FedInvent™ Patent Applications

Application Details for Thursday, November 04, 2021 

This page was updated on Friday, November 05, 2021 at 11:03 AM GMT

Department of Health and Human Services (HHS) 

US 20210337804 Roeder et al.
FUNDED BY
Environmental Protection Agency (EPA)
Department of Health and Human Services (HHS)
Centers for Disease Control and Prevention (CDC)
National Science Foundation (NSF)
APPLICANT(S) Jeffrey F. Roeder (Brookfield, Connecticut);  Melissa A. Petruska (Newtown, None);  Trevor E. James (Plantsville, Connecticut);  Thomas J. Spoonmore (Norwalk, Connecticut);  Peter C. Van Buskirk (Newtown, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Jeffrey F. Roeder (Brookfield, Connecticut);  Melissa A. Petruska (Newtown, None);  Trevor E. James (Plantsville, Connecticut);  Thomas J. Spoonmore (Norwalk, Connecticut);  Peter C. Van Buskirk (Newtown, Connecticut)
ABSTRACT Polymer coatings and surfaces are disclosed with antimicrobial properties. The antimicrobial action is provided by high surface area materials contained within the coating or surface. The high surface area materials may contain photocatalysts that create reactive oxygen species upon exposure to visible light or transition metals that create reactive oxygen species upon exposure to hydrogen peroxide. The high surface area materials may also sorb disinfecting liquids and desorb them over time to provide disinfection.
FILED Wednesday, June 09, 2021
APPL NO 17/343723
CURRENT CPC
Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators
A01N 25/10 (20130101)
A01N 59/06 (20130101)
A01N 59/20 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338092 Akbari et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Center for Advancing Translational Sciences (NCATS)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
National Science Foundation (NSF)
Directorate for Education and Human Resources (EHR)
Division of Graduate Education (DGE)
APPLICANT(S) THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California)
ASSIGNEE(S)
INVENTOR(S) Yama Akbari (Irvine, California);  Robert H. Wilson (Irvine, California);  Christian Crouzet (Irvine, California);  Thomas Milner (Irvine, California);  Bernard Choi (Irvine, California)
ABSTRACT A portable device for quantitative measurement of tissue autoregulation and neurovascular coupling via portable measurement of blood flow, oxygenation, metabolism, and/or EEG signals and methods for using said device. The device may comprise a body and a plurality of legs pivotably attached to the body. The plurality of legs may comprise at least one reference electrode leg and at least one measurement electrode leg for electrical measurement, and an optical detection fiber leg and at least one optical source fiber leg for optical blood flow, oxygenation, and metabolism measurement. The present invention is additionally directed to a portable device for blood flow measurement and therapeutic photobiomodulation. The device may comprise a body and a plurality of legs. The plurality of legs may comprise at least one optical detection fiber leg and at least one optical source fiber leg, and at least one leg for therapeutic photobiomodulation.
FILED Thursday, July 15, 2021
APPL NO 17/377123
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/0075 (20130101)
A61B 5/0261 (20130101) Original (OR) Class
A61B 5/6801 (20130101)
A61B 5/14553 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338121 ZAND et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) SURGISENSE CORPORATION (Bethesda, Maryland)
ASSIGNEE(S) SURGISENSE CORPORATION (BETHESDA, Maryland)
INVENTOR(S) Jason M. ZAND (Washington, District of Columbia);  Gregory S. FISCHER (Jamaica Plain, Massachusetts)
ABSTRACT A surgical instrument may be configured to sense a light re-emitting probe to resolve tissue oxygenation, the surgical instrument including: an optical emitter configured to excite the light re-emitting probe within an absorption band of the light re-emitting probe; an optical detector configured to receive the re-emitted light from the probe; and a signal processor configured to resolve the tissue oxygenation based on the received light. The surgical instrument can be a surgical stapler anvil or a flexible substrate having a tissue interfacing surface. Further, a monitoring device may be configured to map oxygenation of a tissue containing a light re-emitting probe, the monitoring device including: an optical emitter configured to excite the light re-emitting probe; at least one optical detector configured to receive the re-emitted light from the probe; and a signal processor that is configured to resolve the tissue oxygenation at multiple points to generate an oxygen map.
FILED Wednesday, July 14, 2021
APPL NO 17/375735
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/01 (20130101)
A61B 5/0059 (20130101)
A61B 5/1459 (20130101)
A61B 5/4836 (20130101)
A61B 5/6847 (20130101)
A61B 5/14552 (20130101)
A61B 5/14556 (20130101) Original (OR) Class
A61B 17/068 (20130101)
A61B 17/1155 (20130101)
A61B 17/07207 (20130101)

Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor
A61M 5/007 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338140 AMIR
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Mental Health (NIMH)
APPLICANT(S) San Diego State University (SDSU) Foundation, dba San Diego State University Research Foundation (San Diego, California)
ASSIGNEE(S)
INVENTOR(S) Nader AMIR (San Diego, California)
ABSTRACT In alternative embodiments, provided are products of manufacture, including devices and integrated systems, and methods, for reducing error-related negativity (ERN) and anxiety, and for treating or ameliorating Anxiety Disorders such as Generalized Anxiety Disorder (GAD) or Social Anxiety Disorder (SAD) and obsessive-compulsive disorder (OCD).
FILED Thursday, November 12, 2020
APPL NO 17/096368
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/31 (20210101)
A61B 5/38 (20210101)
A61B 5/055 (20130101)
A61B 5/165 (20130101)
A61B 5/291 (20210101)
A61B 5/297 (20210101)
A61B 5/315 (20210101)
A61B 5/372 (20210101)
A61B 5/375 (20210101) Original (OR) Class
A61B 5/378 (20210101)
A61B 5/384 (20210101)
A61B 5/386 (20210101)
A61B 5/398 (20210101)
A61B 5/486 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338195 Reiche et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) UNIVERSITY OF UTAH RESEARCH FOUNDATION (Salt Lake City, Utah)
ASSIGNEE(S)
INVENTOR(S) Christopher F. Reiche (Salt Lake City, Utah);  Navid Farhoudi (Salt Lake City, Utah);  Florian Solzbacher (Salt Lake City, Utah);  Jules J. Magda (Salt Lake City, Utah)
ABSTRACT Microresonator structures including a top polymer film layer, a bottom polymer film layer, and a smart hydrogel structure sandwiched between the polymer film layers. An ultrasound resonator cavity having a resonance frequency is defined between the top and bottom polymer layers, and the smart hydrogel structure is configured to provide a change in height to the ultrasound resonator cavity due to volumetric expansion or contraction of the smart hydrogel structure, in response to interaction of the smart hydrogel structure with one or more predefined analytes in an in vivo or other environment. Related methods of use for determining the presence or concentration of a given target analyte, as well as methods of fabricating such microresonator structures are also described.
FILED Friday, July 02, 2021
APPL NO 17/366743
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 8/481 (20130101)
A61B 8/0841 (20130101) Original (OR) Class
A61B 90/39 (20160201)
A61B 2090/3929 (20160201)

Preparations for Medical, Dental, or Toilet Purposes
A61K 49/226 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338205 Greenleaf et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) Mayo Foundation for Medical Education and Research (Rochester, Minnesota)
ASSIGNEE(S)
INVENTOR(S) James F. Greenleaf (Rochester, Minnesota);  Shigao Chen (Rochester, Minnesota);  Pengfei Song (Champaign, Illinois);  Armando Manduca (Rochester, Minnesota)
ABSTRACT Systems and methods for performing shear wave elastography using push and/or detection ultrasound beams that are generated by subsets of the available number of transducer elements in an ultrasound transducer. These techniques provide several advantages over currently available approaches to shear wave elastography, including the ability to use a standard, low frame rate ultrasound imaging system and the ability to measure shear wave speed throughout the entire field-of-view rather than only those regions where the push beams are not generated.
FILED Friday, July 09, 2021
APPL NO 17/372182
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 8/08 (20130101)
A61B 8/485 (20130101) Original (OR) Class
A61B 8/4488 (20130101)
A61B 8/4494 (20130101)
A61B 8/5223 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 29/07 (20130101)
G01N 29/262 (20130101)
G01N 2291/011 (20130101)
G01N 2291/0422 (20130101)
G01N 2291/02475 (20130101)
G01N 2291/02827 (20130101)

Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves
G01S 7/5209 (20130101)
G01S 7/52022 (20130101)
G01S 7/52042 (20130101)
G01S 15/8915 (20130101)
G01S 15/8927 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338383 TAPALTSYAN et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) UNIVERSITY OF CENTRAL OKLAHOMA (Edmond, Oklahoma)
ASSIGNEE(S)
INVENTOR(S) Vagan TAPALTSYAN (El Cerrito, California);  Morshed KHANDAKER (Edmond, Oklahoma);  Shahram RIAHINEZHAD (Fort Lee, New Jersey);  Rami Mohanad Mahdi ALKHALEELI (Edmond, Oklahoma);  Niyaf Nidhal Kadhem ALKADHEM (Edmond, Oklahoma)
ABSTRACT The present invention enables modification of an intraosseous implant device that is not only biologically non-inert, but can stimulate bone and vascular growth; decrease localized inflammation; and fight local infections. The method of the present invention provides a fiber with any of the following modifications: (1) Nanofiber with PDGF, (2) Nanofiber with PDGF+BMP2, and (3) Nanofiber with BMP2 and Ag. Nanofiber can be modified with other growth factors that have been shown to improve bone growth and maturation—BMP and PDGF being the most common. Nanofiber can be applied on the surface of the implant in several ways. First, a spiral micro-notching can be applied on the implant in the same direction as the threads with the nanofibers embedded into the notches. Second, the entire surface of the implant may be coated with a mesh of nanofibers. Third, it can be a combination of both embedding and notching.
FILED Tuesday, July 13, 2021
APPL NO 17/374700
CURRENT CPC
Dentistry; Apparatus or Methods for Oral or Dental Hygiene
A61C 8/0006 (20130101) Original (OR) Class
A61C 8/0013 (20130101)
A61C 8/0016 (20130101)
A61C 8/0022 (20130101)
A61C 13/0018 (20130101)

Preparations for Medical, Dental, or Toilet Purposes
A61K 6/891 (20200101)
A61K 6/898 (20200101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338408 MacEwan et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
NIH Office of the Director (NIHOD)
National Science Foundation (NSF)
Directorate for Computer and Information Science and Engineering (CISE)
Division of Electrical and Communications Systems (ECS)
APPLICANT(S) Washington University (St. Louis, Missouri)
ASSIGNEE(S)
INVENTOR(S) Matthew R. MacEwan (St. Louis, Missouri);  Jingwei Xie (St. Louis, Missouri);  Zack Ray (St. Louis, Missouri);  Younan Xia (St. Louis, Missouri)
ABSTRACT A multi-laminar electrospun nanofiber scaffold for use in repairing a defect in a tissue substrate is provided. The scaffold includes a first layer formed by a first plurality of electrospun polymeric fibers, and a second layer formed by a second plurality of electrospun polymeric fibers. The second layer is combined with the first layer. A first portion of the scaffold includes a higher density of fibers than a second portion of the scaffold, and the first portion has a higher tensile strength than the second portion. The scaffold is configured to degrade via hydrolysis after at least one of a predetermined time or an environmental condition. The scaffold is configured to be applied to the tissue substrate containing the defect, and is sufficiently flexible to facilitate application of the scaffold to uneven surfaces of the tissue substrate, and to enable movement of the scaffold by the tissue substrate.
FILED Friday, June 25, 2021
APPL NO 17/358463
CURRENT CPC
Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits
A61F 2/02 (20130101) Original (OR) Class
A61F 2/0063 (20130101)
A61F 2/105 (20130101)

Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles
A61L 15/22 (20130101)
A61L 15/42 (20130101)
A61L 27/14 (20130101)
A61L 27/50 (20130101)

Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing
B29C 48/05 (20190201)
B29C 48/142 (20190201)

Apparatus for Enzymology or Microbiology;
C12M 25/14 (20130101)

Mechanical Methods or Apparatus in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons
D01D 5/0076 (20130101)
D01D 5/0092 (20130101)

Making Textile Fabrics, e.g From Fibres or Filamentary Material; Fabrics Made by Such Processes or Apparatus, e.g Felts, Non-woven Fabrics; Cotton-wool; Wadding
D04H 1/728 (20130101)
D04H 3/016 (20130101)
D04H 3/073 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338569 VARMA et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS)
APPLICANT(S) PHI THERAPEUTICS, INC. (San Francisco, California)
ASSIGNEE(S)
INVENTOR(S) Yug VARMA (San Francisco, California);  Nancy VAN PROOYEN (San Francisco, California)
ABSTRACT Provided herein are, inter alia, compositions, systems, and methods for preventing or treating acne. Included are compositions, combinations, systems, and methods comprising at least one Propionibacterium acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier. Also included are compositions, combinations, and systems comprising a Propionibacterium acnes bacteriophage and an enzyme. Methods for preventing or treating acne are also provided.
FILED Friday, April 20, 2018
APPL NO 16/606158
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 8/22 (20130101)
A61K 8/23 (20130101)
A61K 8/062 (20130101)
A61K 8/064 (20130101)
A61K 8/66 (20130101)
A61K 8/99 (20130101) Original (OR) Class
A61K 8/347 (20130101)
A61K 8/368 (20130101)
A61K 8/671 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 17/10 (20180101)

Specific Use of Cosmetics or Similar Toilet Preparations
A61Q 19/00 (20130101)

Enzymes
C12Y 105/01001 (20130101)
C12Y 111/01 (20130101)
C12Y 304/21062 (20130101)
C12Y 304/21064 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338577 Freedman et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
APPLICANT(S) President and Fellows of Harvard College (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Benjamin Ross Freedman (Brookline, Massachusetts);  Oktay R. Uzun (Boston, Massachusetts);  David J. Mooney (Sudbury, Massachusetts);  Nadja M. Maldonado Luna (Cambridge, Massachusetts)
ABSTRACT The present invention is directed to a biodegradable tough adhesive material comprising an interpenetrating networks (IPN) hydrogel comprising a first polymer network and a second polymer network, wherein the first polymer network comprises a first polymer covalently crosslinked with a biodegradable covalent crosslinker and the second polymer network comprises a second polymer crosslinked with ionic or physical crosslinks; a high density primary amine polymer; and a coupling agent. The present invention also provides methods preparing and using the biodegradable tough adhesive material.
FILED Friday, October 11, 2019
APPL NO 17/283412
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/06 (20130101) Original (OR) Class
A61K 47/32 (20130101)
A61K 47/34 (20130101)
A61K 47/36 (20130101)
A61K 47/6903 (20170801)

Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles
A61L 24/0031 (20130101)
A61L 24/043 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338579 GAO et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The Board of Regents of the University of Texas System (Austin, Texas)
ASSIGNEE(S) The Board of Regents of the University of Texas System (Austin, Texas)
INVENTOR(S) Jinming GAO (Dallas, Texas);  Tongyi HUANG (Dallas, Texas);  Qiang FENG (Allen, Texas);  Baran SUMER (Dallas, Texas)
ABSTRACT Described herein are therapeutic pH responsive compositions comprising a block copolymer and a therapeutic agent useful for the treatment of cancer.
FILED Monday, April 26, 2021
APPL NO 17/239742
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/1075 (20130101) Original (OR) Class
A61K 31/519 (20130101)
A61K 31/5025 (20130101)
A61K 45/06 (20130101)
A61K 47/32 (20130101)
A61K 47/34 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 5/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338585 Bloembergen et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
Small Business Administration (SBA)
Small Business Innovation Research (SBIR)
APPLICANT(S) GreenMark Biomedical Inc. (East Lansing, Michigan)
ASSIGNEE(S)
INVENTOR(S) Steven Bloembergen (Okemos, Michigan);  Ian J. McLennan (Burlington, Canada);  Nathan Jones (Hamilton, Canada);  Ryan Wagner (Kitchener, Canada);  Aareet Mahadevan (Waterloo, Canada);  Abdel Rahman Elsayed (Waterloo, Canada);  Juewen Liu (Kitchener, Canada)
ABSTRACT A delivery device for an active agent comprises nanoparticles based on a biopolymer such as starch. The delivery device may also be in the form of an aptamer-biopolymer-active agent conjugate wherein the aptamer targets the device for the treatment of specific disorders. The nanoparticles may be made by applying a high shear force in the presence of a crosslinker. The particles may be predominantly in the range of 50-150 nm and form a colloidal dispersion of crosslinked hydrogel particles in water. The biopolymer may be functionalized. The aptamer may be conjugated directly to the cross-linked biopolymers. The active agent may be a drug useful for the treatment of cancer. The delivery device survives for a period of time in the body sufficient to allow for the sustained release of a drug and for the transportation and uptake of the conjugate into targeted cells. However, the biopolymer is biocompatible and resorbable.
FILED Thursday, July 15, 2021
APPL NO 17/376837
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/145 (20130101) Original (OR) Class
A61K 9/1676 (20130101)
A61K 9/5161 (20130101)
A61K 31/704 (20130101)
A61K 47/36 (20130101)
A61K 47/549 (20170801)
A61K 47/6939 (20170801)

Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 5/00 (20130101)

Polysaccharides; Derivatives Thereof
C08B 31/003 (20130101)
C08B 31/185 (20130101)
C08B 33/00 (20130101)
C08B 35/00 (20130101)

Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests
Y10S 977/773 (20130101)
Y10S 977/906 (20130101)

