles or Ionising Radiation Not Otherwise Provided For; Irradiation Devices; Gamma Ray or X-ray Microscopes G21K 1/043 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515782 | Donnelly et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Houston System (Houston, Texas) |
| ASSIGNEE(S) | UNIVERSITY OF HOUSTON SYSTEM (Houston, Texas) |
| INVENTOR(S) | Vincent M. Donnelly (Houston, Texas); Demetre J. Economou (Houston, Texas) |
| ABSTRACT | A system and method for rapid atomic layer etching (ALET) including a pulsed plasma source, with a spiral coil electrode, a cooled Faraday shield, a counter electrode disposed at the top of the tube, a gas inlet and a reaction chamber including a substrate support and a boundary electrode. The method includes positioning an etchable substrate in a plasma etching chamber, forming a product layer on the surface of the substrate, removing a portion of the product layer by pulsing a plasma source, then repeating the steps of forming a product layer and removing a portion of the product layer to form an etched substrate. |
| FILED | Tuesday, April 10, 2018 |
| APPL NO | 15/949274 |
| ART UNIT | 1716 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 37/32036 (20130101) H01J 37/32045 (20130101) H01J 37/32082 (20130101) H01J 37/32146 (20130101) H01J 37/32174 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/30655 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516068 | Doty et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| ASSIGNEE(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| INVENTOR(S) | F. Patrick Doty (Livermore, California); Pin Yang (Albuquerque, New Mexico); Xiaowang Zhou (Livermore, California) |
| ABSTRACT | Various technologies pertaining to formation or treatment of a thallium bromide crystal to improve the operable lifespan of a device that incorporates the thallium bromide crystal are described herein. In exemplary embodiments, treatments including focused ion beam implantation, selective material removal, and buffer layer application are performed on a thallium bromide crystal to inhibit motion of dislocations toward a region at which an electrical contact is desirably installed. In other exemplary embodiments, a thallium bromide crystal is doped with impurities during formation that inhibit the motion of dislocations in the crystal. In still other exemplary embodiments, a thallium bromide crystal is formed by way of processes that inhibit dislocation formation during crystal growth or eliminate dislocations in an existing thallium bromide mass. |
| FILED | Thursday, January 04, 2018 |
| APPL NO | 15/862307 |
| ART UNIT | 2816 — Semiconductors/Memory |
| CURRENT CPC | Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 11/00 (20130101) C30B 13/00 (20130101) C30B 15/00 (20130101) C30B 29/10 (20130101) C30B 33/08 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/425 (20130101) H01L 21/441 (20130101) H01L 21/465 (20130101) H01L 21/02521 (20130101) H01L 21/02595 (20130101) H01L 29/24 (20130101) H01L 31/032 (20130101) Original (OR) Class H01L 31/115 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516089 | Braiman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee); University of Tennessee Research Foundation (Knoxville, Tennessee) |
| ASSIGNEE(S) | UT-Battelle, LLC (Oak Ridge, Tennessee); University of Tennessee Research Foundation (Knoxville, Tennessee) |
| INVENTOR(S) | Yehuda Braiman (Oak Ridge, Tennessee); Neena Imam (Knoxville, Tennessee); Brendan Neschke (Tucson, Arizona) |
| ABSTRACT | Methods and apparatus are disclosed for operating a memory cell formed from the plurality of coupled Josephson junctions. The memory cell is configured such that applying an electrical signal to the junctions can cause at least one, but not all, of the junctions to change their respective phase states. Subsequent writes to the memory cell using substantially the same electrical pulse do not change the phase state of the plurality of junctions. The memory cell can be ready by providing another electrical pulse to one of the junctions and receiving an output electrical pulse generated in response by a different Josephson junction of the memory cell. A set of phase states are selected to represent the logic values that are stable across anticipated operating conditions for the memory cell. Methods of selecting electrical parameters and manufacturing memory cells are further disclosed. |
| FILED | Thursday, October 05, 2017 |
| APPL NO | 15/726173 |
| ART UNIT | 2825 — Semiconductors/Memory |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 33/0354 (20130101) Static Stores G11C 11/44 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 39/223 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516117 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Jian Li (Tempe, Arizona); Yunlong Ji (Mesa, Arizona) |
| ABSTRACT | Metal-assisted delayed fluorescent emitters employing benzo-imidazo-phenanthridine and analogues for full color displays and lighting applications. |
| FILED | Friday, May 18, 2018 |
| APPL NO | 15/983680 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 15/006 (20130101) C07F 15/0033 (20130101) C07F 15/0086 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/06 (20130101) C09K 2211/185 (20130101) C09K 2211/1044 (20130101) C09K 2211/1074 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 51/0084 (20130101) Original (OR) Class H01L 51/0085 (20130101) H01L 51/0087 (20130101) H01L 51/5016 (20130101) H01L 51/5268 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516169 | Zeberoff et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Anthony F. Zeberoff (Brookfield, Connecticut); Jeffrey F. Roeder (Bethel, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ASSIGNEE(S) | Sonata Scientific LLC (Bethel, Connecticut) |
| INVENTOR(S) | Anthony F. Zeberoff (Brookfield, Connecticut); Jeffrey F. Roeder (Bethel, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ABSTRACT | An apparatus and method is described to coat small and large quantities of solid particles using atomic layer deposition, with increased material utilization and decreased cycle times. The resulting higher coating efficiency ALD process is achieved by a controlled pressure differential acting across a rotating porous vessel that contains a plurality of solid particles. The apparatus is comprised of two coaxial cylindrical porous vessels with a means for one to rotate, and a two stage rotary feedthrough with a specialized hollowed out shaft, which enables both rotation of the vessel and reactant, purge, and product gas transport across a particle bed that undergoes mixing. |
| FILED | Saturday, November 12, 2016 |
| APPL NO | 15/350010 |
| ART UNIT | 1722 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 41/00 (20130101) Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/40 (20130101) C23C 16/405 (20130101) C23C 16/4412 (20130101) C23C 16/4417 (20130101) C23C 16/45548 (20130101) C23C 16/45555 (20130101) C23C 16/45557 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/8867 (20130101) Original (OR) Class H01M 4/9033 (20130101) H01M 2008/1293 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516181 | Sahu |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Palo Alto Research Center Incorporated (Palo Alto, California) |
| ASSIGNEE(S) | PALO ALTO RESEARCH CENTER INCORPORATED (Palo Alto, California) |
| INVENTOR(S) | Saroj Sahu (Fremont, California) |