Technical Subjects Covered by Former US Classification
Y10T 428/2982 (20150115)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338593 Ferrari et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army Medical Research and Materiel Command (USAMRMC)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Aeronautics and Space Administration (NASA)
APPLICANT(S) Board of Regents of the University of Texas System (Austin, Texas);  The Ohio State University Research Foundation (Columbus, Ohio)
ASSIGNEE(S) Board of Regents of the University of Texas System (Austin, Texas);  The Ohio State University Research Foundation (Columbus, Ohio)
INVENTOR(S) Mauro Ferrari (Houston, Texas);  Ennio Tasciotti (Houston, Texas);  Jason Sakamoto (Houston, Texas)
ABSTRACT Multistage delivery vehicles are disclosed which include a first stage particle and a second stage particle. The first stage particle is a micro or nanoparticle that contains the second stage particle. The second stage particle includes an active agent, such as a therapeutic agent or an imaging agent. The multistage delivery vehicle allows sequential overcoming or bypassing of biological barriers. The multistage delivery vehicle is administered as a part of a composition that includes a plurality of the vehicles. Methods of making the multistage delivery vehicles are also provided.
FILED Tuesday, July 06, 2021
APPL NO 17/368401
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/50 (20130101) Original (OR) Class
A61K 9/51 (20130101)
A61K 9/127 (20130101)
A61K 9/1271 (20130101)
A61K 31/165 (20130101)
A61K 31/704 (20130101)
A61K 31/7088 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338615 Li et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Memorial Sloan Kettering Cancer Center (New York, New York)
ASSIGNEE(S)
INVENTOR(S) Ming Li (New York, New York);  Min Peng (New York, New York);  Na Yin (New York, New York)
ABSTRACT Provided are methods for treating or preventing T cell-mediated diseases or disorders by administering an inhibitor of acetyl-CoA production, such as an inhibitor of lactate dehydrogenase A or an inhibitor of ATP-citrate lyase.
FILED Friday, July 09, 2021
APPL NO 17/372272
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)
A61K 9/0053 (20130101)
A61K 31/10 (20130101)
A61K 31/192 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 37/06 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338624 Vockley et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania)
ASSIGNEE(S) University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania)
INVENTOR(S) Gerard Vockley (Pittsburgh, Pennsylvania);  Al-Walid A. Mohsen (Pittsburgh, Pennsylvania)
ABSTRACT Methods of treating propionic acidemia (PA), methylmalonic acidemia (MMA) and fatty acid oxidation disorders are described. The methods include administering an anaplerotic agent that can directly enter the tricarboxylic acid cycle, such as a succinate derivative or pro-drug, for example trisuccinylglycerol (TSG). Methods of restoring tricarboxylic acid (TCA) cycle function in a cell deficient for propionyl-CoA carboxylase (PCC) or methylmalonyl-CoA mutase (MUT) by contacting the cell with a succinate derivative or pro-drug, such as TSG, are also described.
FILED Wednesday, July 07, 2021
APPL NO 17/369268
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/225 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 3/00 (20180101)

Acyclic or Carbocyclic Compounds
C07C 69/66 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338628 Lopez-Mejias et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
National Science Foundation (NSF)
Directorate for Education and Human Resources (EHR)
Division of Human Resource Development (HRD)
Directorate for Mathematical and Physical Sciences (MPS)
Division of Chemistry (CHE)
APPLICANT(S) Vilmali Lopez-Mejias (San Juan, Puerto Rico);  Jeaninna P. Flores Bello (San Juan, Puerto Rico);  Israel Rodriguez Rodriguez (San Juan, Puerto Rico);  Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico)
ASSIGNEE(S)
INVENTOR(S) Vilmali Lopez-Mejias (San Juan, Puerto Rico);  Jeaninna P. Flores Bello (San Juan, Puerto Rico);  Israel Rodriguez Rodriguez (San Juan, Puerto Rico);  Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico)
ABSTRACT A series of pharmaceutical metal complexes (pMCs) were produced and characterized using the mast cell stabilizer, cromolyn, and bioactive metal ions (Zn+2, Mg+2, and Ca+2). Three novel pMCs, Cromolyn-Zn, Cromolyn-Mg, and Cromolyn-Ca were formed through reactions under controlled temperature and pH conditions. TGA demonstrated that these metal complexes showed an enhanced thermal stability due to the strong coordination with the ligand, cromolyn. PXRD data indicates a high degree of crystallinity as well as a unique packing arrangement for each pMCs. SEM analysis showed materials with well-defined morphologies while EDS presented elemental evidence for the unique composition of each pMCs. The crystal structure for these materials was elucidated through SCXRD, and a variety of binding modes and packing motifs were found within each respective metal complex. Only 2D structures were achieved under the conditions studied. Dissolution studies show high stability and slow degradation for the metal complexes, while a higher dissolution was observed for the drug compound in PBS. Neither CS nor the pMCs dissolved significantly in FaSSGF at 37° C.
FILED Tuesday, May 04, 2021
APPL NO 17/307208
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/315 (20130101) Original (OR) Class
A61K 31/352 (20130101)

General Methods of Organic Chemistry; Apparatus Therefor
C07B 2200/13 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338630 Basile et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) The Trustees of Indiana University (Bloomington, Indiana)
ASSIGNEE(S) The Trustees of Indiana University (Bloomington, Indiana)
INVENTOR(S) David P. Basile (Indianapolis, Indiana);  Purvi Mehrotra (Carmel, Indiana);  Michael S. Sturek (Indianapolis, Indiana)
ABSTRACT Disclosed are methods to treat a renal disorder in a mammal in need thereof by administering to the mammal in need of treatment an effective amount of a store operated calcium entry (SOCE) inhibitor or a pharmaceutically acceptable salt thereof.
FILED Friday, October 04, 2019
APPL NO 17/282401
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/352 (20130101) Original (OR) Class
A61K 31/433 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 13/12 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338632 Li et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
U.S. State Government
State of Texas
Cancer Prevention and Research Institute of Texas (TX-CPRIT)
APPLICANT(S) The Board of Regents of the University of Texas System (Austin, Texas)
ASSIGNEE(S) The Board of Regents of the University of Texas System (Austin, Texas)
INVENTOR(S) Rong Li (San Antonio, Texas);  Bin Yuan (San Antonio, Texas);  Tyler Curiel (San Antonio, Texas)
ABSTRACT The present invention provides methods and compositions for treating or preventing breast cancer with S-equol. The method and compositions are particularly suited to treating triple-negative breast cancer. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule.
FILED Friday, July 09, 2021
APPL NO 17/372352
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/353 (20130101) Original (OR) Class
A61K 39/3955 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 16/2818 (20130101)
C07K 16/2827 (20130101)
C07K 2317/21 (20130101)
C07K 2317/24 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338659 CHEN et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE CHILDREN'S MEDICAL CENTER CORPORATION (Boston, Massachusetts)
ASSIGNEE(S) THE CHILDREN'S MEDICAL CENTER CORPORATION (Boston, Massachusetts)
INVENTOR(S) Bing CHEN (Boston, Massachusetts);  Gary FREY (Boston, Massachusetts);  Tianshu XIAO (Boston, Massachusetts)
ABSTRACT Described herein are compounds that inhibits the membrane proximal external region (MPER) of a viral envelope (Env), as well as and compositions thereof. Further provided herein are methods for treating or preventing a viral infection comprises administering to a subject in need thereof an agent or compound that inhibits the MPER of a viral Env. In certain embodiments, the viral infection is an HIV infection.
FILED Friday, July 26, 2019
APPL NO 17/262540
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/4709 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338670 Carlucci et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) New York University (New York, New York);  Memorial Sloan Kettering Cancer Center (New York, New York)
ASSIGNEE(S)
INVENTOR(S) Giuseppe Carlucci (New York, New York);  Thomas Reiner (New York, New York)
ABSTRACT Disclosed are compounds having the following structure:
CDK-L-(X)n, where CDK is a CDK4/6 inhibitor group, L is a linking group, X is a radiolabel or hydrogen, n is 1, 2, 3, 4, or 5, and when there are a plurality of X groups, at least one X is a radiolabel. Also described are methods of making and using the compounds. The compounds may be used in PET imaging to quantify CDK4/6 expression in cancers and to treat cancer patients exhibiting tumors which express CDK4/6.
FILED Friday, April 30, 2021
APPL NO 17/246291
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/506 (20130101) Original (OR) Class

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/57415 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338676 Kwiek et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) Duke University (Durham, North Carolina);  Ohio State Innovation Foundation (Columbus, Ohio)
ASSIGNEE(S) Duke University (Durham, North Carolina);  Ohio State Innovation Foundation (Columbus, Ohio)
INVENTOR(S) Jesse Kwiek (Worthington, Ohio);  Timothy Haystead (Chapel Hill, North Carolina);  Philip Hughes (Chapel Hill, North Carolina);  Yazan Alwarawrah (Durham, North Carolina)
ABSTRACT The present disclosure relates to a method for inhibiting Fatty Acid. Synthase (FASN) with, a FASN inhibitor, methods for treating cancer and viral infections with a FASN inhibitor, and compounds and compositions inhibiting FASN,
FILED Friday, April 02, 2021
APPL NO 17/221649
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/519 (20130101) Original (OR) Class
A61K 31/555 (20130101)
A61K 33/243 (20190101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/18 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338680 Martemyanov et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Drug Abuse (NIDA)
APPLICANT(S) The Scripps Research Institute (La Jolla, California)
ASSIGNEE(S) The Scripps Research Institute (La Jolla, California)
INVENTOR(S) Kirill Martemyanov (Jupiter, Florida);  Brock Grill (Lake Worth, Florida)
ABSTRACT The present invention provides methods for modulating opioid receptor mediated analgesic effect, e.g., promoting or enhancing analgesia in subjects in need of pain relief. Also provided in the invention are methods for ameliorating or suppressing withdrawal symptoms in subjects with chronic opioid use. These methods of the invention entail administering to the subjects in need of treatment a therapeutically effective amount of a GPR139 antagonist compound. The invention further provides methods for identifying novel compounds that can be useful for modulating opioid receptor mediated analgesic effect.
FILED Tuesday, October 15, 2019
APPL NO 17/286187
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/095 (20130101)
A61K 31/166 (20130101)
A61K 31/175 (20130101)
A61K 31/397 (20130101)
A61K 31/519 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 25/36 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338685 JENNINGS et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) Griffith University (Nathan, Queensland, Australia);  Research Institute at Nationwide Children's Hospital (Columbus, Ohio)
ASSIGNEE(S)
INVENTOR(S) Michael P. JENNINGS (Nathan, Queensland, Australia);  Jennifer L. EDWARDS (Columbus, Ohio);  Christopher J. DAY (Nathan, Queensland, Australia);  Johnson MAK (Nathan, Queensland, Australia)
ABSTRACT The present disclosure relates to the use of ligands of complement receptor 3, including ligands of the I domain of the alpha subunit of this receptor, in methods, compositions and articles/devices for inhibiting the interaction of pathogens to a complement receptor 3-expressing cell and for treating or inhibiting the development of infections caused by such pathogens.
FILED Monday, September 30, 2019
APPL NO 17/280603
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0014 (20130101)
A61K 9/0039 (20130101)
A61K 31/55 (20130101) Original (OR) Class
A61K 31/196 (20130101)
A61K 31/198 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/04 (20180101)
A61P 31/18 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338705 Adair et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Center for Advancing Translational Sciences (NCATS)
National Cancer Institute (NCI)
APPLICANT(S) THE PENN STATE RESEARCH FOUNDATION (University Park, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) James H. Adair (State College, Pennsylvania);  Gail L. Matters (Hummelstown, Pennsylvania);  Welley S. Loc (University Park, Pennsylvania);  Amra Tabakovic (State College, Pennsylvania);  Mark Kester (Harrisburg, Pennsylvania);  Sam Linton (Hershey, Pennsylvania);  Christopher McGovern (Harrisburg, Pennsylvania);  Xiaomeng Tang (University Park, Pennsylvania);  Gary A. Clawson (Bethesda, Maryland);  Jill P. Smith (Washington, District of Columbia);  Tye Deering (Charlottesville, Virginia)
ABSTRACT Method of producing nanoparticle of drug and imaging agents are provided. The phosphorylated encapsulated drugs and imaging agents could be encapsulated at therapeutic levels, were encapsulated at higher amounts. The CPSNPs were more effective in treating cancer, in reducing cancer proliferation, arresting cancer cell growth than when not in the form of a CPSNP, and showed efficacious treatment of cancer cells at far lower dosage than free molecules. Calcium phosphosilicate and phosphate nanoparticles are disclosed and their method of use. The methods and nanoparticles are particularly efficacious where CPSNPs were used to encapsulate 5-FU metabolites such as FdUMP and gemcitabine metabolites.
FILED Wednesday, June 09, 2021
APPL NO 17/303878
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/5115 (20130101)
A61K 9/5146 (20130101)
A61K 31/513 (20130101)
A61K 31/7068 (20130101)
A61K 31/7072 (20130101) Original (OR) Class

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/115 (20130101)
C12N 2310/16 (20130101)
C12N 2320/32 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338723 Fehniger et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Washington University (St. Louis, Missouri)
ASSIGNEE(S) Washington University (St. Louis, Missouri)
INVENTOR(S) Todd Fehniger (St. Louis, Missouri);  Melissa Berrien-Elliott (St. Louis, Missouri)
ABSTRACT Among the various aspects of the present disclosure are provisions for methods of, and compositions for, increasing NK cell anti-tumor response, screening donors, and predicting response to NK cell therapy.
FILED Thursday, January 21, 2021
APPL NO 17/154889
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101) Original (OR) Class
A61K 38/19 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 16/30 (20130101)
C07K 16/2815 (20130101)
C07K 2319/02 (20130101)
C07K 2319/03 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0646 (20130101)
C12N 15/1138 (20130101)
C12N 2310/11 (20130101)
C12N 2310/14 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/5005 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338731 Riley et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) James L. Riley (Downingtown, Pennsylvania);  James A. Hoxie (Berwyn, Pennsylvania);  George J. Leslie (Philadelphia, Pennsylvania);  Max W. Richardson (Philadelphia, Pennsylvania)
ABSTRACT The present invention relates to engineered cells expressing a fusion protein comprising a peptide fusion inhibitor and a CXCR4 protein that lacks signaling activity. Also provided are methods of suppressing, inhibiting, preventing or treating a HIV infection in a subject in need thereof using the engineered cells.
FILED Monday, May 03, 2021
APPL NO 17/306613
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/18 (20180101)

Peptides
C07K 14/162 (20130101)
C07K 14/7158 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/62 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338738 KING et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Vanderbilt University (Nashville, Tennessee)
ASSIGNEE(S) Vanderbilt University (Nashville, Tennessee)
INVENTOR(S) Michael R. KING (Nashville, Tennessee);  Nidhi JYOTSANA (Nashville, Tennessee)
ABSTRACT The present disclosure describes engineering of cells to co-express TNF-Related Apoptosis-Inducing Ligand (TRAIL) and Decoy Receptor 1 (DcR1). The expression of DcR1 results in competition for TRAIL binding to Death Receptors 4 and 5, thereby protecting the engineered cells from TRAIL-induced apoptosis. Such cells will exhibit longer survival such as when used in cell-based therapies for cancer.
FILED Monday, May 03, 2021
APPL NO 17/306153
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0014 (20130101)
A61K 9/0019 (20130101)
A61K 35/28 (20130101) Original (OR) Class
A61K 45/06 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 14/70575 (20130101)
C07K 14/70578 (20130101)
C07K 2319/50 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0647 (20130101)
C12N 2510/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338754 THORNE
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Stephen H. THORNE (Pittsburgh, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) Stephen H. THORNE (Pittsburgh, Pennsylvania)
ABSTRACT This disclosure relates to modified viruses, e.g., oncolytic vaccinia viruses, which have been modified to contain an exogenous nucleic acid that codes for a variant HMGB1 protein. It provides, at least in part, that vaccinia viruses modified to contain nucleic acid encoding variant HMGB1 and that express a variant HMGB1 or a fragment thereof can achieve a synergistic effect in combination with chemotherapy. Further, this disclosure provides for oncolytic vaccinia viruses and methods of using them in the treatment of various cancers.
FILED Tuesday, June 01, 2021
APPL NO 17/335430
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7088 (20130101)
A61K 35/768 (20130101) Original (OR) Class
A61K 45/06 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 14/4702 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 2710/24132 (20130101)

Technologies for Adaptation to Climate Change
Y02A 50/30 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338772 Kachlany et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Dental and Craniofacial Research (NIDCR)
APPLICANT(S) Rutgers, The State University of New Jersey (New Brunswick, New Jersey);  Actinobac Biomed, Inc. (Princeton, New Jersey)
ASSIGNEE(S) Rutgers, The State University of New Jersey (New Brunswick, New Jersey);  Actinobac Biomed, Inc. (Princeton, New Jersey)
INVENTOR(S) Scott C. Kachlany (Bridgewater, New Jersey);  Benjamin A. Belinka, JR. (Newtown, Connecticut)
ABSTRACT This invention concerns compositions and methods of treating or diagnosing inflammatory disorders and other disorders, as well as compositions and methods of treating HIV.
FILED Thursday, April 01, 2021
APPL NO 17/220573
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/164 (20130101) Original (OR) Class
A61K 39/3955 (20130101)
A61K 45/06 (20130101)
A61K 47/6849 (20170801)
A61K 51/1093 (20130101)
A61K 2039/55544 (20130101)

Peptides
C07K 16/2896 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/5052 (20130101)
G01N 33/56911 (20130101)
G01N 33/56988 (20130101)
G01N 2800/26 (20130101)
G01N 2800/52 (20130101)
G01N 2800/709 (20130101)
G01N 2800/7095 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338776 FIKRIG et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) YALE UNIVERSITY (New Haven, Connecticut)
ASSIGNEE(S) YALE UNIVERSITY (New Haven, Connecticut)
INVENTOR(S) Erol FIKRIG (Guilford, Connecticut);  Ryuta URAKI (New Haven, Connecticut);  Andrew HASTINGS (Hamden, Connecticut)
ABSTRACT The invention is directed to compositions comprising mosquito (e.g., Aedes aegypti) salivary polypeptides and related methods for preventing and/or treating mosquito-borne viral infections such as infections caused by flaviviruses and alphaviruses. The flavivirus that is prevented or treated includes Zika virus, West Nile virus, Dengue virus, tick-borne encephalitis virus, and yellow fever virus.
FILED Thursday, September 05, 2019
APPL NO 17/274086
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/1767 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338783 Goodman et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Deafness and Other Communication Disorders (NIDCD)
APPLICANT(S) RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio)
ASSIGNEE(S) RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio)
INVENTOR(S) Steven David Goodman (Columbus, Ohio);  Lauren Opremcak Bakaletz (Columbus, Ohio)
ABSTRACT Provided herein are methods to inhibit or disrupt a bio film comprising contacting the bio film with an agent that cleaves the Holliday junction (HJ) structure in the bio film.
FILED Friday, October 04, 2019
APPL NO 17/282341
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/54 (20130101)
A61K 38/465 (20130101) Original (OR) Class