| ABSTRACT | An electrolyte membrane for a reformer-less fuel cell is provided. The electrolyte membrane is assembled with fuel and air manifolds to form the fuel cell. The fuel manifold receives an oxidizable fuel from a fuel supply in a gaseous, liquid, or slurry form. The air manifold receives air from an air supply. The electrolyte membrane conducts oxygen in an ionic superoxide form when the fuel cell is exposed to operating temperatures above the boiling point of water to electrochemically combine the oxygen with the fuel to produce electricity. The electrolyte membrane includes a porous electrically non-conductive substrate, an anode catalyst layer deposited along a fuel manifold side of the substrate, a cathode catalyst layer deposited along an air manifold side of the substrate, and an ionic liquid filling the substrate between the anode and cathode catalyst layers. Methods for manufacturing and operating the electrolyte membrane are also provided. |
| FILED | Thursday, August 28, 2014 |
| APPL NO | 14/472195 |
| ART UNIT | 1729 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/881 (20130101) H01M 4/905 (20130101) H01M 4/8853 (20130101) H01M 4/8871 (20130101) H01M 4/8878 (20130101) H01M 4/9025 (20130101) H01M 4/9058 (20130101) H01M 8/124 (20130101) H01M 8/1004 (20130101) H01M 8/1016 (20130101) Original (OR) Class H01M 8/1233 (20130101) H01M 2004/8684 (20130101) H01M 2004/8689 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516269 | Dall'Anese et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado); Université catholique de Louvain (Louvain-la-Neuve, Belgium) |
| ASSIGNEE(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado); Université catholique de Louvain (Louvain-la-Neuve, Belgium) |
| INVENTOR(S) | Emiliano Dall'Anese (Arvada, Colorado); Andrey Bernstein (Golden, Colorado); Andrea Simonetto (Wavre, Belgium) |
| ABSTRACT | An example device includes a processor configured to receive a plurality of voltage values corresponding to voltage nodes in a first portion of a power system and determine, for each voltage node, a respective value of first and second voltage-constraint coefficients. The processor is also configured to receive a power value corresponding to a connection point of the first portion of the power system with a second portion of the power system and determine for the connection point, a respective value of first and second power-constraint coefficients. The processor is also configured to cause at least one energy resource connected to the first portion of the power system to modify an output power of the at least one energy resource based on the value of the first and second voltage-constraint coefficients for each voltage node and the value of the first and second power-constraint coefficients. |
| FILED | Thursday, November 16, 2017 |
| APPL NO | 15/814532 |
| ART UNIT | 2117 — Computer Error Control, Reliability, & Control Systems |
| CURRENT CPC | Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 19/042 (20130101) G05B 2219/2639 (20130101) Circuit Arrangements or Systems for Supplying or Distributing Electric Power; Systems for Storing Electric Energy H02J 3/32 (20130101) H02J 3/46 (20130101) H02J 3/381 (20130101) Original (OR) Class H02J 13/0006 (20130101) H02J 2003/007 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 40/76 (20130101) Y02E 60/76 (20130101) Systems Integrating Technologies Related to Power Network Operation, Communication or Information Technologies for Improving the Electrical Power Generation, Transmission, Distribution, Management or Usage, i.e Smart Grids Y04S 10/545 (20130101) Y04S 40/22 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Aeronautics and Space Administration (NASA)
| US 10513026 | Griffith |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States of America as Represented by the Administrator of NASA (Washington, District of Columbia) |
| ASSIGNEE(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| INVENTOR(S) | Charles W. Griffith (Huntsville, Alabama) |
| ABSTRACT | A surface grinding tool includes a support housing adapted to be coupled to a source of pressurized gas. The housing includes a conduit for directing the pressurized gas to an open end of the housing. A flexible sealing membrane is coupled to the housing such that the sealing membrane spans the housing's open end to prevent the pressurized gas from passing through and around the sealing membrane. A plate having through holes is coupled to the housing. The plate has a first face disposed adjacent to the sealing membrane and a second face opposing the first face. Each of a plurality of grinding elements is coupled to the sealing membrane and to the first face of the plate. Each grinding element has a portion thereof passing loosely through one of the through holes and extending away from the second face of the plate. |
| FILED | Friday, July 14, 2017 |
| APPL NO | 15/650423 |
| ART UNIT | 3723 — Manufacturing Devices & Processes, Machine Tools & Hand Tools Group Art Units |
| CURRENT CPC | Machines, Devices, or Processes for Grinding or Polishing; Dressing or Conditioning of Abrading Surfaces; Feeding of Grinding, Polishing, or Lapping Agents B24B 7/00 (20130101) B24B 23/00 (20130101) Combination or Multi-purpose Tools Not Otherwise Provided For; Details or Components of Portable Power-driven Tools Not Particularly Related to the Operations Performed and Not Otherwise Provided for B25F 5/02 (20130101) Original (OR) Class Alloys C22C 26/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513080 | Kim et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S.A. as represented by the Administrator of the National Aeronautics and Space Administration (Washington, District of Columbia) |
| ASSIGNEE(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| INVENTOR(S) | Jae-Woo Kim (Newport News, Virginia); Godfrey Sauti (Hampton, Virginia); John M. Gardner (Newport News, Virginia); Emilie J. Siochi (Newport News, Virginia) |
| ABSTRACT | A method of fabricating composite articles includes supplying electrical current to an electrically conductive filament. The electrically conductive filament may include a first material that is electrically conductive and a polymer second material. The polymer second material comprises at least one of a thermoplastic polymer and a partially cured thermosetting polymer. The heated filament is deposited according to a predefined pattern in successive layers to adhere the polymer material of the layers together and build up a three dimensional article. The article includes strands of the first material embedded in a substantially continuous polymer matrix of the second material. |
| FILED | Monday, November 07, 2016 |
| APPL NO | 15/345064 |
| ART UNIT | 1742 — Tires, Adhesive Bonding, Glass/Paper making, Plastics Shaping & Molding |
| CURRENT CPC | Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/106 (20170801) B29C 64/386 (20170801) B29C 67/0055 (20130101) Original (OR) Class Indexing Scheme Associated With Subclasses B29B, B29C or B29D, Relating to Moulding Materials or to Materials for Reinforcements, Fillers or Preformed Parts, e.g Inserts B29K 2105/16 (20130101) B29K 2995/0005 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 50/02 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513434 | Seger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | R. Adam Seger (Santa Cruz, California); Paolo Actis (London, United Kingdom); Boaz Vilozny (Santa Cruz, California); Nader Pourmand (Scotts Valley, California) |