Enzymes
C12Y 301/22004 (20130101)
C12Y 306/04012 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338787 Rothenberg et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) CHILDREN'S HOSPITAL MEDICAL CENTER (Cincinnati, Ohio)
ASSIGNEE(S)
INVENTOR(S) Marc E. Rothenberg (Cincinnati, Ohio);  Nurit P. Azouz (Cincinnati, Ohio)
ABSTRACT The present invention relates to methods for treating or preventing a coronavirus infection with serine protease inhibitors targeted against the host protease, transmembrane serine protease 2 (TMPRSS2), and related compositions and methods.
FILED Wednesday, April 28, 2021
APPL NO 17/302247
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/245 (20130101)
A61K 38/57 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/14 (20180101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/502 (20130101)
G01N 33/573 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338789 Khan et al.
FUNDED BY
Department of Defense (DOD)
Defense Medical Research and Development Program (DMRDP)
Joint Warfighter Medical Research Program (JWMRP)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts);  Whitehead Institute for Biomedical Research (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Omar F. Khan (Cambridge, Massachusetts);  Jasdave S. Chahal (Arlington, Massachusetts);  Daniel G. Anderson (Cambridge, Massachusetts);  Hidde Ploegh (Brookline, Massachusetts);  Robert S. Langer (Cambridge, Massachusetts);  Tyler E. Jacks (Cambridge, Massachusetts);  David A. Canner (Cambridge, Massachusetts)
ABSTRACT Compositions and methods for modified dendrimer nanoparticle (“MDNP”) delivery of therapeutic, prophylactic and/or diagnostic agent such as large repRNA molecules to the cells of a subject have been developed. MDNPs efficiently drive proliferation of antigen-specific T cells against intracellular antigen, and potentiate antigen-specific antibody responses. MDNPs can be multiplexed to deliver two or more different repRNAs to modify expression kinetics of encoded antigens and to simultaneous deliver repRNAs and mRNAs including the same UTR elements that promote expression of encoded antigens.
FILED Wednesday, March 10, 2021
APPL NO 17/198037
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)
A61K 9/5146 (20130101)
A61K 31/713 (20130101)
A61K 39/002 (20130101)
A61K 39/0012 (20130101) Original (OR) Class
A61K 39/12 (20130101)
A61K 39/145 (20130101)
A61K 48/00 (20130101)
A61K 2039/53 (20130101)
A61K 2039/70 (20130101)
A61K 2039/645 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/87 (20130101)
C12N 15/88 (20130101)
C12N 2740/16234 (20130101)
C12N 2760/14134 (20130101)
C12N 2760/16034 (20130101)
C12N 2770/24134 (20130101)
C12N 2770/36143 (20130101)

Technologies for Adaptation to Climate Change
Y02A 50/30 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338790 Okada
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania)
ASSIGNEE(S) University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania)
INVENTOR(S) Hideho Okada (Pittsburgh, Pennsylvania)
ABSTRACT Provided herein are interleukin-13 receptor α2 peptide-based brain cancer vaccines and methods for treating and vaccinating against brain cancer comprising administering to patients in need thereof interleukin-13 receptor α2 peptide-based brain cancer vaccines. Also provided herein are regimens comprising interleukin-13 receptor α2 peptides and at least one additional peptide and/or immunostimulant.
FILED Wednesday, December 02, 2020
APPL NO 17/109463
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)
A61K 38/17 (20130101)
A61K 38/177 (20130101)
A61K 38/1709 (20130101)
A61K 38/2086 (20130101)
A61K 39/39 (20130101)
A61K 39/00115 (20180801)
A61K 39/001119 (20180801) Original (OR) Class
A61K 39/001122 (20180801)
A61K 39/001153 (20180801)
A61K 39/001192 (20180801)
A61K 2039/70 (20130101)
A61K 2039/572 (20130101)
A61K 2039/5154 (20130101)
A61K 2039/55566 (20130101)
A61K 2039/55583 (20130101)

Peptides
C07K 14/705 (20130101)
C07K 14/4703 (20130101)
C07K 14/4705 (20130101)
C07K 14/7155 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338793 Peabody et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) UNM RAINFOREST INNOVATIONS (Albuquerque, New Mexico)
ASSIGNEE(S)
INVENTOR(S) David S. Peabody (Albuquerque, New Mexico);  Bryce Chackerian (Albuquerque, New Mexico)
ABSTRACT The present invention relates to a system and method for controlling peptide display valency on virus-like particles (VLPs), especially including MS2 VLPs. In this method, large amounts of wild-type and low quantities of single-chain dimer coat proteins may be produced from a single RNA. Valency is controlled in immunogen (vaccine) production by providing a system that allows the production of large amounts of wild-type and low quantities of single-chain dimer coating proteins from a single RNA, allowing facile adjustment of display valency levels on VLPs, especially MS2 VLPS over a wide range, from few than one-on average- to as many as ninety per particle. This facilitates the production of immunogens and vaccines, including VLPs exhibiting low valency. Nucleic acid constructs useful in the expression of virus-like particles are disclosed, comprised of a coat polypeptide of MS2 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates MS2 niRNA. Nucleic acid constructs are also disclosed which are useful in the expression of virus-like particles comprised of a coat polypeptide of PP7 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates PP7 mRNA.
FILED Thursday, April 29, 2021
APPL NO 17/244255
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 39/07 (20130101)
A61K 39/12 (20130101) Original (OR) Class

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 7/00 (20130101)
C12N 15/1037 (20130101)

Combinatorial Chemistry; Libraries, e.g Chemical Libraries
C40B 40/02 (20130101)
C40B 40/08 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338795 Hinrichs et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
ASSIGNEE(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
INVENTOR(S) Christian S. Hinrichs (Bethesda, Maryland);  Steven A. Rosenberg (Potomac, Maryland)
ABSTRACT Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed.
FILED Monday, July 12, 2021
APPL NO 17/372927
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101)
A61K 39/12 (20130101) Original (OR) Class
A61K 2039/5158 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0636 (20130101)
C12N 5/0638 (20130101)
C12N 7/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338796 Hinrichs et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
ASSIGNEE(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
INVENTOR(S) Christian S. Hinrichs (Bethesda, Maryland);  Steven A. Rosenberg (Potomac, Maryland)
ABSTRACT Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed.
FILED Monday, July 12, 2021
APPL NO 17/373093
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101)
A61K 39/12 (20130101) Original (OR) Class
A61K 2039/5158 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0636 (20130101)
C12N 5/0638 (20130101)
C12N 7/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338797 Hinrichs et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
ASSIGNEE(S) The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland)
INVENTOR(S) Christian S. Hinrichs (Bethesda, Maryland);  Steven A. Rosenberg (Potomac, Maryland)
ABSTRACT Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed.
FILED Monday, July 12, 2021
APPL NO 17/373130
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101)
A61K 39/12 (20130101) Original (OR) Class
A61K 2039/5158 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0636 (20130101)
C12N 5/0638 (20130101)
C12N 7/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338800 PICKER et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) OREGON HEALTH and SCIENCE UNIVERSITY (Portland, Oregon)
ASSIGNEE(S)
INVENTOR(S) Louis J. PICKER (Portland, Oregon);  Michael A. JARVIS (Portland, Oregon);  Jay A. NELSON (Lake Oswego, Oregon)
ABSTRACT Particular aspects provide for use of the β-herpesvirus Cytomegalovirus (CMV: e.g., RhCMV and HCMV) as a uniquely evolved “vector” for safely initiating and indefinitely maintaining high level cellular and humoral immune responses (against, e.g., HIV, SIV, TB, etc.). Particular aspects provide a method for treatment or prevention of, e.g., HIV, SIV or TB, comprising infection of a subject in need thereof with at least one recombinant CMV-based vector (e.g., HCMV or RhCMV) comprising an expressible HIV/SIV/TB antigen or a variant or fusion protein thereof. In particular embodiments of the method, infection is of an immunocompetent, HCMV or RhCMV seropositive subject. Additional aspects provide for RhCMV- and HCMV-based vaccine vectors, and versions thereof with suicide or safety means. Further aspects provide pharmaceutical compositions comprising the inventive CMV-based vaccine vectors.
FILED Monday, November 09, 2020
APPL NO 17/092941
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 39/04 (20130101)
A61K 39/12 (20130101)
A61K 39/21 (20130101) Original (OR) Class
A61K 2039/53 (20130101)

Peptides
C07K 14/005 (20130101)
C07K 16/088 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 7/00 (20130101)
C12N 15/86 (20130101)
C12N 2740/16034 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338804 Parks et al.
FUNDED BY
Department of Health and Human Services (HHS)
Assistant Secretary for Preparedness and Response (ASPR)
Biomedical Advanced Research and Development Authority (BARDA)
APPLICANT(S) International AIDS Vaccine Initiative Inc. (New York, New York);  Merck Sharp and Dohme Corp. (Rahway, New Jersey)
ASSIGNEE(S) International AIDS Vaccine Initiative Inc. (New York, New York);  Merck Sharp and Dohme Corp. (Rahway, New Jersey)
INVENTOR(S) Christopher Lee Parks (Boonton, New Jersey);  Maoli Yuan (Brooklyn, New York);  Mark Feinberg (New York, New York);  Amy Espeseth (Chalfont, Pennsylvania);  Andrew J. Bett (West Point, Pennsylvania)
ABSTRACT The present disclosure provides Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) vaccines, recombinant vesicular stomatitis virus (VSV) vectors encoding the SARS-CoV-2 spike (S) protein or an immunogenic variant thereof, recombinant replicable VSV particles having a SARS-CoV-2 S protein or an immunogenic variant thereof on the surface of the particles, and immunogenic recombinant proteins comprising a SARS-CoV-2 S protein or a variant thereof. Immunogenic compositions comprising the SARS-CoV-2 vaccines, the recombinant VSV vectors, the recombinant replicable VSV particles and/or the immunogenic recombinant proteins may be used for inducing an immune response to the SARS-CoV-2, preventing infection by the SARS-CoV-2, vaccinating against the SARS-CoV-2 and/or producing adaptive mutants of the recombinant replicable VSV particles.
FILED Friday, February 19, 2021
APPL NO 17/180147
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 39/215 (20130101) Original (OR) Class
A61K 2039/542 (20130101)

Peptides
C07K 14/145 (20130101)
C07K 14/165 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 7/00 (20130101)
C12N 15/86 (20130101)
C12N 2760/20234 (20130101)
C12N 2760/20243 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338811 Bigner et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Duke University (Durham, North Carolina);  THE GOVERNMENT OF THE UNITED STATES AS REPRESENTED BY THE SECRETARY OF HEALTH AND HUMAN SERVICES (Rockville, Maryland)
ASSIGNEE(S)
INVENTOR(S) Darell Bigner (Mebane, North Carolina);  Vidyalakshmi Chandramohan (Durham, North Carolina);  Smita Nair (Durham, North Carolina);  Matthias Gromeier (Durham, North Carolina);  Xuhui Bao (Durham, North Carolina);  Ira H. Pastan (Potomac, Maryland)
ABSTRACT Regional, tumor-targeted, cytotoxic therapy, such as D2C7-immunotoxin (D2C7-IT), not only specifically target and destroy tumor cells, but in the process initiate immune events that promote an in situ vaccine effect. The antitumor effects are amplified by immune checkpoint blockade which engenders a long-term systemic immune response that effectively eliminates all tumor cells.
FILED Thursday, July 15, 2021
APPL NO 17/376319
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/164 (20130101)
A61K 39/395 (20130101) Original (OR) Class
A61K 39/3955 (20130101)
A61K 47/6829 (20170801)
A61K 47/6849 (20170801)
A61K 47/6851 (20170801)
A61K 2039/505 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 16/30 (20130101)
C07K 16/2818 (20130101)
C07K 16/2863 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338815 Quijano et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Yale University (New Haven, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Elias Quijano (Durham, Connecticut);  Adele Ricciardi (New Haven, Connecticut);  Raman Bahal (Glastonbury, Connecticut);  Audrey Turchick (Chelmsford, Massachusetts);  Nicholas Economos (New Haven, Connecticut);  W. Mark Saltzman (New Haven, Connecticut);  Peter Glazer (Guilford, Connecticut)
ABSTRACT Compositions for improved gene editing and methods of use thereof are disclosed. In a preferred method, gene editing involves use of a cell-penetrating anti-DNA antibody, such as 3E10, as a potentiating agent to enhance gene editing by nucleases and triplex forming oligonucleotides. Genomic modification occurs at a higher frequency when cells are contacted with the potentiating agent and nuclease or triplex forming oligonucleotide, as compared to the absence of the potentiating agent. The methods are suitable for both ex vivo and in vivo approaches to gene editing and are useful for treating a subject with a genetic disease or disorder. Nanoparticle compositions for intracellular delivery of the gene editing compositions are provided and are particularly advantageous for use with in vivo applications.
FILED Friday, August 30, 2019
APPL NO 17/272151
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/5153 (20130101)
A61K 31/7088 (20130101)
A61K 35/28 (20130101)
A61K 38/14 (20130101)
A61K 38/465 (20130101)
A61K 39/39533 (20130101) Original (OR) Class
A61K 2039/545 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 7/00 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338816 Vorp et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Heart, Lung, and Blood Institute (NHLBI)
National Institute on Aging (NIA)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania);  Vanderbilt University (Nashville, Tennessee)
ASSIGNEE(S)
INVENTOR(S) David A. Vorp (Pittsburgh, Pennsylvania);  Aneesh Krishna Ramaswamy (Pittsburgh, Pennsylvania);  Justin Sol Weinbaum (Allison Park, Pennsylvania);  Kory James Blose (Pittsburgh, Pennsylvania);  Timothy Kwang-Joon Chung (Pittsburgh, Pennsylvania);  Trevor Kickliter (Allentown, Pennsylvania);  Yogev Baruch (Pittsburgh, Pennsylvania);  John A. Curci (Nashville, Tennessee)
ABSTRACT A method of delivering cells to a target tissue is provided comprising depositing a hydrogel pre-gel comprising magnetic particle-loaded cells to the target tissue and, prior to or during gelation of the hydrogel, drawing the magnetic particle-loaded cells to the tissue with a magnetic field, followed by gelation of the hydrogel to lock the cells in place on the tissue. The cells may be mesenchymal stem cells, such as adipose-derived mesenchymal stem cells, and the target tissue may be adventitial tissue of an aneurysm in a blood vessel. Also provided are devices useful in the method.
FILED Friday, October 18, 2019
APPL NO 17/286210
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/28 (20130101)
A61K 41/00 (20130101) Original (OR) Class

Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor
A61M 5/1407 (20130101)
A61M 25/0127 (20130101)
A61M 25/09041 (20130101)
A61M 2202/09 (20130101)
A61M 2205/0288 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0667 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338821 Abdullah et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) The Trustees of the University of Pennsylvania (Philadelphia, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) Kalil G Abdullah (Philadelphia, Pennsylvania);  Leo L Wang (Philadelphia, Pennsylvania);  Jason Alan Burdick (Philadelphia, Pennsylvania)
ABSTRACT Provided are compositions comprising a hydrogel formed from a cyclodextrin-modified branched polyethyleneimine and an adamantane-modified, eight-arm polyethyelene glycol. The hydrogel may contain an active agent, and can provide sustained release the active agent. Beneficial delivery characteristics may result from electrostatic or lipophilic interactions between the active agent and the hydrogel. Delivery of valproic acid from the present compositions can provide treatment following surgical resection of glioblastoma brain tumors.
FILED Monday, July 12, 2021
APPL NO 17/372773
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/06 (20130101)
A61K 9/19 (20130101)
A61K 9/0085 (20130101)
A61K 31/19 (20130101)
A61K 31/7105 (20130101)
A61K 47/34 (20130101) Original (OR) Class
A61K 47/40 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338823 Lencer et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) Children's Medical Center Corporation (Boston, Massachusetts)
ASSIGNEE(S) Children's Medical Center Corporation (Boston, Massachusetts)
INVENTOR(S) Wayne I. Lencer (Jamaica Plain, Massachusetts);  Daniel JF Chinnapen (Quincy, Massachusetts);  Richard I. Duclos (Quincy, Massachusetts)
ABSTRACT Provided herein, in some aspects, are delivery vehicles comprising a ceramide and an agent to be delivered attached to the ceramide. In some embodiments, the ceramide does not comprise a fatty acid (i.e., is a sphingosine). In some embodiments, the ceramide comprises a fatty acid. In some embodiments, the ceramide is a glycoceramide. In some embodiments, the agent is attached to the ceramide covalently (e.g., via a linker). In some embodiments, the agent to be delivered is a therapeutic agent. The ceramide is able to deliver the agent to a cell or to a cellular compartment, as well as across the musical barrier. In some embodiments, agents delivered using the ceramide described herein exhibit longer half-life, compared to agents delivered alone. Methods of delivering a therapeutic agent to a subject for treating a disease using the ceramide delivery vehicle are also provided.
FILED Friday, April 12, 2019
APPL NO 17/046753
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/1617 (20130101)
A61K 31/7105 (20130101)
A61K 47/65 (20170801)
A61K 47/543 (20170801) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338825 Gray et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts);  PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts)
ASSIGNEE(S) DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts);  PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts)
INVENTOR(S) Nathanael S. Gray (Boston, Massachusetts);  Tinghu Zhang (Boston, Massachusetts);  Priscilla Yang (Boston, Massachusetts);  Melissanne De Wispelaere (Cambridge, Massachusetts);  Guangyan Du (Jamaica Plain, Massachusetts)
ABSTRACT Disclosed are bifunctional compounds (degraders) that target hepatitis C virus (HCV) NS3/4A for degradation. Also disclosed are pharmaceutical compositions containing the degraders and methods of using the compounds to treat HCV infection and HCV-associated diseases or disorders.
FILED Thursday, September 26, 2019
APPL NO 17/280075
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 47/55 (20170801) Original (OR) Class
A61K 47/545 (20170801)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338833 IRVINE et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Darrell J. IRVINE (Arlington, Massachusetts);  Karl Dane WITTRUP (Boston, Massachusetts);  Naveen MEHTA (Somerville, Massachusetts);  Leyuan MA (Brookline, Massachusetts);  Benjamin COSSETTE (Durham, North Carolina)
ABSTRACT The disclosure features chimeric antigen receptor (CAR) ligands, methods for making the same, and immunomodulatory compositions comprising the CAR ligands. The disclosure also features compositions and methods of using the immunomodulatory compositions, for example, to stimulate activation of CAR expressing cells.
FILED Monday, March 01, 2021
APPL NO 17/188813
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/17 (20130101)
A61K 39/001112 (20180801)
A61K 47/543 (20170801)
A61K 47/6889 (20170801) Original (OR) Class

Peptides
C07K 16/2803 (20130101)
C07K 2317/92 (20130101)
C07K 2317/622 (20130101)
C07K 2319/74 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338835 Chen et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) University of Cincinnati (Cincinnati, Ohio);  The Board of Trustees of the University of Illinois (Chicago, Illinois);  The University of Chicago (Chicago, Illinois)
ASSIGNEE(S)
INVENTOR(S) Jianjun Chen (Cincinnati, Ohio);  Seungpyo Hong (Naperville, Illinois);  Xi Jiang (Cincinnati, Ohio);  Zejuan Li (Chicago, Illinois)
ABSTRACT A nanoparticle delivery system designed for sustained delivery of microRNA-150 (miR-150) to FLT3-overexpressing acute myeloid leukemia (AML) cells, the delivery system comprising poly(amidoamine) (PAMAM) dendrimers complexed with miR-150, wherein at least one dendrimer is surface-functionalized with a ligand specific for FLT3 receptor, and methods for treating AML characterized by FLT3-overexpression are provided.
FILED Wednesday, July 14, 2021
APPL NO 17/375548
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/551 (20130101)
A61K 31/7105 (20130101)
A61K 38/19 (20130101)
A61K 45/06 (20130101)
A61K 47/62 (20170801)
A61K 47/595 (20170801)
A61K 47/6935 (20170801) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/02 (20180101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/1138 (20130101)
C12N 2310/141 (20130101)
C12N 2310/321 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338840 GAO et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) The Board of Regents of the University of Texas System (Austin, Texas)
ASSIGNEE(S) The Board of Regents of the University of Texas System (Austin, Texas)
INVENTOR(S) Jinming GAO (Plano, Texas);  Gang HUANG (Plano, Texas);  Tian ZHAO (Irving, Texas);  Xinpeng MA (Dallas, Texas);  Yiguang WANG (Dallas, Texas);  Yang LI (Dallas, Texas);  Baran D. SUMER (Dallas, Texas)
ABSTRACT The present disclosure relates to polymers which contain a hydrophobic and hydrophilic segment which is sensitive to pH. In some aspects, the polymers form a micelle which is sensitive to pH and results in a change in fluorescence based upon the particular pH. In some aspects, the disclosure also provides methods of using the polymers for the imaging of cellular or extracellular environment or delivering a drug.
FILED Thursday, April 15, 2021
APPL NO 17/231922
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 49/0021 (20130101)
A61K 49/0032 (20130101)
A61K 49/0041 (20130101)
A61K 49/0054 (20130101) Original (OR) Class

Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds
C08F 8/30 (20130101)
C08F 8/32 (20130101)
C08F 8/34 (20130101)
C08F 8/42 (20130101)

Organic Dyes or Closely-related Compounds for Producing Dyes; Mordants; Lakes
C09B 69/103 (20130101)
C09B 69/105 (20130101)
C09B 69/106 (20130101)
C09B 69/109 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 21/643 (20130101)
G01N 21/6428 (20130101)
G01N 21/6456 (20130101)
G01N 33/84 (20130101)
G01N 33/582 (20130101)
G01N 2021/6432 (20130101)
G01N 2021/6439 (20130101)
G01N 2021/6441 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338846 Pomper et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The Johns Hopkins University (Baltimore, Maryland)
ASSIGNEE(S)
INVENTOR(S) Martin G. Pomper (Baltimore, Maryland);  Ronnie C. Mease (Fairfax, Virginia);  Sangeeta Ray (Ellicott City, Maryland);  IL Minn (Ellicott City, Maryland)
ABSTRACT Methods for co-injection of a non-radioactive PSMA inhibitor, referred to herein as a competing inhibitor (CI), with a radiolabeled PSMA inhibitor are disclosed. This combination reduces the uptake of the radiotracer in non-target organs, including the kidneys and lacrimal glands, with only a modest reduction in tumor uptake.
FILED Tuesday, July 30, 2019
APPL NO 17/264222
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/27 (20130101)
A61K 31/198 (20130101)
A61K 31/455 (20130101)
A61K 51/0402 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339011 ALBECK et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
United States Army (USA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Deafness and Other Communication Disorders (NIDCD)
APPLICANT(S) Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel);  NORTHWESTERN UNIVERSITY (Evanston, Illinois)
ASSIGNEE(S) Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel);  NORTHWESTERN UNIVERSITY (Evanston, Illinois)
INVENTOR(S) Dan David ALBECK (Givat Shmuel, Israel);  Claus Peter RICHTER (Skokie, Illinois)
ABSTRACT Disclosed is a method of selecting stimulations for a cochlear implant or an auditory implant. The method may include: capturing an acoustical signal; dividing the acoustical signal into a plurality of frequency bands; determining a mean acoustical energy for each frequency band; for each frequency band: comparing the mean acoustical energy with the mean acoustical energy determined for neighboring frequency bands; merging neighboring frequency bands having a difference between the mean acoustical energies that is less than an acoustical energy threshold value; selecting one or more types of stimulation to be applied to one or more locations in a cochlea or along an auditory nerve based on bandwidths of each frequency band. The one or more types of stimulation may be selected from: electrical stimulation, optical stimulation and opto-electrical stimulation, and the one or more locations in cochlea or along the auditory nerve may correspond to specific frequencies of the acoustical signal.
FILED Wednesday, August 14, 2019
APPL NO 17/268400
CURRENT CPC
Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy
A61N 1/0541 (20130101) Original (OR) Class
A61N 1/36038 (20170801)
A61N 1/36171 (20130101)
A61N 1/36175 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339035 Carter et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) University of Iowa Research Foundation (Iowa City, Iowa)
ASSIGNEE(S)
INVENTOR(S) Calvin S. Carter (Iowa City, Iowa);  Sunny C. Huang (Iowa City, Iowa);  Michael J. Miller (Iowa City, Iowa);  Charles C. Searby (Iowa City, Iowa);  Val C. Sheffield (Iowa City, Iowa)
ABSTRACT An example of subject may deliver a therapy by delivering energy to tissue. The system may comprise a magnetic field system and an electric field system. The magnetic field system may be configured to provide a magnetic field in a first direction to the tissue. The magnetic field system may include at least one magnetic field source to produce the magnetic field. The magnetic field produced by the at least one magnetic field source may include a magnetic field produced by at least one of a permanent magnet, a temporary magnet or electric current flow through a conductor. The electric field system may be configured to provide an electric field in a second direction to the tissue. The electric field system may include at least one electric field source to provide the electric field and the second direction is non-parallel to the first direction.
FILED Wednesday, July 07, 2021
APPL NO 17/369784
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/14532 (20130101)

Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy
A61N 1/10 (20130101)
A61N 1/40 (20130101)
A61N 1/0484 (20130101)
A61N 1/36002 (20170801)
A61N 1/36034 (20170801)
A61N 2/00 (20130101)
A61N 2/002 (20130101) Original (OR) Class
A61N 2/06 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339242 Yang et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
National Science Foundation (NSF)
APPLICANT(S) Board of Regents of the University of Nebraska (Lincoln, Nebraska);  UNIVERSITY OF CONNECTICUT (FARMINGTON, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Ruiguo Yang (Lincoln, Nebraska);  Arian Jaberi (Lincoln, Nebraska);  Amir Monemian Esfahani (Lincoln, Nebraska);  Ali Tamayol (Providence, Rhode Island)
ABSTRACT Microfluidic gradient generators that can create robust platforms that can not only be used for creating co-cultures of cells with various ratios, but also can simultaneously generate gradients of mechanical and chemical stresses. A chip utilizes microchambers embedded within channels to provide space for 3D cell culture and exposes these cells to gradients of mechanical shear stress and a chemical treatment.
FILED Friday, April 30, 2021
APPL NO 17/245381
CURRENT CPC
Chemical or Physical Laboratory Apparatus for General Use
B01L 3/5025 (20130101) Original (OR) Class
B01L 2300/087 (20130101)
B01L 2300/0877 (20130101)
B01L 2300/0883 (20130101)

Apparatus for Enzymology or Microbiology;
C12M 41/46 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 1/34 (20130101)
C12N 2513/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339244 GANGULI et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) The Board of Trustees of the University of Illinois (Urbana, Illinois);  Mayo Foundation for Medical Education and Research (Rochester, Minnesota)
ASSIGNEE(S)
INVENTOR(S) Anurup GANGULI (Urbana, Illinois);  Rashid BASHIR (Champaign, Illinois);  Panagiotis Z. ANASTASIADIS (Jacksonville, Florida);  George VASMATZIS (Oronoco, Minnesota)
ABSTRACT Provided are methods and related devices for preparing a cell and tissue culture, including a hanging drop culture. Microwells are specially loaded with cell mixtures using a removable reservoir and forcing cells into the underlying microwells. The removable reservoir is removed and the cells partitioned into the individual microwells and covered by an immiscible layer of fluid. The microwells and immiscible layer is inverted and the cells in the microwells cultured. The microwells may have shape-controlling elements to control the three-dimensional shape of the culture.
FILED Tuesday, May 04, 2021
APPL NO 17/307150
CURRENT CPC
Chemical or Physical Laboratory Apparatus for General Use
B01L 3/0262 (20130101)
B01L 3/5088 (20130101) Original (OR) Class
B01L 9/523 (20130101)
B01L 2400/024 (20130101)

Apparatus for Enzymology or Microbiology;
C12M 21/08 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339316 Xia et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
National Science Foundation (NSF)
Directorate for Mathematical and Physical Sciences (MPS)
Division of Materials Research (DMR)
APPLICANT(S) University of Washington (Seattle, Washington)
ASSIGNEE(S) University of Washington (Seattle, Washington)
INVENTOR(S) Younan Xia (St. Louis, Missouri);  Sang-Hyuk Im (Pohang-Shi, South Korea);  Yugang Sun (Naperville, Illinois);  Yun Tack Lee (Seattle, Washington);  Benjamin Wiley (Boston, Massachusetts)
ABSTRACT Methods for producing silver nanostructures with improved dimensional control, yield, purity, monodispersed, and scale of synthesis.
FILED Wednesday, March 17, 2021
APPL NO 17/249885
CURRENT CPC
Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder
B22F 1/0025 (20130101)
B22F 9/24 (20130101) Original (OR) Class
B22F 2001/0037 (20130101)
B22F 2009/245 (20130101)
B22F 2301/255 (20130101)
B22F 2304/05 (20130101)
B22F 2998/10 (20130101)

Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 30/00 (20130101)
B82Y 40/00 (20130101)

Production and Refining of Metals; Pretreatment of Raw Materials
C22B 11/04 (20130101)

Alloys
C22C 5/02 (20130101)
C22C 5/06 (20130101)

Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor
C30B 7/00 (20130101)
C30B 29/02 (20130101)
C30B 29/60 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340100 SHAPIRO et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
United States Army (USA)
U.S. Army Medical Research and Materiel Command (USAMRMC)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
ASSIGNEE(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
INVENTOR(S) David J. SHAPIRO (Urbana, Illinois);  Paul J. HERGENROTHER (Champaign, Illinois);  Matthew W. BOUDREAU (Urbana, Illinois)
ABSTRACT A set of small molecules ERα biomodulators that kill therapy-resistant ERα positive breast, ovarian, and endometrial cancer cells. These small molecules have increased therapeutic potential because of an increased ability to kill therapy-resistant breast cancer cells compared to BHPI and other conventional therapies (endocrine therapies, tamoxifen and fulvestrant/ICI). The new compounds do not only inhibit proliferation of the cancer cells but actually kills them, which prevents reactivation of tumors years later.
FILED Thursday, May 13, 2021
APPL NO 17/319447
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Heterocyclic Compounds
C07D 209/34 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340102 Hatcher et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts)
ASSIGNEE(S) DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts)
INVENTOR(S) John Hatcher (Marlborough, Massachusetts);  Nathanael S. Gray (Boston, Massachusetts);  Hwangeun Choi (Seoul, South Korea);  Pasi Janne (Needham, Massachusetts);  Tinghu Zhang (Brookline, Massachusetts)
ABSTRACT The application relates to a compound of Formula (I): which modulates the activity of ALK or SRPK, a pharmaceutical composition comprising the compound, and a method of treating or preventing a disease in which ALK or SRPK plays a role.
FILED Tuesday, June 15, 2021
APPL NO 17/348394
CURRENT CPC
Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Heterocyclic Compounds
C07D 209/80 (20130101) Original (OR) Class
C07D 401/04 (20130101)
C07D 401/14 (20130101)
C07D 403/04 (20130101)
C07D 405/04 (20130101)
C07D 405/14 (20130101)
C07D 409/04 (20130101)
C07D 413/04 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/12 (20130101)
C12N 9/96 (20130101)

Enzymes
C12Y 207/11001 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340116 CHANG et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) University of Notre Dame du Lac (South Bend, Indiana)
ASSIGNEE(S) University of Notre Dame du Lac (South Bend, Indiana)
INVENTOR(S) Mayland CHANG (Granger, Indiana);  Shahriar MOBASHERY (Granger, Indiana);  Derong DING (South Bend, Indiana)
ABSTRACT Clostridium difficile infection (CDI) is a public health threat that results in 14,000 annual deaths in the United States. Challenges involve the production of CDI spores that can remain dormant for years and the production of toxins that damage the gut. Current therapies for CDI include vancomycin and metronidazole, but neither inhibits spore or toxin production. Thus, recurrence of infection occurs in 25% of patients and there are no antibiotics that are effective for multiple recurrences. We describe oxadiazoles with activity against C. difficile, including the highly virulent NAP1/027 strain with increased production of toxins A and B, as well as the additional binary toxin. Oxadiazole 2 is poorly absorbed, thus advantageously achieving high concentrations in the gut. The compound targets peptidoglycan synthesis and inhibits vegetative cells, spores, and toxin production.
FILED Thursday, July 15, 2021
APPL NO 17/376522
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/12 (20130101)
A61K 9/0014 (20130101)
A61K 9/0019 (20130101)
A61K 9/2027 (20130101)
A61K 9/2059 (20130101)
A61K 9/4866 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/04 (20180101)

Heterocyclic Compounds
C07D 271/06 (20130101) Original (OR) Class
C07D 413/04 (20130101)
C07D 413/10 (20130101)
C07D 413/12 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340117 CHANG et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) University of Notre Dame du Lac (South Bend, Indiana)
ASSIGNEE(S) University of Notre Dame du Lac (South Bend, Indiana)
INVENTOR(S) Mayland CHANG (Granger, Indiana);  Shahriar MOBASHERY (Granger, Indiana);  Derong DING (South Bend, Indiana)
ABSTRACT Clostridium difficile infection (CDI) is a public health threat that results in 14,000 annual deaths in the United States. Challenges involve the production of CDI spores that can remain dormant for years and the production of toxins that damage the gut. Current therapies for CDI include vancomycin and metronidazole, but neither inhibits spore or toxin production. Thus, recurrence of infection occurs in 25% of patients and there are no antibiotics that are effective for multiple recurrences. We describe oxadiazoles with activity against C. difficile, including the highly virulent NAP1/027 strain with increased production of toxins A and B, as well as the additional binary toxin. Oxadiazole 2 is poorly absorbed, thus advantageously achieving high concentrations in the gut. The compound targets peptidoglycan synthesis and inhibits vegetative cells, spores, and toxin production.
FILED Thursday, July 15, 2021
APPL NO 17/376558
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/12 (20130101)
A61K 9/0014 (20130101)
A61K 9/0019 (20130101)
A61K 9/2027 (20130101)
A61K 9/2059 (20130101)
A61K 9/4866 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/04 (20180101)

Heterocyclic Compounds
C07D 271/06 (20130101) Original (OR) Class
C07D 413/04 (20130101)
C07D 413/10 (20130101)
C07D 413/12 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340126 Debnath et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
Non-Profit Organization (NPO)
New York Blood Center (NYBC)
APPLICANT(S) New York Blood Center, Inc. (New York, New York);  The United States of America, As Represented By The Secretary, Department of Health and Human Servic (Bethesda, Maryland)
ASSIGNEE(S)
INVENTOR(S) Asim Kumar Debnath (New York, New York);  Francesca Curreli (New, New York);  Peter D. Kwong (Bethesda, Maryland);  Young Do Kwon (Bethesda, Maryland)
ABSTRACT Substituted phenylpyrrolecarboxamide compounds such as those represented by Formula A can be used in the treatment of HIV infection and related conditions.
FILED Friday, July 02, 2021
APPL NO 17/366920
CURRENT CPC
Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/18 (20180101)

Heterocyclic Compounds
C07D 207/34 (20130101)
C07D 241/04 (20130101)
C07D 401/14 (20130101)
C07D 403/12 (20130101) Original (OR) Class
C07D 405/14 (20130101)
C07D 413/12 (20130101)
C07D 417/12 (20130101)
C07D 417/14 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340140 GRAY et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) DANA-FARBER CANCER INSTITUTE, INC. (BOSTON, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) NATHANAEL S. GRAY (BOSTON, Massachusetts);  BAISHAN JIANG (WATERTOWN, Massachusetts);  TINGHU ZHANG (BROOKLINE, Massachusetts);  ERIC WANG (JAMAICA PLAIN, Massachusetts);  NICHOLAS KWIATKOWSKI (AUBURN, Massachusetts);  YANKE LIANG (BROOKLINE, Massachusetts);  CALLA M. OLSON (BROOKLINE, Massachusetts)
ABSTRACT The present application provides bifunctional compounds, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, which act as protein degradation inducing moieties for cyclin-dependent kinase 4 (CDK4) and/or cyclin-dependent kinase 6 (CDK6). The present application also relates to methods for the targeted degradation of CDK4 and/or CDK6 through the use of the bifunctional compounds that link a ubiquitin ligase-binding moiety to a ligand that is capable of binding to CDK4 and/or
FILED Tuesday, July 23, 2019
APPL NO 17/262032
CURRENT CPC
Heterocyclic Compounds
C07D 401/14 (20130101)
C07D 471/04 (20130101) Original (OR) Class
C07D 487/04 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340155 Donaldson et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Drug Abuse (NIDA)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) Marquette University (Milwaukee, Wisconsin);  Concordia University, Inc. (Mequon, Wisconsin);  UWM Research Foundation, Inc. (Milwaukee, Wisconsin)
ASSIGNEE(S)
INVENTOR(S) William A. Donaldson (Milwaukee, Wisconsin);  Daniel S. Sem (New Berlin, Wisconsin);  Karyn M. Frick (Milwaukee, Wisconsin)
ABSTRACT Disclosed are substituted (4′-hydroxylphenyl)cycloalkane compounds and substituted (4′-hydroxylphenyl)cycloalkene compounds and there use as selective agonists of the estrogen receptor beta isoform (ERβ). The disclosed compounds may be formulated as pharmaceutical compositions and administered for treating diseases associated with ER activity, such as neurological, psychiatric, and/or cell proliferative diseases and disorders as well as for enhancing memory consolidation in subjects in need thereof.
FILED Friday, March 30, 2018
APPL NO 16/498122
CURRENT CPC
Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 25/28 (20180101)