| ABSTRACT | Disclosed herein are methods and systems for controlled ejection of desired material onto surfaces including in single cells using nanopipettes, as well as ejection onto and into cells. Some embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller for depositing a user defined pattern on an arbitrary substrate for the purpose of controlled cell adhesion and growth. Alternate embodiments are directed to a method and system comprising nanopipettes combined with an xyz controller and electronic control of a voltage differential in a bore of the nanopipette electroosmotically injecting material into a cell in a high-throughput manner and with minimal damage to the cell. Yet other embodiments are directed to method and system comprising functionalized nanopipettes combined with scanning ion conductance microscopy for studying molecular interactions and detection of biomolecules inside a single living cell. |
| FILED | Monday, March 20, 2017 |
| APPL NO | 15/463860 |
| ART UNIT | 1641 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 2219/00371 (20130101) Chemical or Physical Laboratory Apparatus for General Use B01L 3/50273 (20130101) B01L 3/502715 (20130101) B01L 2300/0645 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Original (OR) Class B82Y 15/00 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/48728 (20130101) Scanning-probe Techniques or Apparatus; Applications of Scanning-probe Techniques, e.g Scanning Probe Microscopy [SPM] G01Q 60/44 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513535 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York) |
| ASSIGNEE(S) | NEW YORK UNIVERSITY (New York, New York) |
| INVENTOR(S) | Xiaojin He (New York City, New York); Ruojie Sha (Basking Ridge, New Jersey); Yongli Mi (Kowloon, China Hong Kong); Paul Chaikin (New York, New York); Nadrian C. Seeman (New York, New York) |
| ABSTRACT | The present invention provides a method for self-replication of multimers of nucleic acid origami tiles by exponentially amplifying the multimer from initial seeds of monomeric units of nucleic acid origami tiles and also provides for the selective exponential amplification of a designated multimer, such as with specific properties or characteristics, over one or more competing multimers in the presence of a mixture of monomers for each of the possible multimers. The selection of the designated multimer based on an environmental change allows the designated multimer to outgrow all competing multimers. |
| FILED | Monday, October 26, 2015 |
| APPL NO | 14/923361 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 21/04 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/11 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6816 (20130101) C12Q 1/6816 (20130101) C12Q 2565/113 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515792 | Cooks et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| INVENTOR(S) | Robert Graham Cooks (West Lafayette, Indiana); Dalton Snyder (West Lafayette, Indiana) |
| ABSTRACT | The invention generally relates to systems and methods for ejection of ions from an ion trap. In certain embodiments, systems and methods of the invention sum two different frequency signals into a single summed signal that is applied to an ion trap. In other embodiments, an amplitude of a single frequency signal is modulated as the single frequency signal is being applied to the ion trap. In other embodiments, a first alternating current (AC) signal is applied to an ion trap that varies as a function of time, while a constant radio frequency (RF) signal is applied to the ion trap. |
| FILED | Wednesday, March 14, 2018 |
| APPL NO | 15/920900 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 49/0013 (20130101) H01J 49/4225 (20130101) H01J 49/4285 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515804 | Okojie |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States of Americas as represented by the Administrator of NASA (Washington, District of Columbia) |
| ASSIGNEE(S) | United States of America as Represented by the Administrator of National Aeronautics and Space Administration (Washington, District of Columbia) |
| INVENTOR(S) | Robert S. Okojie (Strongsville, Ohio) |
| ABSTRACT | Use of a single alloy conductor to form simultaneous ohmic contacts (SOC) to n- and p-type 4H—SiC. The single alloy conductor also is an effective diffusion barrier against gold (AU) and oxygen (O2) at high temperatures (e.g., up to 800° C.). The innovation may also provide an effective interconnecting metallization in a multi-level metallization device scheme. |
| FILED | Monday, August 06, 2018 |
| APPL NO | 16/055951 |
| ART UNIT | 2898 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/0485 (20130101) Original (OR) Class H01L 21/2855 (20130101) H01L 21/7685 (20130101) H01L 21/32134 (20130101) H01L 21/76864 (20130101) H01L 23/53261 (20130101) H01L 23/53266 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516073 | Ray et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NthDegree Technologies Worldwide Inc. (Tempe, Arizona) |
| ASSIGNEE(S) | NthDegree Technologies Worldwide Inc (Tempe, Arizona) |
| INVENTOR(S) | William Johnstone Ray (Fountain Hills, Arizona); Mark D. Lowenthal (Gilbert, Arizona); Neil O. Shotton (Tempe, Arizona); Richard A. Blanchard (Los Altos Hills, California); Mark Allan Lewandowski (North Port, Florida); Kirk A. Fuller (Madison, Alabama); Donald Odell Frazier (Huntsville, Alabama) |
| ABSTRACT | The present invention provides an electronic apparatus, such as a lighting device comprised of light emitting diodes (LEDs) or a power generating apparatus comprising photovoltaic diodes, which may be created through a printing process, using a semiconductor or other substrate particle ink or suspension and using a lens particle ink or suspension. An exemplary apparatus comprises a base; at least one first conductor; a plurality of diodes coupled to the at least one first conductor; at least one second conductor coupled to the plurality of diodes; and a plurality of lenses suspended in a polymer deposited or attached over the diodes. The lenses and the suspending polymer have different indices of refraction. In some embodiments, the lenses and diodes are substantially spherical, and have a ratio of mean diameters or lengths between about 10:1 and 2:1. The diodes may be LEDs or photovoltaic diodes, and in some embodiments, have a junction formed at least partially as a hemispherical shell or cap. |
| FILED | Friday, December 08, 2017 |
| APPL NO | 15/835944 |
| ART UNIT | 2828 — Semiconductors/Memory |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 20/00 (20130101) B82Y 30/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/30 (20130101) H01L 27/32 (20130101) H01L 27/142 (20130101) H01L 27/156 (20130101) H01L 27/3281 (20130101) H01L 31/05 (20130101) H01L 31/028 (20130101) H01L 31/068 (20130101) H01L 31/0304 (20130101) H01L 31/0328 (20130101) H01L 31/0352 (20130101) H01L 31/0475 (20141201) H01L 31/0504 (20130101) H01L 31/0508 (20130101) H01L 31/0512 (20130101) H01L 31/0543 (20141201) H01L 31/0547 (20141201) H01L 31/03044 (20130101) H01L 31/035281 (20130101) H01L 33/00 (20130101) Original (OR) Class H01L 33/08 (20130101) H01L 33/20 (20130101) H01L 33/30 (20130101) H01L 33/32 (20130101) H01L 33/34 (20130101) H01L 33/58 (20130101) H01L 33/60 (20130101) H01L 33/62 (20130101) H01L 51/52 (20130101) H01L 51/56 (20130101) H01L 51/0096 (20130101) H01L 51/447 (20130101) H01L 51/5203 (20130101) H01L 51/5265 (20130101) H01L 51/5271 (20130101) H01L 51/5275 (20130101) H01L 2251/5369 (20130101) H01L 2924/00 (20130101) H01L 2924/0002 (20130101) H01L 2924/0002 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/52 (20130101) Y02E 10/547 (20130101) Y02E 10/549 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 70/521 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516246 | Stephen |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| ASSIGNEE(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| INVENTOR(S) | Mark A. Stephen (Catonsville, Maryland) |
| ABSTRACT | The present invention is related to laser technology which enables efficient, passive, coherent beam combination from distributed gain sources. The present invention includes a novel architecture which coherently combines the power from multiple sources, and which adds considerable flexibility to laser gain materials for many applications. The novel architecture of the present invention combines two techniques: 1) beam splitting and combination; and 2) phase-locking (i.e., maintaining a common phase relationship between multiple beams), using reflective gratings. Thus, the present invention addresses important limitations in laser technology: efficiency, power scaling and wavelength selectivity. |
| FILED | Thursday, August 24, 2017 |
| APPL NO | 15/685932 |
| ART UNIT | 3645 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 5/1857 (20130101) G02B 6/00 (20130101) G02B 27/14 (20130101) G02B 27/106 (20130101) G02B 27/123 (20130101) G02B 27/283 (20130101) G02B 27/1093 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/005 (20130101) Original (OR) Class H01S 3/0071 (20130101) H01S 3/0675 (20130101) H01S 3/1618 (20130101) H01S 5/0057 (20130101) H01S 5/0071 (20130101) H01S 5/125 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Agriculture (USDA)
| US 10512251 | Wagoner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of North Carolina at Greensboro (Greensboro, North Carolina) |
| ASSIGNEE(S) | University of North Carolina at Greensboro (Greensboro, North Carolina) |
| INVENTOR(S) | Kaira Wagoner (Greensboro, North Carolina); Olav Rueppell (Greensboro, North Carolina) |
| ABSTRACT | The presently disclosed subject matter provides tritriacontene compositions for inducing hygienic behavior in honey bees; mite-infested brood extract compositions for inducing hygienic behavior in honey bees; methods of inducing hygienic behavior in honey bees; methods of selecting one or more honey bee(s) exhibiting hygienic behavior, and methods for assessing the degree of hygienic behavior within a honey bee colony. |
| FILED | Tuesday, July 05, 2016 |
| APPL NO | 15/742072 |
| ART UNIT | 1612 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 51/00 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513533 | Price |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America as Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| INVENTOR(S) | Neil P. Price (Edelstein, Illinois) |
| ABSTRACT | Tunicamycin related compounds having an acyl chain double bond reduced and/or having an acyl chain double bond and an uracil ring double bond reduced are described as well as methods of making these tunicamycin related compounds. These tunicamycin related compounds are not toxic to eukaryotic cells and can be used to kill Gram-positive bacteria, alone or in combination with other antibiotics. Use of these tunicamycin related compounds to kill Gram-positive bacteria, treat Gram-positive bacterial diseases, and disinfect objects or surfaces are described. In addition, naturally-occurring streptovirudin compounds are not toxic to eukaryotic cells and can be used to kill Gram-positive bacteria, alone or in combination with other antibiotics. |
| FILED | Tuesday, January 16, 2018 |
| APPL NO | 15/872270 |
| ART UNIT | 1623 — Organic Chemistry |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 43/16 (20130101) A01N 43/54 (20130101) A01N 43/90 (20130101) A01N 57/16 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 31/7034 (20130101) A61K 31/7072 (20130101) A61K 31/7076 (20130101) A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/04 (20180101) Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 15/207 (20130101) C07H 19/06 (20130101) Original (OR) Class C07H 19/16 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513707 | Gopalan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arrowhead Center, Inc. (Las Cruces, New Mexico) |
| ASSIGNEE(S) | Arrowhead Center, Inc. (Las Cruces, New Mexico) |
| INVENTOR(S) | Champa Sengupta Gopalan (Las Cruces, New Mexico); Mark Seger (Las Cruces, New Mexico); Jose L. Ortega-Carranza (Las Cruces, New Mexico) |
| ABSTRACT | Embodiments of the present invention comprise altering the biosynthesis and accumulation of sucrose in legumes by transforming the plants with the sucrose phosphate synthase (SPS) gene of maize, and closely related regulatory genes. Embodiments of the present invention further comprise altering the assimilation of nitrogen in legumes by transforming the plants with the glutamine synthetase (GS) gene of soybean, and closely related regulatory genes. Embodiments of the present invention further comprise transforming legume plants with both SPS and GS genes. In addition, embodiments of the present invention relate to enhancing expression of transgenes through the 5′ UTR of the glycine max (soybean) cytosolic glutamine synthetase (Gmglnβ1) gene. |
| FILED | Tuesday, February 27, 2018 |
| APPL NO | 15/907141 |
| ART UNIT | 1662 — Plants |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/827 (20130101) C12N 15/8241 (20130101) Original (OR) Class C12N 15/8245 (20130101) C12N 15/8261 (20130101) Technologies for Adaptation to Climate Change Y02A 40/146 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10513708 | Dardick et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| INVENTOR(S) | Christopher D. Dardick (Shenandoah Junction, West Virginia); Jessica M. Guseman (Charles Town, West Virginia); Courtney A. Hollender (East Lansing, Michigan) |
| ABSTRACT | Root orientation, or angle, is an important component of root architecture and depth of the root system. We have determined that DRO1 and DRO1-related genes are present across diverse plant phyla and fall within the IGT gene family. DRO1, present in both Arabidopsis and peach, displayed root specific expression patterns. AtDRO1 is predominantly expressed in both the root vasculature and root tips in a distinct developmental pattern. Mutation of AtDRO1 led to more horizontal lateral root angles; over-expression of AtDRO1 under a constitutive promoter reduced lateral root angles and resulted in shoot phenotypes including upward leaf curling, shortened siliques, and narrow lateral branch angles. Over-expression of PpeDRO1 in plum (Prunus domestica) led to deeper rooting phenotypes. These data establish that DRO1-related genes serve a role in altering root architecture, providing a method for drought avoidance. |
| FILED | Wednesday, September 13, 2017 |
| APPL NO | 15/703434 |
| ART UNIT | 1662 — Plants |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8261 (20130101) Original (OR) Class C12N 15/8273 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514338 | Robinson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| INVENTOR(S) | Joseph Paul Robinson (West Lafayette, Indiana); Bartlomiej P. Rajwa (West Lafayette, Indiana); Valery P. Patsekin (West Lafayette, Indiana); Euiwon Bae (West Lafayette, Indiana) |
| ABSTRACT | A target within a sample can be characterized using an energy source configured to transform a metal in the sample into a plasma and an optical spectroscopic detector configured to detect electromagnetic radiation emitted by the plasma to provide an optical-spectrum signal. A processor can determine presence of the metal in the sample using the optical-spectrum signal. The target can include a microbe or biological toxin. A recognition construct comprising a metal and a scaffold can be applied to the sample. The scaffold can bind to the target. Energy can be applied to transform at least some of the sample into a plasma. Electromagnetic radiation emitted by the plasma can be detected to provide an optical-spectrum signal of the sample. A preparation subsystem can add the recognition construct to the sample and a washing subsystem can wash unbound recognition construct out of the sample. |
| FILED | Friday, February 12, 2016 |
| APPL NO | 15/042969 |
| ART UNIT | 1641 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/25 (20130101) G01N 21/718 (20130101) Original (OR) Class G01N 33/58 (20130101) G01N 33/569 (20130101) G01N 33/56911 (20130101) G01N 2469/00 (20130101) G01N 2469/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Security Agency (NSA)
| US 10514418 | Deslandes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | FEI Company (Hillsboro, Oregon) |
| ASSIGNEE(S) | FEI Company (Hillsboro, Oregon) |
| INVENTOR(S) | Herve Deslandes (Sunnyvale, California) |
| ABSTRACT | A method for emission testing of a semiconductor device (DUT), by mounting the DUT onto an test bench of an emission tester, the emission tester having an optical detector; electrically connecting the DUT to an electrical tester; applying electrical test signals to the DUT while keeping test parameters constant; inserting an optical filters into an optical path of the emission tester and collecting emission test signal from the optical detector; removing the filter from the optical path and collecting emission test signal from the optical detector. Comparing the images obtained with and without the filter. The filter may be shortpass to obtain emission signal, a bandpass for detecting forward bias, or longpass to obtain thermal signal. |
| FILED | Wednesday, October 05, 2016 |
| APPL NO | 15/286371 |
| ART UNIT | 2866 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/311 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515046 | Fleming et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | Intel Corporation (Santa Clara, California) |
| INVENTOR(S) | Kermin Fleming (Hudson, Massachusetts); Kent D. Glossop (Merrimack, New Hampshire); Simon C. Steely, Jr. (Hudson, New Hampshire) |
| ABSTRACT | Systems, methods, and apparatuses relating to a configurable spatial accelerator are described. In one embodiment, a processor includes a synchronizer circuit coupled between an interconnect network of a first tile and an interconnect network of a second tile and comprising storage to store data to be sent between the interconnect network of the first tile and the interconnect network of the second tile, the synchronizer circuit to convert the data from the storage between a first voltage or a first frequency of the first tile and a second voltage or a second frequency of the second tile to generate converted data, and send the converted data between the interconnect network of the first tile and the interconnect network of the second tile |
| FILED | Saturday, July 01, 2017 |
| APPL NO | 15/640543 |
| ART UNIT | 2185 — Computer Architecture and I/O |
| CURRENT CPC | Electric Digital Data Processing G06F 9/5027 (20130101) G06F 13/423 (20130101) Original (OR) Class G06F 15/825 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515049 | Fleming et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intel Corporation (Santa Clara, California) |
| ASSIGNEE(S) | intel corporation (Santa Clara, California) |
| INVENTOR(S) | Kermin E. Fleming (Hudson, Massachusetts); Simon C. Steely (Hudson, New Hampshire); Kent D. Glossop (Merrimack, New Hampshire) |
| ABSTRACT | Methods and apparatuses relating to distributed memory hazard detection and error recovery are described. In one embodiment, a memory circuit includes a memory interface circuit to service memory requests from a spatial array of processing elements for data stored in a plurality of cache banks; and a hazard detection circuit in each of the plurality of cache banks, wherein a first hazard detection circuit for a speculative memory load request from the memory interface circuit, that is marked with a potential dynamic data dependency, to an address within a first cache bank of the first hazard detection circuit, is to mark the address for tracking of other memory requests to the address, store data from the address in speculative completion storage, and send the data from the speculative completion storage to the spatial array of processing elements when a memory dependency token is received for the speculative memory load request. |
| FILED | Saturday, July 01, 2017 |
| APPL NO | 15/640541 |
| ART UNIT | 2827 — Semiconductors/Memory |
| CURRENT CPC | Electric Digital Data Processing G06F 9/38 (20130101) G06F 9/3001 (20130101) G06F 9/3004 (20130101) G06F 9/3802 (20130101) G06F 9/30036 (20130101) G06F 9/30076 (20130101) G06F 15/7892 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515181 | Shehata et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| INVENTOR(S) | Andrea Bahgat Shehata (White Plains, New York); Peilin Song (Lagrangeville, New York); Franco Stellari (Waldwick, New Jersey) |
| ABSTRACT | Techniques facilitating integrated circuit identification and reverse engineering are provided. A computer-implemented method can comprise identifying, by a system operatively coupled to a processor, an element within a first elementary cell of one or more elementary cells of an integrated circuit. The method can also comprise matching, by the system, the element with respective elements across the one or more elementary cells including the first elementary cell. The respective elements can be replicas of the element. Further, matching the element with respective elements can be based on a layout analysis of the integrated circuit. |
| FILED | Wednesday, May 10, 2017 |
| APPL NO | 15/591691 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 17/50 (20130101) G06F 17/2705 (20130101) G06F 17/5045 (20130101) G06F 17/5081 (20130101) Original (OR) Class G06F 21/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515183 | Shehata et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | INTERNATIONAL BUSINESS MACHINES CORPORATION (Armonk, New York) |
| INVENTOR(S) | Andrea Bahgat Shehata (White Plains, New York); Peilin Song (Lagrangeville, New York); Franco Stellari (Waldwick, New Jersey) |
| ABSTRACT | Techniques facilitating integrated circuit identification and reverse engineering are provided. A computer-implemented method can comprise identifying, by a system operatively coupled to a processor, an element within a first elementary cell of one or more elementary cells of an integrated circuit. The method can also comprise matching, by the system, the element with respective elements across the one or more elementary cells including the first elementary cell. The respective elements can be replicas of the element. Further, matching the element with respective elements can be based on a layout analysis of the integrated circuit. |
| FILED | Thursday, December 14, 2017 |
| APPL NO | 15/842639 |
| ART UNIT | 2851 — Printing/Measuring and Testing |
| CURRENT CPC | Electric Digital Data Processing G06F 17/50 (20130101) G06F 17/2705 (20130101) G06F 17/5045 (20130101) G06F 17/5081 (20130101) Original (OR) Class G06F 21/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Commerce (DOC)
| US 10513768 | Lass et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GOVERNMENT OF THE UNITES STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF COMMERCE (Gaithersburg, Maryland) |
| ASSIGNEE(S) | GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF COMMERCE (Gaithersburg, Maryland) |
| INVENTOR(S) | Eric A. Lass (Montgomery Village, Maryland); Mark R. Stoudt (Germantown, Maryland); Carelyn Campbell (Germantown, Maryland); Tsineng Tony Ying (Silver Spring, Maryland) |
| ABSTRACT | A coinage cladding alloy for coinage includes nickel present in an amount from 5 wt. % to 7 wt. %, based on a total weight of the coinage cladding alloy; zinc present in an amount from 21 wt. % to 29 wt. %, based on the total weight of the coinage cladding alloy; manganese present in an amount from 12 wt. % to 16 wt. %, based on a total weight of the coinage cladding alloy; copper; an electrical conductivity from 2% International Annealed Copper Standard (IACS) to 3% IACS; and a color comprising a yellowness vector b* that is from 2 to 10, based on a CIE L*a*b* color space and determined in accordance with ASTM Standard E308-15 (2015). |
| FILED | Wednesday, October 19, 2016 |
| APPL NO | 15/297393 |
| ART UNIT | 1733 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Personal Adornments, e.g Jewellery; Coins A44C 21/00 (20130101) Casting of Metals; Casting of Other Substances by the Same Processes or Devices B22D 21/005 (20130101) Layered Products, i.e Products Built-up of Strata of Flat or Non-flat, e.g Cellular or Honeycomb, Form B32B 15/01 (20130101) Alloys C22C 1/02 (20130101) C22C 9/04 (20130101) Changing the Physical Structure of Non-ferrous Metals and Non-ferrous Alloys C22F 1/08 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514359 | Reyes-Hernandez et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GOVERNMENT OF UNITED STATES OF AMERICA, AS REPRESENTED BY SECRETARY (Gaithersburg, Maryland) |
| ASSIGNEE(S) | GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF COMMERCE (Gaithersburg, Maryland) |
| INVENTOR(S) | Darwin R. Reyes-Hernandez (Clarksburg, Maryland); Brian Nablo (Rockville, Maryland) |
| ABSTRACT | A dual dielectropheretic article for monitoring cell migration includes: a membrane to selectively migrate a plurality of cells across the membrane, the membrane including: a first surface to receive the cells; a second surface opposed to the first surface; and a plurality of communication paths disposed in the membrane to provide the selective migration of the cells across the membrane from the first surface to the second surface; a first electrode disposed on the first surface to: provide an electric field for dielectrophoresis of the cells at the first surface; and provide a first potential for monitoring an impedance at the first surface; and a third electrode disposed on the second surface to: provide an electric field for dielectrophoresis of the cells at the second surface; and provide a third potential for monitoring an impedance at the second surface. |
| FILED | Wednesday, November 16, 2016 |
| APPL NO | 15/353342 |
| ART UNIT | 1795 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Magnetic or Electrostatic Separation of Solid Materials From Solid Materials or Fluids; Separation by High-voltage Electric Fields B03C 5/005 (20130101) B03C 5/026 (20130101) B03C 2201/26 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/447 (20130101) G01N 27/44747 (20130101) G01N 27/44773 (20130101) Original (OR) Class G01N 33/4836 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10516140 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PIXELLIGENT TECHNOLOGIES, LLC (Baltimore, Maryland) |
| ASSIGNEE(S) | PIXELLIGENT TECHNOLOGIES, LLC (Baltimore, Maryland) |
| INVENTOR(S) | Zhiyun Chen (Rockville, Maryland); Gregory D. Cooper (Fulton, Maryland) |
| ABSTRACT | Light-emitting devices and methods of making the same are described whereby lenses of any array include a material with a higher refractive index than an encapsulation layer of a substrate layer, the refractive index of the material being in a range of greater than 1.7 to 1.9 at 400 nm. The material forming the lenses includes nanocomposite comprised of inorganic nanocrystals and a polymeric matrix, wherein the nanocrystals are selected from the group consisting of ZrO2, ZnO, MgO, HfO2, NbO5, Ta2O5 and Y2O3. A 3-4 micron thick sample of the nanocomposite has an optical transmittance of at least 80% over a range of 440 nm to 800 nm. |
| FILED | Tuesday, June 26, 2018 |
| APPL NO | 16/019300 |
| ART UNIT | 2811 — Semiconductors/Memory |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 3/0056 (20130101) G02B 3/0087 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/3211 (20130101) H01L 27/3244 (20130101) H01L 51/5253 (20130101) H01L 51/5275 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Transportation (USDOT)
| US 10514454 | Parrott |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The U.S.A, as represented by the Administrator of the Federal Aviation Administration (Atlantic City International Airport, New Jersey) |
| ASSIGNEE(S) | The United States of America, as represented by the Administrator of the Federal Aviation Administration (Washington, District of Columbia) |
| INVENTOR(S) | Daniel Parrott (Oklahoma City, Oklahoma) |
| ABSTRACT | Embodiments described herein provide for the improved detection of target(s) in the vicinity of cluttered environments such as wind farms, and for the reduction of false alarms resulting from wind turbines and other complex structures in such environments. Maximum amplitude readings of all non-zero Doppler frequency bins are determined for each resolution cell under test during a dwell and used to determine an aggregate threshold value. In one embodiment, the aggregate threshold value and an existing threshold value are compared and the higher value applied. A tracking sample period and a transition state delay are introduced to determine when the aggregate threshold value for each resolution cell under test should be updated. |
| FILED | Wednesday, May 24, 2017 |
| APPL NO | 15/603544 |
| ART UNIT | 3646 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Measuring Volume, Volume Flow, Mass Flow or Liquid Level; Metering by Volume G01F 1/663 (20130101) Measuring Linear or Angular Speed, Acceleration, Deceleration, or Shock; Indicating Presence, Absence, or Direction, of Movement G01P 5/241 (20130101) Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/415 (20130101) G01S 7/2922 (20130101) G01S 13/538 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10514463 | Weed |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Honeywell International Inc. (Morris Plains, New Jersey) |
| ASSIGNEE(S) | Honeywell International Inc. (Morris Plains, New Jersey) |
| INVENTOR(S) | Douglas Mark Weed (Forest Lake, Minnesota) |
| ABSTRACT | Systems and methods for monitoring excessive delay gradients using long reference receiver separation distances are provided. In one embodiment, a ground-based system comprising a plurality of reference receivers configured to receive satellite signals. The ground-based system further comprises a processor coupled to a memory. The processor is configured to determine whether the line of sight of a newly available satellite is within a gradient. The processor is further configured to determine a monitor measurement using accumulated carrier data for each pair of reference receivers of a plurality of reference receiver pairs. The processor is further configured to combine monitor measurements for a subset of the plurality of reference receiver pairs into a monitor discriminator. The processor is further configured to output an alert when the monitor discriminator exceeds a threshold. |
| FILED | Wednesday, March 30, 2016 |
| APPL NO | 15/085894 |
| ART UNIT | 3646 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 19/07 (20130101) Original (OR) Class G01S 19/08 (20130101) G01S 19/41 (20130101) G01S 19/43 (20130101) G01S 19/258 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Small Business Administration (SBA)
| US 10514384 | Kleinfeld et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alan Kleinfeld (La Jolla, California) |
| ASSIGNEE(S) | Alan Kleinfeld (La Jolla, California) |
| INVENTOR(S) | Alan Marc Kleinfeld (La Jolla, California); Andrew Henry Huber (Encinitas, California); James Patrick Kampf (San Diego, California); Thomas Kwan (San Diego, California); Baolong Zhu (San Diego, California) |
| ABSTRACT | A method for high throughput discovery of proteins fluorescently labeled at a cysteine residue and that undergo a change in fluorescence ratio at 2 wavelengths upon binding an unbound analyte is described. Probes are disclosed which are labeled at a cysteine residue and also probes labeled at both cysteine and lysine with two different fluorophores. These probes are useful for characterization and measurement of hydrophobic species in a fluid sample, particularly characterization and measurement of levels of unbound free fatty acids. A profile of unbound free fatty acids can be determined for an individual which can be used to determine the individual's relative risk for disease. |
| FILED | Friday, September 29, 2017 |
| APPL NO | 15/720260 |
| ART UNIT | 1639 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Peptides C07K 14/00 (20130101) C07K 14/47 (20130101) Combinatorial Chemistry; Libraries, e.g Chemical Libraries C40B 30/04 (20130101) C40B 40/10 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/68 (20130101) G01N 33/92 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 10515733 | Jing et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Euclid Techlabs, LLC (Solon, Ohio) |
| ASSIGNEE(S) | Euclid Techlabs, LLC (Solon, Ohio) |
| INVENTOR(S) | Chunguang Jing (Naperville, Illinois); Jiaqi Qiu (Zhejiang, China PRC); Ao Liu (Naperville, Illinois); Eric John Montgomery (Oak Park, Illinois); Yubin Zhao (Naperville, Illinois); Wade Rush (Lawrence, Kansas); Roman Kostin (Oak Park, Illinois); Alexei Kanareykin (Bethesda, Maryland) |
| ABSTRACT | An electromagnetic mechanical pulser implements a transverse wave metallic comb stripline TWMCS kicker having inwardly opposing teeth structured to retard a phase velocity of an RF traveling wave propagated therethrough to match the kinetic velocity of a continuous electron beam simultaneously propagated therethrough. The kicker imposes transverse oscillations onto the beam, which is subsequently chopped into pulses by an aperture. The RF phase velocity is substantially independent of RF frequency and amplitude, thereby enabling independent tuning of the electron pulse widths and repetition rate. The exterior surface of the kicker is conductive, thereby avoiding electron charging. In embodiments, various elements of the kicker and/or aperture can be mechanically varied to provide further tuning of the pulsed electron beam. A divergence suppression section can include a mirror TWMCS and/or magnetic quadrupoles. RF can be applied to a down-selecting TWMCS downstream of the aperture to reduce the pulse repetition rate. |
| FILED | Wednesday, April 24, 2019 |
| APPL NO | 16/393469 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Techniques for Handling Particles or Ionising Radiation Not Otherwise Provided For; Irradiation Devices; Gamma Ray or X-ray Microscopes G21K 1/043 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Homeland Security (DHS)
| US 10513542 | Puckette et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| INVENTOR(S) | Michael Puckette (Waterford, Connecticut); Max Rasmussen (Guilford, Connecticut); John Neilan (Wethersfield, Connecticut) |
| ABSTRACT | This application is directed generally to minicircle DNA vectors for the vaccination of foot-and-mouth disease (FMD). The transgene expression cassette in the minicircle DNA vector includes: a eukaryotic translation initiation nucleotide sequence, a mutant nucleotide sequence that encodes a foot-and-mouth disease virus (FMDV) capsid polyprotein precursor that contains at least one mutation to eliminate a restriction enzyme recognition site, a nucleotide sequence that encodes a protease that cleaves the FMDV capsid polyprotein precursor into a plurality of FMDV capsid proteins and a translational regulatory element to regulate the expression of the protease. The minicircle DNA vectors can be transfected directly into the cell of a mammalian host. When transfected into the mammalian host cell, virus-like particles can be produced intrinsically to stimulate the mammalian host's immune system to develop adaptive immunity toward foot-and-mouth disease. |
| FILED | Thursday, April 19, 2018 |
| APPL NO | 15/957376 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/00 (20130101) Peptides C07K 14/005 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 2770/32122 (20130101) C12N 2770/32123 (20130101) C12N 2770/32134 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56983 (20130101) G01N 2333/09 (20130101) G01N 2469/20 (20130101) G01N 2800/26 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Veterans Affairs (DVA)
| US 10513494 | Bertaccini et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Palo Alto, California); THE UNITED STATES GOVERNMENT AS REPRESENTED BY THE DEPARTMENT OF VETERANS AFFAIRS (Washington, District of Columbia) |
| ASSIGNEE(S) | The Board of Trustees of the Leland Stanford Junior University (Palo Alto, California); The United States Government as represented by the Department Of Veterans Affairs (Washington, District of Columbia) |
| INVENTOR(S) | Edward John Bertaccini (San Jose, California); Margaret Frances Davies (Palo Alto, California) |
| ABSTRACT | Methods of treatment useful in the inducement or maintenance of anesthesia in a subject are provided. The methods comprise administering to a subject in need of anesthesia a compound disclosed herein. Also provided are novel compounds having anesthetic effects, pharmaceutical compositions comprising the compounds, and packaged pharmaceuticals. Computer modeling of the compounds demonstrates favorable interactions with the GABA receptor type A. In addition, the compounds display reversible anesthetic effects in an animal model, with dose-response curves similar to those of known general anesthetics. GABA receptor-mediated effects are also demonstrated in a hippocampal brain slice preparation. |
| FILED | Wednesday, December 05, 2018 |
| APPL NO | 16/210631 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/40 (20130101) A61K 31/402 (20130101) Heterocyclic Compounds C07D 207/34 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Office of the Director of National Intelligence (ODNI)
| US 10514418 | Deslandes |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | FEI Company (Hillsboro, Oregon) |
| ASSIGNEE(S) | FEI Company (Hillsboro, Oregon) |
| INVENTOR(S) | Herve Deslandes (Sunnyvale, California) |
| ABSTRACT | A method for emission testing of a semiconductor device (DUT), by mounting the DUT onto an test bench of an emission tester, the emission tester having an optical detector; electrically connecting the DUT to an electrical tester; applying electrical test signals to the DUT while keeping test parameters constant; inserting an optical filters into an optical path of the emission tester and collecting emission test signal from the optical detector; removing the filter from the optical path and collecting emission test signal from the optical detector. Comparing the images obtained with and without the filter. The filter may be shortpass to obtain emission signal, a bandpass for detecting forward bias, or longpass to obtain thermal signal. |
| FILED | Wednesday, October 05, 2016 |
| APPL NO | 15/286371 |
| ART UNIT | 2866 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/311 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Government Rights Acknowledged
How To Use This Page
THE FEDINVENT PATENT DETAILS PAGE
Each week, FedInvent analyzes newly granted patents and published patent applications whose origins lead back to funding by the US Federal Government. The FedInvent Patent Details page is a companion to the weekly FedInvents Patents Report.
This week's information is published in the FedInvent Patents report for Tuesday, December 24, 2019.
The FedInvent Weekly Patent Details Page contains a subset of patent information to provide a deeper dive into the week’s taxpayer-funded patents to help the reader better understand where a patent fits in the federal innovation ecosphere.
HOW IS THE INFORMATION ORGANIZED?
Patents are organized by the funding agency. Within each group, the patents are organized in numeric order. A patent funded by more than one agency will appear in the section of each of the agencies that funded the research and development that resulted in the invention. This approach gives the reader a complete view of the department or agency activity for the week.
WHAT INFORMATION WILL I FIND?
THE PANEL
There is a panel for each patent that contains the patent number and the title of the patent. When you click the panel, it opens to reveal the following information:
FUNDED BY
The agencies that funded the grants, contracts, or other research agreements that resulted in the patent. FedInvent includes as much information on the source of the funding as possible. The information is presented in a hierarchy going from the Federal Department down to the agencies, subagencies, and offices that funded the work. Here are two examples:
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Army Research Office (ARO)
We do our best to provide detailed information about the funding. In some cases, the patent only reports limited information on the origins of the funding. FedInvents presents what it can confirm. We add the patents without the information required by the Bayh-Dole Act to our list of patents worthy of further investigation.
APPLICANT(S) and ASSIGNEES
FedInvent includes both the Applicants and the Assignees because having both provides more information about where the inventive work was done and by what organizations. Many organizations — universities, corporations, and federal agencies — standardize the Assignee/Owner information by the time a patent is granted. In the case of federal patents, many of the patents use the agency headquarters information for patent assignment.
Showing just the headquarters address would make Washington, DC the epicenter of all taxpayer-funded research and development. Providing both the applicant information and the assignee information provides a more accurate picture of where important taxpayer funded innovation is happening in America. Here are two examples from two different patents:
APPLICANT: U.S. Army Research Laboratory, Adelphi, MD
ASSIGNEE: The United States of America as represented by the Secretary of the Army Washington, DC
APPLICANT: Optech Ventures, LLC (Torrance, California)
ASSIGNEE(S): The Regents of the University of California (Oakland, California); Optech Ventures, LLC (Torrance, California)
INVENTOR(S)
The inventors appear in the same order as they appear on the patent. FedInvents presents the names in first name/last name order because they are easier to read than the last name/first name order of the names on the USPTO patent documents.
ABSTRACT
The abstract as it appears on the patent.
FILED
The date of the patent application including the day of the week.
APPL NO
This is the patent application serial number. If you’d like to learn more about how application serial numbers work you can go to the Lists Page.
ART UNIT
Patent data includes the Art Unit where a patent was examined. (The Art Unit isn’t available for published patent applications.) The Art Unit provides insight into what group of patent examiners prosecuted the patent application and the subject matter that the examiners work on. For example:
3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices
You can learn more about ART UNITS on the FedInvent Patents Weekly panel called About Tech Center or you can find information on the FedInvent Lists Page.
CURRENT CPC
Current CPC provides a list of the Cooperative Patent Classification symbols assigned to the patent. These are the CPC symbols assigned at the time the patent was granted.
The FedInvent Project is a patent classification maximalist endeavor or put another way, we believe that more you understand about patent classification the more you'll learn about the nature of the invention and the types of work that the federal government is funding.
The symbol presented in BOLD is the symbol identified as the "first" classification which is the most relevant classification on the patent. The date that follows the symbol is the date of the most recent revision to the art classed there.
- A61B 1/149 (20130101)
- A61B 1/71 (20130101)
- A61B 1/105 (20130101)
The CPC symbols match the classifications found on the PDF version of the patent. Over time, the classifications on the full-text version of the patent change to reflect how USPTO organizes patent art to support its examiners. The two sets of CPCs don’t always match.
VIEW PATENT
As of June 2021, we include two ways to view a patent at USPTO. FedInvent provides a link to the Full-Text Version of the patent and a link to the PDF version of the patent.
HOW DO I FIND A SPECIFIC PATENT ON A PAGE?
You can use the Command F or Control F to find a specific patent you are interested in.
HOW DO I GET HERE?
You navigate to the details of a patent by clicking the information icon that follows a patent on the FedInvent Patents Weekly Report.
You can also reach this page using the weekly page link that looks like this:
https://wayfinder.digital/fedinvent/patents-2022/fedinvent-patents-20191224.html
Just update the date portion of the URL. Tuesdays for patents. Thursdays for pre-grant publication of patent applications.
Download a copy of the How To Use This Page