Acyclic or Carbocyclic Compounds
C07C 35/21 (20130101)

Heterocyclic Compounds
C07D 493/08 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340181 Tang et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The Regents of the University of California (Oakland, California)
ASSIGNEE(S) The Regents of the University of California (Oakland, California)
INVENTOR(S) Yng Tang (Davis, California);  Julie L. Sutcliffe (Davis, California)
ABSTRACT The present invention provides peptides and peptide-conjugates that bind to αvβ6 integrin. The peptide-conjugates can be used for a variety of imaging and therapeutic applications. Methods of use and peptide optimization are also provided herein.
FILED Wednesday, March 03, 2021
APPL NO 17/191223
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/00 (20130101)
A61K 45/06 (20130101)
A61K 47/60 (20170801)
A61K 51/082 (20130101)

Peptides
C07K 7/08 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340188 Franchini et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) The United States of America, as represented by the Secretary, Department of Health and Human Servic (Bethesda, Maryland);  New York University (New York, New York)
ASSIGNEE(S) The United States of America, as represented by the Secretary, Department of Health and Human Servic (Bethesda, Maryland);  New York University (New York, New York)
INVENTOR(S) Genoveffa Franchini (Washington, District of Columbia);  Timothy Cardozo (New York, New York);  Manuel Becerra-Flores (Brooklyn, New York);  Isabela Silva de Castro (Bethesda, Maryland);  Giacomo Gorini (Bethesda, Maryland);  Massimiliano Bissa (Bethesda, Maryland)
ABSTRACT Embodiments of recombinant HIV-1 gp120 proteins that contain a V1 deletion are disclosed. Also provided are gp140, gp145, and gp160 proteins containing the V1 deletion, as well as HIV-1 Env ectodomain trimers containing protomers containing the V1 deletion. Nucleic acid molecules encoding these proteins are also provided. In several embodiments, the disclosed recombinant HIV-1 proteins and/or nucleic acid molecules can be used to generate an immune response to HIV-1 in a subject, for example, to treat or prevent an HIV-1 infection in the subject.
FILED Monday, October 21, 2019
APPL NO 17/285453
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/00 (20130101)
A61K 39/21 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 31/18 (20180101)

Peptides
C07K 14/162 (20130101) Original (OR) Class

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/86 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/56988 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340191 BEERNINK
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) Children's Hospital and Research Center at Oakland (Oakland, California)
ASSIGNEE(S)
INVENTOR(S) Peter T. BEERNINK (Walnut Creek, California)
ABSTRACT Variant factor H binding proteins that can elicit antibodies that are bactericidal for at least one strain of Neisseria meningitidis, compositions comprising such proteins, and methods of use of such proteins, are provided.
FILED Friday, April 02, 2021
APPL NO 17/221646
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 39/095 (20130101)
A61K 2039/55505 (20130101)

Peptides
C07K 14/22 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340197 Yeo et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Human Genome Research Institute (NHGRI)
APPLICANT(S) The Regents of the University of California (La Jolla, California)
ASSIGNEE(S)
INVENTOR(S) Eugene Yeo (La Jolla, California);  Kristopher Brannan (La Jolla, California)
ABSTRACT Described herein are compositions, systems, methods, and kits utilizing CRISPR-Cas protein fusions comprising a guide nucleotide sequence-programmable RNA binding protein and a RNA pseudouridylation modification protein. The compositions, systems, methods, and kits described herein are useful to modulate RNA pseudouridylation.
FILED Friday, August 30, 2019
APPL NO 17/272018
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 48/00 (20130101)

Peptides
C07K 14/47 (20130101) Original (OR) Class
C07K 2319/00 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/11 (20130101)
C12N 2800/80 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340198 Goodman et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Deafness and Other Communication Disorders (NIDCD)
APPLICANT(S) RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio)
ASSIGNEE(S) RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio)
INVENTOR(S) Steven David Goodman (Columbus, Ohio);  Lauren Opremcak Bakaletz (Columbus, Ohio)
ABSTRACT Provided herein are derivatives of HMGB1 that have been engineered to possess the same efficacious anti-bio film activity but are smaller and do not induce inflammation.
FILED Friday, October 04, 2019
APPL NO 17/282354
CURRENT CPC
Peptides
C07K 14/47 (20130101) Original (OR) Class
C07K 16/1232 (20130101)
C07K 2317/76 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340218 HEDRICK et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Heart, Lung, and Blood Institute (NHLBI)
Non-Profit Organization (NPO)
American Heart Association (AHA)
APPLICANT(S) La Jolla Institute for Allergy and Immunology (La Jolla, California)
ASSIGNEE(S)
INVENTOR(S) Catherine C. HEDRICK (La Jolla, California);  Richard HANNA (San Diego, California)
ABSTRACT Disclosed herein are methods of increasing numbers of monocytes to a tumor or cancer metastasis site in a subject. Non-limiting embodiments include administering or using a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1 (Ly6C−)) monocytes; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1 (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist. Also disclosed herein are methods of increasing, stimulating, activating or promoting monocyte migration to or mobilization against a tumor or cancer metastasis in a subject. Non-limiting embodiments include administering a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1 (Ly6C−)) monocytes; or CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD111b+GR1 (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist.
FILED Tuesday, July 06, 2021
APPL NO 17/368706
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/704 (20130101)
A61K 35/15 (20130101)
A61K 38/195 (20130101)
A61K 38/1783 (20130101)
A61K 39/3955 (20130101)
A61K 45/06 (20130101)
A61K 47/02 (20130101)
A61K 47/6849 (20170801)
A61K 2039/545 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)
A61P 35/04 (20180101)

Peptides
C07K 14/70567 (20130101) Original (OR) Class
C07K 16/24 (20130101)
C07K 16/2857 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340227 Hunsperger et al.
FUNDED BY
Department of Health and Human Services (HHS)
APPLICANT(S) The United States of America, as represented by the Secretary, Department of Health and Human Service (Rockville, Maryland)
ASSIGNEE(S)
INVENTOR(S) Elizabeth Anne Hunsperger (Guaynabo, Puerto Rico);  Tesfaye Gelanew Taye (San Juan, Puerto Rico)
ABSTRACT The present disclosure relates to polypeptides that specifically bind to Dengue virus non¬structural protein 1, including antibodies and fragments thereof. The antibody or antigen-binding fragment thereof may specifically bind Dengue virus (DENV) serotype 4 and include: a heavy chain variable region that comprises at least one CDR amino acid sequence selected from the group consisting of: SGYNWH, YIH YS GGTN YNPS LKS, RTGTVPFAY, SYVMH, YLNPYNDDTKYNEKFKG, and GPPYALDY. The present disclosure further relates to methods of producing the polypeptides of the present disclosure, methods of diagnosing DENV, and methods of treating a DENV infection.
FILED Thursday, June 22, 2017
APPL NO 16/310964
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/167 (20130101)

Peptides
C07K 16/1081 (20130101) Original (OR) Class
C07K 2317/14 (20130101)
C07K 2317/24 (20130101)
C07K 2317/565 (20130101)
C07K 2319/02 (20130101)
C07K 2319/30 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 7/00 (20130101)
C12N 15/62 (20130101)
C12N 15/79 (20130101)
C12N 2710/14041 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/56983 (20130101)
G01N 2333/185 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340232 HWANG et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Board of Regents, The University of Texas System (Austin, Texas)
ASSIGNEE(S) Board of Regents, The University of Texas System (Austin, Texas)
INVENTOR(S) Rosa HWANG (Houston, Texas);  Liran ZHOU (Houston, Texas);  Mason LU (Houston, Texas);  Hongmei HUSTER (Houston, Texas);  Craig LOGSDON (Houston, Texas);  Jeffrey E. LEE (Houston, Texas)
ABSTRACT Provided herein are methods and reagents for increasing chemosensitivity to chemotherapy and immunotherapy in cancer patients. Methods of treating cancer are provided, comprising administering to a patient in need thereof an effective amount of an DKK3-neutralizing agent, such as a DKK3-neutralizing antibody provided herein. The methods can further include administering an effective amount of chemotherapy or immunotherapy to said patient.
FILED Tuesday, October 15, 2019
APPL NO 17/285470
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7068 (20130101)
A61K 39/3955 (20130101)
A61K 45/06 (20130101)
A61K 47/6843 (20170801)
A61K 2039/505 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 16/18 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340257 Abou-Elkacem et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Lotfi Abou-Elkacem (Houston, Texas);  Juergen Karl Willmann (Stanford, California);  Benjamin J. Hackel (Edina, Minnesota);  Lawrence Arthur Stern (Monrovia, California);  Patrick Samuel Lown (Minneapolis, Minnesota);  Amelie Margarete Marianne Lutz (Stanford, California);  Rakesh Kumar Bam (Menlo Park, California);  THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California);  REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota)
ASSIGNEE(S)
INVENTOR(S) Lotfi Abou-Elkacem (Houston, Texas);  Juergen Karl Willmann (Stanford, California);  Benjamin J. Hackel (Edina, Minnesota);  Lawrence Arthur Stern (Monrovia, California);  Patrick Samuel Lown (Minneapolis, Minnesota);  Amelie Margarete Marianne Lutz (Stanford, California);  Rakesh Kumar Bam (Menlo Park, California)
ABSTRACT Affibody polypeptides that specifically bind to B7-H3 are provided. Exemplary anti-B7-H3 affibodies are provided. The affibody polypeptides specifically recognize and bind to B7-H3 with high affinity. The affibodies can be conjugated to contrast agents, including without limitation microbubbles for contrast-enhanced ultrasound imaging
FILED Thursday, August 22, 2019
APPL NO 17/267733
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)
A61K 47/6803 (20170801)
A61K 47/6849 (20170801)
A61K 49/221 (20130101)
A61K 49/223 (20130101)
A61K 2039/505 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 16/2827 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340258 Ackerman et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) TRUSTEES OF DARTMOUTH COLLEGE (Hanover, New Hampshire)
ASSIGNEE(S)
INVENTOR(S) Margaret Ackerman (Lebanon, New Hampshire);  Casey Hua (Hanover, New Hampshire);  Charles Sentman (Hanover, New Hampshire)
ABSTRACT Provided herein, in some embodiments, are antibodies, antigen-binding antibody fragments, chimeric antigen receptors (CARs) and bispecific T cell engagers (BiTEs) that bind specifically to 137 homolog 6. Also provided herein are methods of using the same and cells comprising the same.
FILED Wednesday, May 12, 2021
APPL NO 17/318310
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 47/6803 (20170801)
A61K 47/6849 (20170801)
A61K 51/1027 (20130101)
A61K 51/1093 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 14/7051 (20130101)
C07K 14/70517 (20130101)
C07K 14/70521 (20130101)
C07K 16/468 (20130101)
C07K 16/2809 (20130101)
C07K 16/2827 (20130101) Original (OR) Class
C07K 2317/21 (20130101)
C07K 2317/31 (20130101)
C07K 2317/56 (20130101)
C07K 2317/73 (20130101)
C07K 2317/92 (20130101)
C07K 2317/622 (20130101)
C07K 2319/02 (20130101)
C07K 2319/03 (20130101)
C07K 2319/033 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340265 Westlund High et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Dental and Craniofacial Research (NIDCR)
APPLICANT(S) Karin WESTLUND HIGH (Albuquerque, New Mexico);  Ravi VENKATA DURVASULA (Albuquerque, New Mexico);  Adinarayana KUNAMNENI (Albuquerque, New Mexico);  UNM RAINFOREST INNOVATIONS (Albuquerque, New Mexico)
ASSIGNEE(S)
INVENTOR(S) Karin Westlund High (Albuquerque, New Mexico);  Ravi Venkata Durvasula (Albuquerque, New Mexico);  Adinarayana Kunamneni (Albuquerque, New Mexico)
ABSTRACT A pharmaceutical composition generally includes a therapeutic antibody, or fragment thereof, and a pharmaceutically acceptable carrier. The therapeutic antibody specifically binds to a target peptide that mediates pain in a subject. The composition may be administered to a subject experiencing pain to at least partially alleviate the pain.
FILED Friday, November 01, 2019
APPL NO 17/284208
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 2039/505 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 25/02 (20180101)
A61P 29/02 (20180101)

Peptides
C07K 16/2869 (20130101) Original (OR) Class
C07K 2317/622 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340279 Glazer et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Yale University (New Haven, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Peter Glazer (Guilford, Connecticut);  Audrey Turchick (Chelmsford, Massachusetts)
ABSTRACT Combination therapies including administering a subject in need thereof a cell-penetrating binding protein, such as an antibody, and an immune checkpoint modulator are provided. Typically, the cell-penetrating binding protein can induce DNA damage or reduce DNA damage repair in an effective amount to activate the innate immunity inflammatory pathway in target cells such as cancer cells or infected cells. For example, in some embodiments, the cell-penetrating binding protein increases induced p21 and/or p27 protein expression, increases accumulation of single-strand DNA in the cytosol, increases phosphorylation of STAT1, or a combination thereof in target cells. The subject can have cancer or an infection and the combination of the cell-penetrating binding protein and the immune checkpoint modulator reduce one or more symptoms of cancer or infection, preferably to a greater degree than administering the subject the same amount of cell-penetrating binding protein alone or the same amount of immune checkpoint modulator alone.
FILED Friday, August 30, 2019
APPL NO 17/272124
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 45/06 (20130101)

Peptides
C07K 16/44 (20130101) Original (OR) Class
C07K 16/2818 (20130101)
C07K 2317/10 (20130101)
C07K 2317/24 (20130101)
C07K 2317/33 (20130101)
C07K 2317/565 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340280 Quijano et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) Yale University (New Haven, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Elias Quijano (Durham, Connecticut);  Audrey Turchick (Chelmsford, Massachusetts);  Peter Glazer (Guilford, Connecticut)
ABSTRACT Compositions for enhanced gene editing and methods of use thereof are. The composition contains a cell-penetrating antibody and a donor oligonucleotide containing a sequence that can correct a mutation in a cell's genome. Preferably, the composition does not contain a nuclease, PNA, or nanoparticle. The compositions are used to modify the genome of a cell by contacting the cell with an effective amount of the composition. Genomic modification occurs at a higher frequency both ex vivo and in vivo, when cells are contacted with the cell-penetrating antibody and donor oligonucleotide as compared to the absence of the cell-penetrating antibody.
FILED Friday, August 30, 2019
APPL NO 17/272136
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7088 (20130101)
A61K 35/14 (20130101)
A61K 47/6937 (20170801)
A61K 48/0008 (20130101)
A61K 2039/505 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 43/00 (20180101)

Peptides
C07K 16/44 (20130101) Original (OR) Class

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/102 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340334 PORTELA et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) California Institute of Technology (Pasadena, California)
ASSIGNEE(S)
INVENTOR(S) Carlos M. PORTELA (Pasadena, California);  Daryl Wei Liang YEE (Pasadena, California);  Dennis M. KOCHMANN (Pasadena, California);  Julia R. GREER (Pasadena, California)
ABSTRACT In an aspect, provided herein are low density materials, including shell-based materials, with three-dimensional architectures formed, in part, via self-assembly processes. Shell-based materials of some embodiments exhibit a combination of ultralow density (e.g., ≤100 mg cm−3 and optionally ≤10 100 mg cm−3) and non-periodic architectures characterized by low defect densities and geometries avoiding stress concentrations. Low density shell based materials of some embodiments have architectures characterized by small curvatures and lack of straight edges providing enhance mechanical response. In some embodiments, for example, the present low density materials, including shell-based materials, providing a combination target mechanical properties including high stiffness-to-density ratios, mechanical resilience and tolerance for deformation.
FILED Friday, September 25, 2020
APPL NO 17/032539
CURRENT CPC
Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 40/00 (20130101)

Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H
C08J 3/02 (20130101) Original (OR) Class
C08J 9/26 (20130101)

Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General
C23C 16/403 (20130101)
C23C 16/45525 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340493 Easley,, IV et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
NIH Office of the Director (NIHOD)
APPLICANT(S) University of Georgia Research Foundation, Inc. (Athens, Georgia);  Emory University (Atlanta, Georgia)
ASSIGNEE(S)
INVENTOR(S) Charles A. Easley,, IV (Athens, Georgia);  Anthony W.S. Chan (Atlanta, Georgia)
ABSTRACT Compositions and methods for improving embryo development, treating idiopathic male factor infertility, and enabling infertile/sub-fertile/sterile men to father their own genetic offspring are provided. Typically, the methods include administering into a male or female gamete or fertilized embryo an effective amount of a compound that increases bioavailability of a TET protein to improve development of an embryo resulting from fertilization of the female gamete by a male gamete. The compound can be administered into the gamete or embryo before, during, or after fertilization. The compound can be administered by an injection such as intracytoplasmic injection. The compound and the male gamete can be administered in combination by intracytoplasmic sperm injection. Methods of making male gametes, and methods of modifying the genome of a male gamete or embryo using an effective amount of a gene editing composition to correct a gene mutation or anomaly in the genome thereof are also provided.
FILED Thursday, August 01, 2019
APPL NO 17/265157
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/061 (20130101)
C12N 5/0604 (20130101) Original (OR) Class
C12N 15/90 (20130101)
C12N 2506/02 (20130101)
C12N 2506/45 (20130101)
C12N 2510/00 (20130101)
C12N 2517/10 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340501 Lewis et al.
FUNDED BY
Department of Health and Human Services (HHS)
Food and Drug Administration (FDA)
APPLICANT(S) The Regents of the University of California (Oakland, California);  The Food and Drug Administration (Silver Spring, Maryland)
ASSIGNEE(S)
INVENTOR(S) Nathan Lewis (La Jolla, California);  Wan-Tien Chiang (La Jolla, California);  Montserrat Puig (Silver Spring, Maryland);  Yaqin Zhang (Silver Spring, Maryland);  Amy Rosenberg (Silver Spring, Maryland)
ABSTRACT A significant interferon (IFN) response is induced following treatment of CHO cells with exogenously-added type I IFN or poly I:C. Treatment of the CHO cells with poly I:C prior to infection limited the cytopathic effect from Vesicular stomatitis virus (VSV), Encephalomyocarditis vims (EMCV), and Reovirus-3 vims (Reo) in a STAT1-dependent manner By knocking out two upstream repressors of STAT1: Gfi1 and Trim 24, the engineered CHO cells exhibited increased resistance to virus contaminations. Thus, omics-guided engineering of mammalian cell culture can be deployed to increase safety in biotherapeutic protein production.
FILED Tuesday, August 27, 2019
APPL NO 17/270501
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0682 (20130101) Original (OR) Class
C12N 2501/24 (20130101)
C12N 2501/50 (20130101)
C12N 2501/90 (20130101)
C12N 2501/998 (20130101)
C12N 2501/999 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340516 CALDWELL
FUNDED BY
Department of Veterans Affairs (DVA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Eye Institute (NEI)
APPLICANT(S) Augusta University Research Institute, Inc. (Augusta, Georgia);  The US Government as Represented by the Department of Veterans Affairs (Washington, District of Columbia)
ASSIGNEE(S)
INVENTOR(S) Ruth CALDWELL (Augusta, Georgia)
ABSTRACT Pathological retinal neovascularization is a common micro-vascular complication in several retinal diseases including retinopathy of prematurity (ROP), diabetic retinopathy, age-related macular degeneration and central vein occlusion. Disclosed herein are compositions and methods useful for the treatment or prevention of retinal neovascularization and related diseases in a subject in need thereof. Exemplary methods include administering a composition including PEGylated arginase 1 to a subject in need thereof to promote reparative angiogenesis and decrease retinal neovascularization in the eye.
FILED Thursday, April 29, 2021
APPL NO 17/244385
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/00 (20130101)
A61K 47/60 (20170801)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 27/02 (20180101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/78 (20130101) Original (OR) Class

Enzymes
C12Y 305/03001 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340519 KING et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Army (DOA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) UNIVERSITY OF WASHINGTON (Seattle, Washington);  UNIVERSITY OF UTAH (Salt Lake City, Utah)
ASSIGNEE(S)
INVENTOR(S) Neil KING (Seattle, Washington);  Wesley SUNDQUIST (Salt Lake City, Utah);  Joerg VOTTELER (Salt Lake City, Utah);  Yang HSIA (Seattle, Washington);  David BAKER (Seattle, Washington);  Jacob BALE (Seattle, Washington);  Marc LAJOIE (Seattle, Washington);  Gabriel BUTTERFIELD (Seattle, Washington);  Elizabeth GRAY (Seattle, Washington);  Daniel STETSON (Seattle, Washington)
ABSTRACT The application discloses multimeric assemblies including multiple oligomeric substructures, where each oligomeric substructure includes multiple proteins that self-interact around at least one axis of rotational symmetry, where each protein includes one or more polypeptide-polypeptide interface (“O interface”); and one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding to one or more proteins in the eukaryotic ESCRT complex (“L domain”); and where the multimeric assembly includes one or more subunits comprising one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), as well as membrane-enveloped versions of the multimeric assemblies.
FILED Wednesday, June 02, 2021
APPL NO 17/336889
CURRENT CPC
Peptides
C07K 14/00 (20130101)
C07K 14/435 (20130101)
C07K 2319/03 (20130101)
C07K 2319/06 (20130101)
C07K 2319/735 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/88 (20130101) Original (OR) Class

Enzymes
C12Y 401/02014 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340524 IRVINE et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Darrell J. IRVINE (Arlington, Massachusetts);  Karl Dane WITTRUP (Boston, Massachusetts);  Naveen MEHTA (Somerville, Massachusetts);  Leyuan MA (Brookline, Massachusetts);  Benjamin COSSETTE (Durham, North Carolina)
ABSTRACT The disclosure features chimeric antigen receptor (CAR) ligands, methods for making the same, and immunomodulatory compositions comprising the CAR ligands. The disclosure also features compositions and methods of using the immunomodulatory compositions, for example, to stimulate activation of CAR expressing cells.
FILED Monday, March 01, 2021
APPL NO 17/188861
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 39/001112 (20180801)
A61K 2039/57 (20130101)
A61K 2039/6018 (20130101)
A61K 2039/6093 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)
A61P 37/04 (20180101)

Peptides
C07K 7/06 (20130101)
C07K 14/7051 (20130101)
C07K 14/70521 (20130101)
C07K 16/2803 (20130101)
C07K 2317/622 (20130101)
C07K 2319/03 (20130101)
C07K 2319/33 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/1037 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340531 Bunick et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS)
APPLICANT(S) YALE UNIVERSITY (New Haven, Connecticut)
ASSIGNEE(S)
INVENTOR(S) Christopher Bunick (Cheshire, Connecticut);  Sherif Eldirany (Glastonbury, Connecticut);  Minh Ho (New Haven, Connecticut)
ABSTRACT The present invention provides compositions and methods for inhibiting intermediate filament tetramerization and formation.
FILED Tuesday, October 08, 2019
APPL NO 17/283405
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 38/00 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Peptides
C07K 14/4702 (20130101)
C07K 14/4741 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/111 (20130101) Original (OR) Class
C12N 15/1093 (20130101)
C12N 2310/20 (20170501)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340535 Khvorova et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Child Health and Human Development (NICHD)
National Institute of General Medical Sciences (NIGMS)
NIH Office of the Director (NIHOD)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) UNIVERSITY OF MASSACHUSETTS (Boston, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Anastasia Khvorova (Westborough, Massachusetts);  Bruno Miguel da Cruz Godinho (Worcester, Massachusetts);  James W. Gilbert (Worcester, Massachusetts)
ABSTRACT This disclosure relates to novel C9ORF72 targeting sequences. Novel sense and antisense dual-targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided.
FILED Friday, March 26, 2021
APPL NO 17/213887
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/113 (20130101) Original (OR) Class
C12N 2310/11 (20130101)
C12N 2310/314 (20130101)
C12N 2310/315 (20130101)
C12N 2310/321 (20130101)
C12N 2310/322 (20130101)
C12N 2310/332 (20130101)
C12N 2310/351 (20130101)
C12N 2310/3233 (20130101)
C12N 2320/30 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340536 Aishwarya et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) AUM Lifetech, Inc. (Philadelphia, Pennsylvania);  The Children's Hospital of Philadelphia (Philadelphia, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) Veenu Aishwarya (Philadelphia, Pennsylvania);  Wayne W. Hancock (Philadelphia, Pennsylvania)
ABSTRACT The present invention is directed to hybrid chimera antisense oligonucleotides including deoxyribonucleotide and 2′-deoxy-2′-fluoro-β-D-arabinonucleotide which binds to a Foxp3 mRNA, and to methods of use thereof. The methods include the use for reducing expression level of Foxp3 gene, increasing anti-tumor activity, and treating cancer in a subject.
FILED Wednesday, September 25, 2019
APPL NO 17/279542
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7088 (20130101)
A61K 45/06 (20130101)

Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy
A61N 5/10 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/113 (20130101) Original (OR) Class
C12N 2310/11 (20130101)
C12N 2310/322 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340537 Mihailescu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) DUQUESNE UNIVERSITY OF THE HOLY SPIRIT (Pittsburgh, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) Mihaela Rita Mihailescu (Pittsburgh, Pennsylvania);  Joshua A. Imperatore (Canonsburg, Pennsylvania)
ABSTRACT Provided is an agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229. In some embodiments, the variant is rs2291418. Provided is a method of treating a disease in a subject, comprising: administering a therapeutically effective amount of the agent to the subject. In some embodiments, the disease is Alzheimer's disease, cancer or coronary artery calcification.
FILED Thursday, April 15, 2021
APPL NO 17/301835
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/113 (20130101) Original (OR) Class
C12N 2310/322 (20130101)
C12N 2310/3181 (20130101)
C12N 2320/34 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340538 Hou et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) Jianghui Hou (St. Louis, Missouri);  Dale Bjorling (Madison, Wisconsin);  Zun-Yi Wang (Madison, Wisconsin)
ASSIGNEE(S) Washington University (St. Louis, Missouri);  Wisconsin Alumni Research Foundation (Madison, Wisconsin)
INVENTOR(S) Jianghui Hou (St. Louis, Missouri);  Dale Bjorling (Madison, Wisconsin);  Zun-Yi Wang (Madison, Wisconsin)
ABSTRACT A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
FILED Monday, May 03, 2021
APPL NO 17/306929
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 47/59 (20170801)
A61K 47/549 (20170801)
A61K 47/554 (20170801)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/113 (20130101) Original (OR) Class
C12N 2310/141 (20130101)
C12N 2310/321 (20130101)
C12N 2310/3515 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340542 JAFFREY et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Institute on Drug Abuse (NIDA)
APPLICANT(S) CORNELL UNIVERSITY (Ithaca, New York)
ASSIGNEE(S)
INVENTOR(S) Samie R. JAFFREY (New York, New York);  Jacob L. LITKE (New York, New York)
ABSTRACT The present invention relates to a RNA molecule comprising a first ribozyme, a first ligation sequence, an effector molecule, a second ligation sequence, and a second ribozyme. Methods of producing circular RNA molecules and treatment methods are also disclosed.
FILED Saturday, June 23, 2018
APPL NO 16/625562
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7115 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/63 (20130101)
C12N 15/115 (20130101) Original (OR) Class
C12N 2310/16 (20130101)
C12N 2310/51 (20130101)
C12N 2310/128 (20130101)
C12N 2310/532 (20130101)
C12N 2310/3519 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340552 Deng et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
APPLICANT(S) The Regents of the University of California (Oakland, California)
ASSIGNEE(S)
INVENTOR(S) Changhui Deng (San Francisco, California);  Hao Li (San Francisco, California)
ABSTRACT Compositions, devices, and systems for use in a high-throughput screening platform for identifying anti-aging compounds and/or mutations that extend replicative life span (RLS). Specifically, herein disclosed is a yeast cell daughter-arresting-program (DAP), as well as compositions used in devices and systems that allow measurement of replicative lifespan and identification of agents or mutations that modulate the lifespan.
FILED Thursday, September 05, 2019
APPL NO 17/273065
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/81 (20130101) Original (OR) Class
C12N 2800/102 (20130101)
C12N 2810/70 (20130101)
C12N 2830/702 (20130101)

Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/025 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340566 PEDERSON et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Human Genome Research Institute (NHGRI)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) University of Massachusetts (Boston, Massachusetts);  University of Central Florida Research Foundation, Inc. (Orlando, Florida)
ASSIGNEE(S)
INVENTOR(S) THORU PEDERSON (WORCESTER, Massachusetts);  SCOT ANDREW WOLFE (WINCHESTER, Massachusetts);  HANHUI MA (SHREWSBURY, Massachusetts);  Metewo Selase Kosi Enuameh (Gaithersburg, Maryland);  Nicola Anne Kearns (Somerville, Massachusetts);  Ryan Michael Jude Genga (Farmingham, Massachusetts);  Rene Maehr (Newton, Massachusetts);  Shaojie Zhang (Oviedo, Florida);  Ardalan Naseri (Orlando, Florida);  Manuel Garber (Winchester, Massachusetts)
ABSTRACT The present disclosure relates to methods of and systems for modifying the transcriptional regulation of stem or progenitor cells to promote their differentiation or reprogramming of somatic cells. Further, the labeling and editing of human genomic loci in live cells with three orthogonal CRISPR/Cas9 components allow multicolor detection of genomic loci with high spatial resolution, which provides an avenue for barcoding elements of the human genome in the living state.
FILED Friday, March 12, 2021
APPL NO 17/200398
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0606 (20130101)
C12N 5/0696 (20130101)
C12N 9/22 (20130101)
C12N 15/63 (20130101)
C12N 15/86 (20130101) Original (OR) Class
C12N 15/907 (20130101)
C12N 2501/65 (20130101)
C12N 2501/70 (20130101)
C12N 2510/00 (20130101)
C12N 2740/15043 (20130101)

Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6841 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340575 Doudna et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) Emmanuelle Charpentier (Berlin, Germany);  The Regents of the University of California (Oakland, California);  University of Vienna (Vienna, Austria)
ASSIGNEE(S)
INVENTOR(S) Jennifer A. Doudna (Berkeley, California);  Martin Jinek (Berkeley, California);  Krzysztof Chylinski (Vienna, Austria);  Emmanuelle Charpentier (Berlin, Germany)
ABSTRACT The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
FILED Friday, May 21, 2021
APPL NO 17/326805
CURRENT CPC
New Plants or Processes for Obtaining Them; Plant Reproduction by Tissue Culture Techniques
A01H 6/4684 (20180501)

Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals
A01K 67/027 (20130101)

Preparations for Medical, Dental, or Toilet Purposes
A61K 38/465 (20130101)
A61K 48/00 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/63 (20130101)
C12N 15/70 (20130101)
C12N 15/90 (20130101)
C12N 15/102 (20130101)
C12N 15/111 (20130101)
C12N 15/113 (20130101)
C12N 15/746 (20130101)
C12N 15/902 (20130101)
C12N 15/907 (20130101) Original (OR) Class
C12N 2310/11 (20130101)
C12N 2310/13 (20130101)
C12N 2310/14 (20130101)
C12N 2310/20 (20170501)
C12N 2310/31 (20130101)
C12N 2310/32 (20130101)
C12N 2310/33 (20130101)
C12N 2310/531 (20130101)
C12N 2310/3519 (20130101)
C12N 2800/80 (20130101)

Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/686 (20130101)

Enzymes
C12Y 301/04 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340577 Ajikumar et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts);  National University of Singapore (Singapore, Singapore)
ASSIGNEE(S) Massachusetts Institute of Technology (Cambridge, Massachusetts);  National University of Singapore (Singapore, Singapore)
INVENTOR(S) Parayil K. Ajikumar (Cambridge, Massachusetts);  Gregory Stephanopoulos (Winchester, Massachusetts);  Heng Phon Too (Singapore, Singapore)
ABSTRACT The invention relates to the production of one or more terpenoids through microbial engineering, and relates to the manufacture of products comprising terpenoids.
FILED Friday, May 07, 2021
APPL NO 17/314561
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/70 (20130101)

Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture
C12P 5/007 (20130101) Original (OR) Class
C12P 7/42 (20130101)
C12P 9/00 (20130101)
C12P 15/00 (20130101)
C12P 17/02 (20130101)
C12P 19/56 (20130101)
C12P 23/00 (20130101)

Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/689 (20130101)
C12Q 2600/158 (20130101)

Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components
H05K 999/99 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340594 Greenberg et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) The Johns Hopkins University (Baltimore, Maryland)
ASSIGNEE(S)
INVENTOR(S) Marc Greenberg (US, Maryland);  Daniel Laverty (Baltimore, Maryland)
ABSTRACT Methods for identifying one or more Pol θ inhibitors and methods of use thereof are disclosed.
FILED Wednesday, July 10, 2019
APPL NO 17/259032
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/7048 (20130101)

Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/48 (20130101) Original (OR) Class

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 2333/9126 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340603 Giese et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Environmental Health Sciences (NIEHS)
APPLICANT(S) Northeastern University (Boston, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Roger W. Giese (Hanover, Massachusetts);  Poguang Wang (Westborough, Massachusetts)
ABSTRACT Disclosed is a method for detecting the presence of a DNA adduct in DNA. The method involves the pre-labeling of an adducted nucleotide in the DNA with a quaternary ammonium compound.
FILED Tuesday, May 04, 2021
APPL NO 17/307607
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6827 (20130101) Original (OR) Class
C12Q 1/6834 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340614 Lindsay
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Human Genome Research Institute (NHGRI)
APPLICANT(S) ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona)
ASSIGNEE(S)
INVENTOR(S) Stuart Lindsay (SCOTTSDALE, Arizona)
ABSTRACT The present disclosure provides devices, systems, and methods related to sequencing a biopolymer. In particular, the present disclosure relates to methods for sequencing a polynucleotide using a bioelectronic device that obtains a bioelectronic signature (e.g., current amplitude levels) of polymerase activity based on current fluctuations as complementary nucleotidepolyphosphate monomers (e.g., having distinct charges) are incorporated into the template polynucleotide.
FILED Friday, April 30, 2021
APPL NO 17/246123
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6869 (20130101) Original (OR) Class

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 27/04 (20130101)
G01N 33/4833 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340633 Wang et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland);  Pioneer Hi-Bred International, Inc. (Johnston, Iowa)
ASSIGNEE(S)
INVENTOR(S) Tza-Huei Jeff Wang (Timonium, Maryland);  Alexander Y. Trick (Baltimore, Maryland);  Xiaoyi Sopko (Wilmington, Delaware)
ABSTRACT Provided herein are methods of processing grain samples to detect the fractional abundance of transgenic traits. Related systems and computer program products are also provided.
FILED Friday, April 23, 2021
APPL NO 17/239211
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6851 (20130101)
C12Q 1/6895 (20130101) Original (OR) Class
C12Q 2600/13 (20130101)

Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology
G16B 40/00 (20190201)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341065 Payne et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Drug Abuse (NIDA)
APPLICANT(S) SFC Fluidics, Inc. (Fayetteville, Arkansas)
ASSIGNEE(S)
INVENTOR(S) Forrest W. Payne (Fayetteville, Arkansas);  Bradley Ledden (Fayetteville, Arkansas);  Gil Kan (Alpharetta, Georgia);  Greg Lamps (Smyrna, Georgia)
ABSTRACT A dual latching microvalve is capable of a metastable state, wherein a one or more complete flow paths are open, before switching to another state that allows only an inlet or outlet valve to be open at any time on any fluid path. One valve mechanism uses a cam to alternately open and close two valves, with an external force applying pressure to move one valve arm onto a resting position on the cam, thereby opening the closed valve and provided an uninterrupted flow path through the dual latching microvalve. The metastable state provides, for example, a means to prime the pump before operation, such as pumping of insulin into a patient. When released from the metastable state, the dual latching microvalve operates in a fashion whereby opening of both valves simultaneously is prevented, thereby protecting the patient from injury.
FILED Thursday, August 29, 2019
APPL NO 17/271247
CURRENT CPC
Valves; Taps; Cocks; Actuating-floats; Devices for Venting or Aerating
F16K 7/045 (20130101)
F16K 7/065 (20130101) Original (OR) Class
F16K 11/027 (20130101)
F16K 99/0026 (20130101)
F16K 99/0038 (20130101)
F16K 2099/0069 (20130101)
F16K 2099/0071 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341374 Vacca et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) Kinetic River Corp. (Mountain View, California)
ASSIGNEE(S)
INVENTOR(S) Giacomo Vacca (Campbell, California);  Ralph Jimenez (Boulder, Colorado)
ABSTRACT Described herein are apparatuses for analyzing an optical signal decay. In some embodiments, an apparatus includes: a source of a beam of pulsed optical energy; a sample holder configured to expose a sample to the beam; a detector comprising a number of spectral detection channels configured to convert the optical signals into respective electrical signals; and a signal processing module configured to perform a method. In some embodiments, the method includes: receiving the electrical signals from the detector; mathematically combining individual decay curves in the electrical signals into a decay supercurve, the supercurve comprising a number of components, each component having a time constant and a relative contribution to the supercurve; and numerically fitting a model to the supercurve.
FILED Monday, May 24, 2021
APPL NO 17/328331
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 15/14 (20130101) Original (OR) Class
G01N 15/147 (20130101)
G01N 15/1429 (20130101)
G01N 15/1434 (20130101)
G01N 2015/1006 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341401 Aspinwall et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) ARIZONA BOARD OF REGENTS ON BEHALF OF THE UNIVERSITY OF ARIZONA (Tucson, Arizona)
ASSIGNEE(S)
INVENTOR(S) Craig A. Aspinwall (Tucson, Arizona);  Colleen M. Janczak (Tucson, Arizona);  Zeinab Mokhtari (Tucson, Arizona);  Isen Andrew C. Calderon (Tucson, Arizona)
ABSTRACT Scintillant-doped polystyrene core nanoparticles surrounded by a silica shell can be used to quantify low-energy radionuclides. The nanoparticles are recoverable and re-useable, which may reduce waste and allow for sample recovery. Unlike traditional liquid scintillation cocktail (LSC) formulations, the nanoparticles are made from non-toxic and non-volatile components, and can be used without the aid of surfactants, making them a possible alternative to LSC for reducing the environmental impact of studies that employ radioactive tracers. Recognition elements attached to the functionalized silica surfaces of the nanoparticles allow for separation-free scintillation proximity assay (SPA) applications in aqueous samples. Lipid membrane coatings deposited on the nanoparticle surface can significantly reduce the non-specific adsorption of proteins and other biomolecules, and allow for the incorporation of membrane proteins or other membrane associated binding molecules.
FILED Tuesday, June 15, 2021
APPL NO 17/347938
CURRENT CPC
Materials for Miscellaneous Applications, Not Provided for Elsewhere
C09K 11/02 (20130101)
C09K 11/06 (20130101)
C09K 11/025 (20130101)
C09K 2211/1007 (20130101)
C09K 2211/1018 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 23/2202 (20130101) Original (OR) Class
G01N 33/573 (20130101)
G01N 2223/07 (20130101)
G01N 2223/507 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341412 Jang et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) Mayo Foundation for Medical Education and Research (Rochester, Minnesota);  INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY (Seoul, South Korea)
ASSIGNEE(S)
INVENTOR(S) Dong-Pyo Jang (Sungnam City, South Korea);  Kendall H. Lee (Rochester, Minnesota);  Yoonbae Oh (Rochester, Minnesota);  Christopher J. Kimble (Pine Island, Minnesota)
ABSTRACT Systems, methods, and devices for generating multiple cyclic square-waveforms and sloped-edge square waveforms. Aspects of the techniques disclosed herein include applying the generated waveforms to an electrode used in voltammetry, e.g., to measure a level of a neurochemical in neural tissue. An electrode can be located in a solution, and an electrical stimulus applied to the solution through the electrode using a multiple cyclic square waveform. An electrical current response to the stimulus is measured, and a level of an analyte (e.g., dopamine or other neurochemical(s)) determined based on the electrical current response.
FILED Tuesday, August 20, 2019
APPL NO 17/270671
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 27/3277 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341429 Kijanka et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) Mayo Foundation for Medical Education and Research (Rochester, Minnesota)
ASSIGNEE(S)
INVENTOR(S) Piotr Kijanka (Rochester, Minnesota);  Matthew W. Urban (Rochester, Minnesota)
ABSTRACT Described here are systems and methods for phase velocity imaging using an imaging system, such as an ultrasound system, an optical imaging system (e.g., an optical coherence tomography system), or a magnetic resonance imaging system. In general, systems and methods for constructing phase velocity images (e.g., 2D images, 3D images) from propagating mechanical wave motion data are described. The systems and methods described in the present disclosure operate in the frequency domain and can be implemented using a single frequency or a band of selected frequencies. If there are multiple mechanical wave sources within the field-of-view, directional filtering may be performed to separate mechanical waves propagating in different directions. The reconstructions described below can be performed for each of these directionally filtered components.
FILED Wednesday, August 28, 2019
APPL NO 17/282569
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/7257 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 29/46 (20130101)
G01N 29/075 (20130101) Original (OR) Class
G01N 29/0672 (20130101)

Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves
G01S 7/53 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341462 Huh et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Center for Advancing Translational Sciences (NCATS)
APPLICANT(S) Dongeun HUH (Villanova, Pennsylvania);  Andrei GEORGESCU (Philadelphia, Pennsylvania);  THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania)
ASSIGNEE(S) THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania)
INVENTOR(S) Dongeun Huh (Villanova, Pennsylvania);  Andrei Georgescu (Philadelphia, Pennsylvania)
ABSTRACT The presently disclosed subject matter provides a microfluidic device that can simulate the cross section of the large and small human airways, including the air-exposed epithelial layer, the adjacent surrounding stromal layer, and the blood-facing endothelial layer of near-by vessels in the circulatory system. The microfluidic device can reconstitute the air-liquid interface in the lung and molecular transport characteristics of bronchi and bronchioles in the human pulmonary airways, and provide a more realistic alternative to current in vitro models of airway structures. Additionally, the model can reconstitute the native response of airway tissues to infection by bacterial and viral agents, and also the extravasation of immune cells from the bloodstream and into the stromal and epithelial compartments of the lung in response to an infection. The presently disclosed subject matter also provides microfluidic devices that include multiple chambers assembled by layered stacking or bonding of a basal chamber, a first membrane, an interstitial chamber, a second membrane and an apical chamber.
FILED Monday, October 07, 2019
APPL NO 17/282667
CURRENT CPC
Apparatus for Enzymology or Microbiology;
C12M 23/16 (20130101)
C12M 23/34 (20130101)
C12M 25/14 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0062 (20130101)
C12N 5/0688 (20130101)
C12N 5/0697 (20130101)
C12N 2513/00 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/5005 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341489 ULRICH et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Secretary of the Army (SECARMY)
Defense Threat Reduction Agency (DTRA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE GOVERNMENT OF THE UNITED STATES, AS REPRESENTED BY THE SECRETARY OF THE ARMY (Fort Detrick, Maryland)
ASSIGNEE(S)
INVENTOR(S) Robert G. ULRICH (Frederick, Maryland);  Teddy KAMATA (Frederick, Maryland)
ABSTRACT The disclosure relates to compositions, assays, methods and kits comprising one or more amino acid sequences of a filovirus protein, or a fragment thereof, which find use in the detection of a filovirus infection and/or the presence of antibodies specific for a filovirus in a biological sample.
FILED Wednesday, June 03, 2015
APPL NO 15/316020
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6854 (20130101) Original (OR) Class
G01N 2333/08 (20130101)
G01N 2469/20 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341492 Hahn et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Institute of Child Health and Human Development (NICHD)
APPLICANT(S) Seattle Children's Hospital d/b/a Seattle Children's Research Institute (Seattie, Washington);  Fred Hutchinson Cancer Research Center (Seattie, Washington)
ASSIGNEE(S) Seattle Children's Hospital d/b/a Seattle Children's Research Institute (Seattle, Washington);  Fred Hutchinson Cancer Research Center (Seattle, Washington)
INVENTOR(S) Sihoun Hahn (Clyde Hill, Washington);  Sunhee Jung (Seattle, Washington);  Jeffrey Whiteaker (Seattle, Washington);  Troy Torgerson (Seattle, Washington);  Amanda Paulovich (Seattle, Washington);  Christopher Collins (Seattle, Washington);  Remwilyn Dayuha (Lynnwood, Washington)
ABSTRACT Newborn screening for primary immunodeficiencies, cystinosis, and Wilson disease is described. The newborn screening can detect these disorders from dried blood spots already routinely collected at the time of birth. Early detection of these disorders will greatly improve patient outcome as each of them can be fatal once symptoms emerge.
FILED Friday, October 04, 2019
APPL NO 17/282989
CURRENT CPC
Peptides
C07K 16/2809 (20130101)
C07K 2317/34 (20130101)
C07K 2317/565 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6848 (20130101)
G01N 33/6893 (20130101) Original (OR) Class
G01N 2800/24 (20130101)
G01N 2800/60 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341494 O'Bryant et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
APPLICANT(S) University of North Texas Health Science Center at Fort Worth (Fort Worth, Texas)
ASSIGNEE(S)
INVENTOR(S) Sid E. O'Bryant (Aledo, Texas);  Leigh A. Johnson (Aledo, Texas)
ABSTRACT The present invention includes methods for selecting a therapy for improved cognition as well as prevention of cognitive loss/dysfunction using one or more endophenotypes comprising: obtaining a sample from a subject; measuring biomarkers that differentiate between an inflammatory, a metabolic, a neurotrophic, and a depressive endophenotype; and selecting a course of treatment for the subject based on whether the subject is scored as having a high or a low endophenotype for one or more of the inflammatory, a metabolic, a neurotrophic, and a depressive endophenotypes.
FILED Tuesday, June 29, 2021
APPL NO 17/361763
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6883 (20130101)
C12Q 2600/106 (20130101)
C12Q 2600/158 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6896 (20130101) Original (OR) Class
G01N 2800/52 (20130101)
G01N 2800/60 (20130101)
G01N 2800/2814 (20130101)
G01N 2800/7095 (20130101)

Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology
G16B 40/00 (20190201)
G16B 40/20 (20190201)
G16B 40/30 (20190201)

Healthcare Informatics, i.e Information and Communication Technology [ICT] Specially Adapted for the Handling or Processing of Medical or Healthcare Data
G16H 50/20 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341495 Barthelemy et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
National Institute of Neurological Disorders and Stroke (NINDS)
APPLICANT(S) Washington University (ST. LOUIS, Missouri)
ASSIGNEE(S)
INVENTOR(S) Nicolas Barthelemy (St. Louis, Missouri);  Randall Bateman (St. Louis, Missouri);  Eric McDade (ST. LOUIS, Missouri)
ABSTRACT The present disclosure provides methods to quantify tau phosphorylation at specific amino acid residues to predict time to onset of mild cognitive impairment due to Alzheimer's disease, stage Alzheimer's disease, guide treatment decisions, select subjects for clinical trials, and evaluate the clinical efficacy of certain therapeutic interventions.
FILED Tuesday, July 06, 2021
APPL NO 17/368403
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6896 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341496 Roper et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) The Florida State University Research Foundation, Inc. (Tallahassee, Florida)
ASSIGNEE(S)
INVENTOR(S) Michael G. Roper (Tallahassee, Florida);  Joel E. Adablah (Tallahassee, Florida);  Matthew Donohue (Tallahassee, Florida)
ABSTRACT Methods and systems for insulin detection. The methods may include contacting one or more islets with glucose to produce a first stream that is then contacted with an anti-insulin antibody and a labeled insulin to produce a second stream. The second stream may be analyzed to determine a ratio of antibody-bound (B) labeled insulin to free (F) labeled insulin in the second stream, wherein the ratio of B:F is inversely related to a concentration of target insulin.
FILED Friday, April 30, 2021
APPL NO 17/246546
CURRENT CPC
Chemical or Physical Laboratory Apparatus for General Use
B01L 3/5027 (20130101)
B01L 2200/027 (20130101)

Peptides
C07K 16/26 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 21/6445 (20130101)
G01N 33/74 (20130101) Original (OR) Class
G01N 33/84 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341557 Zhao et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Biomedical Imaging and Bioengineering (NIBIB)
APPLICANT(S) THE GENERAL HOSPITAL CORPORATION (Boston, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Bo Zhao (Malden, Massachusetts);  Lawrence Wald (Cambridge, Massachusetts)
ABSTRACT Systems and methods for reconstructing MR parameter maps of a subject from magnetic resonance fingerprinting (MRF) data acquired using a magnetic resonance imaging (MRI) system. The method includes providing MRF data acquired from a subject using an MRI system and reconstructing the MRF data by solving a constrained optimization problem using a low-rank model, for which an input to the optimization problem is the MRF data and an output from the optimization problem is the MRF time-series images.
FILED Tuesday, July 13, 2021
APPL NO 17/374693
CURRENT CPC
Measuring Electric Variables; Measuring Magnetic Variables
G01R 33/50 (20130101)
G01R 33/561 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342646 Feng et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Heart, Lung, and Blood Institute (NHLBI)
APPLICANT(S) Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona)
ASSIGNEE(S)
INVENTOR(S) Ruibin Feng (Scottsdale, Arizona);  Zongwei Zhou (Tempe, Arizona);  Jianming Liang (Scottsdale, Arizona)
ABSTRACT Described herein are means for training a deep model to learn contrastive representations embedded within part-whole semantics via a self-supervised learning framework, in which the trained deep models are then utilized for the processing of medical imaging. For instance, an exemplary system is specifically configured for performing a random cropping operation to crop a 3D cube from each of a plurality of medical images received at the system as input, performing a resize operation of the cropped 3D cubes, performing an image reconstruction operation of the resized and cropped 3D cubes to predict the resized whole image represented by the original medical images received; and generating a reconstructed image which is analyzed for reconstruction loss against the original image representing a known ground truth image to the reconstruction loss function. Other related embodiments are disclosed.
FILED Monday, April 26, 2021
APPL NO 17/240271
CURRENT CPC
Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/6259 (20130101) Original (OR) Class
G06K 2209/051 (20130101)

Image Data Processing or Generation, in General
G06T 7/0012 (20130101)
G06T 7/174 (20170101)
G06T 15/08 (20130101)
G06T 17/10 (20130101)
G06T 2207/20081 (20130101)
G06T 2207/20084 (20130101)
G06T 2207/20132 (20130101)
G06T 2207/30016 (20130101)
G06T 2207/30056 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343014 Haghighi et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Heart, Lung, and Blood Institute (NHLBI)
APPLICANT(S) Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona)
ASSIGNEE(S)
INVENTOR(S) Fatemeh Haghighi (Tempe, Arizona);  Mohammad Reza Hosseinzadeh Taher (Tempe, Arizona);  Zongwei Zhou (Tempe, Arizona);  Jianming Liang (Tempe, Arizona)
ABSTRACT Described herein are means for the generation of semantic genesis models through self-supervised learning in the absence of manual labeling, in which the trained semantic genesis models are then utilized for the processing of medical imaging. For instance, an exemplary system is specially configured with means for performing a self-discovery operation which crops 2D patches or crops 3D cubes from similar patient scans received at the system as input; means for transforming each anatomical pattern represented within the cropped 2D patches or the cropped 3D cubes to generate transformed 2D anatomical patterns or transformed 3D anatomical patterns; means for performing a self-classification operation of the transformed anatomical patterns by formulating a C-way multi-class classification task for representation learning; means for performing a self-restoration operation by recovering original anatomical patterns from the transformed 2D patches or transformed 3D cubes having transformed anatomical patterns embedded therein to learn different sets of visual representation; and means for providing a semantics-enriched pre-trained AI model having a trained encoder-decoder structure with skip connections in between based on the performance of the self-discovery operation, the self-classification operation, and the self-restoration operation. Other related embodiments are disclosed.
FILED Friday, April 30, 2021
APPL NO 17/246032
CURRENT CPC
Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/3233 (20130101)
G06K 9/4638 (20130101)
G06K 9/6204 (20130101)

Image Data Processing or Generation, in General
G06T 3/0012 (20130101)
G06T 7/0014 (20130101) Original (OR) Class
G06T 2207/20081 (20130101)
G06T 2207/20084 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343015 MOUTON et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Mental Health (NIMH)
APPLICANT(S) UNIVERSITY OF SOUTH FLORIDA (Tampa, Florida);  STEREOLOGY RESOURCE CENTER, INC. (Saint Petersburg, Florida)
ASSIGNEE(S)
INVENTOR(S) PETER RANDOLPH MOUTON (St. Petersburg, Florida);  HADY AHMADY PHOULADY (Portland, Maine);  DMITRY GOLDGOF (Lutz, Florida);  LAWRENCE O. HALL (Tampa, Florida)
ABSTRACT Systems and methods for automated stereology are provided. A method can include providing an imager for capturing a Z-stack of images of a three-dimensional (3D) object; constructing extended depth of field (EDF) images from the Z-stack of images; performing a segmentation method on the EDF images including estimating a Gaussian Mixture Model (GMM), performing morphological operations, performing watershed segmentation, constructing Voronoi diagrams and performing boundary smoothing; and determining one or more stereology parameters such as number of cells in a region.
FILED Wednesday, May 05, 2021
APPL NO 17/308592
CURRENT CPC
Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/0014 (20130101)
G06K 9/00147 (20130101)

Computer Systems Based on Specific Computational Models
G06N 3/08 (20130101)
G06N 20/00 (20190101)

Image Data Processing or Generation, in General
G06T 5/002 (20130101)
G06T 5/20 (20130101)
G06T 7/11 (20170101)
G06T 7/0014 (20130101) Original (OR) Class
G06T 7/97 (20170101)
G06T 7/174 (20170101)
G06T 17/205 (20130101)
G06T 2207/20081 (20130101)
G06T 2207/20084 (20130101)
G06T 2207/20152 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343364 Wang et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland)
ASSIGNEE(S)
INVENTOR(S) Tza-Huei Jeff Wang (Timonium, Maryland);  Alexander Y. Trick (Baltimore, Maryland)
ABSTRACT Provided herein are methods of performing multiplexed real-time quantitative ratiometric regression PCR (qRR-PCR) to determine the fractional abundance of target variants in a population. Related systems and computer program products are also provided.
FILED Friday, April 23, 2021
APPL NO 17/238872
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/686 (20130101)
C12Q 2600/156 (20130101)

Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology
G16B 5/00 (20190201)
G16B 20/20 (20190201) Original (OR) Class
G16B 25/20 (20190201)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343422 Wood et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) Georgia Tech Research Corporation (Atlanta, Georgia)
ASSIGNEE(S)
INVENTOR(S) Levi Wood (Atlanta, Georgia);  James E. Forsmo (Atlanta, Georgia);  Laura D. Weinstock (Atlanta, Georgia);  Alexis F. Wilkinson (Atlanta, Georgia)
ABSTRACT The disclosure is directed to technologies for restoring proper regulation of the immune response and novel methods and systems for exogenously controlling immune cells in order to dynamically and predictively drive the immune response through pro-inflammatory activity to anti-inflammatory activity, mimicking the immune system's natural progression through these states. Embodiments of the present disclosure relate generally to methods and systems for dynamic predictive modeling and control of inflammation and the immune response, and more specifically to methods and systems for predictive modeling and control of the inflammatory state of immune cells via temporally regulated immune-modulating stimuli.
FILED Friday, October 11, 2019
APPL NO 17/284216
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/5047 (20130101)

Healthcare Informatics, i.e Information and Communication Technology [ICT] Specially Adapted for the Handling or Processing of Medical or Healthcare Data
G16H 50/50 (20180101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343515 EBERLIN et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas)
ASSIGNEE(S)
INVENTOR(S) Livia Schiavinato EBERLIN (Austin, Texas);  Marta Sans ESCOFET (Austin, Texas);  Bryan R. WYGANT (Austin, Texas);  Jialing ZHANG (Austin, Texas);  C. Buddie MULLINS (Austin, Texas)
ABSTRACT Method and devices are provided for imaging a surface, such as a biological tissue sample, by mass spectrometry. In certain aspects, devices of the embodiments allow for the placement and collection of a plurality of spatially separated liquid droplets on a sample and delivery of the droplets with extracted sample analytes for mass spectrometry analysis.
FILED Friday, June 08, 2018
APPL NO 16/620298
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6848 (20130101)

Electric Discharge Tubes or Discharge Lamps
H01J 49/0004 (20130101) Original (OR) Class
H01J 49/0431 (20130101)
H01J 49/0477 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344626 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352551
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344627 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352564
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344628 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352579
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344629 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352590
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344630 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352611
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344631 Hsu et al.
FUNDED BY
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Aging (NIA)
NIH Office of the Director (NIHOD)
APPLICANT(S) Salk Institute for Biological Studies (La Jolla, California)
ASSIGNEE(S) Salk Institute for Biological Studies (La Jolla, California)
INVENTOR(S) Patrick D. Hsu (San Francisco, California);  Silvana Konermann (Menlo Park, California)
ABSTRACT Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA.
FILED Monday, June 21, 2021
APPL NO 17/352725
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/85 (20130101)
C12N 15/102 (20130101)
C12N 15/113 (20130101)
C12N 15/8201 (20130101)
C12N 15/8213 (20130101)
C12N 2310/16 (20130101)
C12N 2310/20 (20170501)
C12N 2310/3519 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/08 (20130101)
H04L 9/30 (20130101)
H04L 45/745 (20130101)
H04L 51/08 (20130101)
H04L 51/12 (20130101) Original (OR) Class
H04L 51/14 (20130101)
H04L 51/18 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 

Department of Defense (DOD) 

US 20210338171 Derksen et al.
FUNDED BY
Department of Defense (DOD)
National Science Foundation (NSF)
APPLICANT(S) The Regents of the University of Michigan (Ann Arbor, Michigan)
ASSIGNEE(S)
INVENTOR(S) Hendrikus Derksen (Dexter, Michigan);  Neriman Tokcan (Somerville, Massachusetts);  Kayvan Najarian (Northville, Michigan);  Jonathan Gryak (Ann Arbor, Michigan)
ABSTRACT A method of generating an assessment of medical condition for a patient includes obtaining a patient data tensor indicative of a plurality of tests conducted on the patient, obtaining a set of tensor factors, each tensor factor of the set of tensor factors being indicative of a decomposition of training tensor data for the plurality of tests, the decomposition amplifying low rank structure of the training tensor data, determining a patient tensor factor for the patient based on the obtained patient data tensor and the obtained set of tensor factors, applying the determined patient tensor factor to a classifier such that the determined further tensor factor establishes a feature vector for the patient, the classifier being configured to process the feature vector to generate the assessment, and providing output data indicative of the assessment.
FILED Thursday, February 04, 2021
APPL NO 17/167140
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/7264 (20130101) Original (OR) Class

Electric Digital Data Processing
G06F 17/40 (20130101)

Computer Systems Based on Specific Computational Models
G06N 20/00 (20190101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338173 Palmer et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
U.S. Air Force
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S) Massachusetts Institute of Technology (Cambridge, Massachusetts);  U.S. Army Research Institute of Environmental Medicine (Natick, Massachusetts)
INVENTOR(S) Jeffrey Palmer (Westford, Massachusetts);  Brian Telfer (Lincoln, Massachusetts);  James Williamson (Arlington, Massachusetts);  Lara Weed (East Kingston, New Hampshire);  Mark Buller (Douglas, Massachusetts);  Rebecca Fellin (Natick, Massachusetts);  Joseph Seay (Marlborough, Massachusetts)
ABSTRACT A heat response monitor, comprises an accelerometer, a core temperature sensor, an estimation device, and an enabler. The estimation device uses accelerometry-based functionality to provide a gait-based heat stroke risk score, and the estimation device uses an estimated core temperature of a wearer of the core temperature sensor, to provide an estimated core temperature-based heat stroke risk score. The gait-based heat stroke risk score and the estimated core temperature-based heat stroke risk score are used to determine if a wearer of the heat response monitor is in risk of heat injury.
FILED Wednesday, June 24, 2020
APPL NO 16/910614
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/1123 (20130101)
A61B 5/02055 (20130101)
A61B 5/02438 (20130101)
A61B 5/7275 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338245 JOHNSON et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Materiel Command (AFMC)
United States Air Force (USAF)
APPLICANT(S) Certus Critical Care, Inc. (Sacramento, California);  Wake Forest University Health Sciences (Winston-Salem, North Carolina)
ASSIGNEE(S)
INVENTOR(S) Michael Austin JOHNSON (Holladay, Utah);  David POISNER (Carmichael, California);  Melanie MCWADE (Portland, Oregon);  Timothy WILLIAMS (Winston-Salem, North Carolina);  Lucas NEFF (Winston-Salem, North Carolina)
ABSTRACT Systems and methods for blood flow control are described herein. In some variations, a blood flow control system may comprise a blood flow control device. The blood flow control device may be placed within a body of a patient and may comprise an expandable member and a sensor. The sensor may be configured to measure at least one of a physiologic condition of the patient and a pressure associated with the expandable member. The blood flow control system may include at least one controller communicably coupled to the sensor to: receive data indicative of at least one of the physiologic condition of the patient and the pressure associated with the expandable member from the sensor, compare the received data with target data, identify at least one error based on the comparison, and in response to identifying the error, inhibit at least one function of the blood flow control system.
FILED Thursday, July 01, 2021
APPL NO 17/365932
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 17/12109 (20130101) Original (OR) Class
A61B 17/12136 (20130101)
A61B 34/25 (20160201)
A61B 2017/00557 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338349 Farritor et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army
U.S. Army Medical Research and Development Command (USAMRDC)
U.S. Army Medical Research and Materiel Command (USAMRMC)
APPLICANT(S) Board of Regents of the University of Nebraska (Lincoln, Nebraska)
ASSIGNEE(S)
INVENTOR(S) Shane Farritor (Lincoln, Nebraska);  Erik Mumm (Longmont, Colorado);  Philip Chu (Friendswood, Texas);  Nishant Kumar (Bergenfield, New Jersey);  Jason Dumpert (Omaha, Nebraska);  Yutaka Tsutano (Campbell, California)
ABSTRACT The embodiments disclosed herein relate to various medical device components, including components that can be incorporated into robotic and/or in vivo medical devices. Certain embodiments include various modular medical devices for in vivo medical procedures.
FILED Tuesday, July 06, 2021
APPL NO 17/368023
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 17/29 (20130101)
A61B 17/00234 (20130101)
A61B 34/00 (20160201)
A61B 34/30 (20160201) Original (OR) Class
A61B 34/37 (20160201)
A61B 90/30 (20160201)
A61B 90/361 (20160201)
A61B 2017/2906 (20130101)
A61B 2034/302 (20160201)
A61B 2217/005 (20130101)
A61B 2217/007 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338593 Ferrari et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army Medical Research and Materiel Command (USAMRMC)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Aeronautics and Space Administration (NASA)
APPLICANT(S) Board of Regents of the University of Texas System (Austin, Texas);  The Ohio State University Research Foundation (Columbus, Ohio)
ASSIGNEE(S) Board of Regents of the University of Texas System (Austin, Texas);  The Ohio State University Research Foundation (Columbus, Ohio)
INVENTOR(S) Mauro Ferrari (Houston, Texas);  Ennio Tasciotti (Houston, Texas);  Jason Sakamoto (Houston, Texas)
ABSTRACT Multistage delivery vehicles are disclosed which include a first stage particle and a second stage particle. The first stage particle is a micro or nanoparticle that contains the second stage particle. The second stage particle includes an active agent, such as a therapeutic agent or an imaging agent. The multistage delivery vehicle allows sequential overcoming or bypassing of biological barriers. The multistage delivery vehicle is administered as a part of a composition that includes a plurality of the vehicles. Methods of making the multistage delivery vehicles are also provided.
FILED Tuesday, July 06, 2021
APPL NO 17/368401
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/50 (20130101) Original (OR) Class
A61K 9/51 (20130101)
A61K 9/127 (20130101)
A61K 9/1271 (20130101)
A61K 31/165 (20130101)
A61K 31/704 (20130101)
A61K 31/7088 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338664 Singh
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Joint Program Executive Office for Chemical, Biological, Radiological and Nuclear Defense (JPEO-CBRND)
APPLICANT(S) CFD Research Corporation (Huntsville, Alabama)
ASSIGNEE(S)
INVENTOR(S) Narender Singh (Madison, Alabama)
ABSTRACT A method for providing a therapy to a subject that has been exposed to an Aflatoxin B1 can include administering a compound having a structure of Formula 1 to the subject after exposure to the Aflatoxin B1: wherein: R1, R2, R3, R4, R5 and/or R6 are each individually a chemical moiety and n is 1, 2, 3, 4, or 5. The compound can be Amprenavir or a derivative thereof, prodrug thereof, salt thereof, or stereoisomer thereof, or having any chirality at any chiral center, or tautomer, polymorph, solvate, or combination thereof. The prodrug can be Amprenavir phosphate.
FILED Wednesday, April 29, 2020
APPL NO 16/862500
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 31/497 (20130101) Original (OR) Class

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 1/16 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338736 INGBER et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Army (DOA)
Army Research Office (ARO)
APPLICANT(S) PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts)
ASSIGNEE(S) PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts)
INVENTOR(S) Donald E. INGBER (Boston, Massachusetts);  Samira MUSAH (Malden, Massachusetts)
ABSTRACT Embodiments of various aspects described herein relate to methods, kits, and cell culture media for generation of podocytes from pluripotent stem (PS) cells, as well as cells produced by the same, and methods of use.
FILED Friday, July 02, 2021
APPL NO 17/366827
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 35/22 (20130101) Original (OR) Class
A61K 35/545 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 5/0686 (20130101)
C12N 2501/16 (20130101)
C12N 2501/155 (20130101)
C12N 2501/165 (20130101)
C12N 2501/385 (20130101)
C12N 2501/415 (20130101)
C12N 2501/727 (20130101)
C12N 2506/02 (20130101)
C12N 2506/45 (20130101)
C12N 2533/52 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338789 Khan et al.
FUNDED BY
Department of Defense (DOD)
Defense Medical Research and Development Program (DMRDP)
Joint Warfighter Medical Research Program (JWMRP)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts);  Whitehead Institute for Biomedical Research (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Omar F. Khan (Cambridge, Massachusetts);  Jasdave S. Chahal (Arlington, Massachusetts);  Daniel G. Anderson (Cambridge, Massachusetts);  Hidde Ploegh (Brookline, Massachusetts);  Robert S. Langer (Cambridge, Massachusetts);  Tyler E. Jacks (Cambridge, Massachusetts);  David A. Canner (Cambridge, Massachusetts)
ABSTRACT Compositions and methods for modified dendrimer nanoparticle (“MDNP”) delivery of therapeutic, prophylactic and/or diagnostic agent such as large repRNA molecules to the cells of a subject have been developed. MDNPs efficiently drive proliferation of antigen-specific T cells against intracellular antigen, and potentiate antigen-specific antibody responses. MDNPs can be multiplexed to deliver two or more different repRNAs to modify expression kinetics of encoded antigens and to simultaneous deliver repRNAs and mRNAs including the same UTR elements that promote expression of encoded antigens.
FILED Wednesday, March 10, 2021
APPL NO 17/198037
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)
A61K 9/5146 (20130101)
A61K 31/713 (20130101)
A61K 39/002 (20130101)
A61K 39/0012 (20130101) Original (OR) Class
A61K 39/12 (20130101)
A61K 39/145 (20130101)
A61K 48/00 (20130101)
A61K 2039/53 (20130101)
A61K 2039/70 (20130101)
A61K 2039/645 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/87 (20130101)
C12N 15/88 (20130101)
C12N 2740/16234 (20130101)
C12N 2760/14134 (20130101)
C12N 2760/16034 (20130101)
C12N 2770/24134 (20130101)
C12N 2770/36143 (20130101)

Technologies for Adaptation to Climate Change
Y02A 50/30 (20180101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339011 ALBECK et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
United States Army (USA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute on Deafness and Other Communication Disorders (NIDCD)
APPLICANT(S) Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel);  NORTHWESTERN UNIVERSITY (Evanston, Illinois)
ASSIGNEE(S) Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel);  NORTHWESTERN UNIVERSITY (Evanston, Illinois)
INVENTOR(S) Dan David ALBECK (Givat Shmuel, Israel);  Claus Peter RICHTER (Skokie, Illinois)
ABSTRACT Disclosed is a method of selecting stimulations for a cochlear implant or an auditory implant. The method may include: capturing an acoustical signal; dividing the acoustical signal into a plurality of frequency bands; determining a mean acoustical energy for each frequency band; for each frequency band: comparing the mean acoustical energy with the mean acoustical energy determined for neighboring frequency bands; merging neighboring frequency bands having a difference between the mean acoustical energies that is less than an acoustical energy threshold value; selecting one or more types of stimulation to be applied to one or more locations in a cochlea or along an auditory nerve based on bandwidths of each frequency band. The one or more types of stimulation may be selected from: electrical stimulation, optical stimulation and opto-electrical stimulation, and the one or more locations in cochlea or along the auditory nerve may correspond to specific frequencies of the acoustical signal.
FILED Wednesday, August 14, 2019
APPL NO 17/268400
CURRENT CPC
Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy
A61N 1/0541 (20130101) Original (OR) Class
A61N 1/36038 (20170801)
A61N 1/36171 (20130101)
A61N 1/36175 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339201 Benton et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Army (DOA)
Army Research Office (ARO)
APPLICANT(S) Porifera, Inc. (San Leandro, California)
ASSIGNEE(S) Porifera, Inc. (San Leandro, California)
INVENTOR(S) Charles Benton (Berkeley, California);  Olgica Bakajin (Berkeley, California)
ABSTRACT An example separation system includes a stack of membrane plate assemblies. An example membrane plate assembly may include membranes bonded to opposite sides of a spacer plate. The spacer plate may include a first opening in fluid communication with a region between the membranes, and a second opening in fluid communication with a region between membrane plate assemblies. Adjacent membrane plate assemblies in the stack may have alternating orientations such that bonding areas for adjacent membranes in the stack may be staggered. Accordingly, two isolated flows may be provided which may be orthogonal from one another.
FILED Wednesday, July 14, 2021
APPL NO 17/375932
CURRENT CPC
Separation
B01D 61/002 (20130101)
B01D 63/082 (20130101) Original (OR) Class
B01D 63/084 (20130101)
B01D 63/085 (20130101)
B01D 2313/14 (20130101)
B01D 2319/00 (20130101)
B01D 2319/02 (20130101)
B01D 2319/04 (20130101)

Treatment of Water, Waste Water, Sewage, or Sludge
C02F 1/445 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339243 GLEZER et al.
FUNDED BY
Department of Defense (DOD)
Defense Threat Reduction Agency (DTRA)
APPLICANT(S) MESO SCALE TECHNOLOGIES, LLC (Rockville, Maryland)
ASSIGNEE(S)
INVENTOR(S) Eli N. GLEZER (Chevy Chase, Maryland);  Bandele Jeffrey-Coker (Darnestown, Maryland);  Jeffery D. Debad (Gaithersburg, Maryland);  Sudeep M. Kumar (Gaithersburg, Maryland);  George B. Sigal (Rockville, Maryland);  Bisbert Spieles (Bethesda, Maryland);  Michael Tsionsky (Derwood, Maryland);  Michael Warnock (Carlsbad, California)
ABSTRACT We describe assay modules (e.g., assay plates, cartridges, multi-well assay plates, reaction vessels, etc.), processes for their preparation, and method of their use for conducting assays. Reagents may be present in free form or supported on solid phases including the surfaces of compartments (e.g., chambers, channels, flow cells, wells, etc.) in the assay modules or the surface of colloids, beads, or other particulate supports. In particular, dry reagents can be incorporated into the compartments of these assay modules and reconstituted prior to their use in accordance with the assay methods. A desiccant material may be used to maintain and stabilize these reagents in a dry state.
FILED Friday, July 16, 2021
APPL NO 17/378294
CURRENT CPC
Chemical or Physical Laboratory Apparatus for General Use
B01L 3/5025 (20130101) Original (OR) Class
B01L 3/5085 (20130101)
B01L 2200/12 (20130101)
B01L 2200/16 (20130101)
B01L 2300/105 (20130101)
B01L 2300/0636 (20130101)
B01L 2300/0645 (20130101)
B01L 2300/0829 (20130101)
B01L 2300/0851 (20130101)
B01L 2300/0858 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/5304 (20130101)
G01N 33/54366 (20130101)
G01N 33/54393 (20130101)

Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests
Y10S 436/809 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339316 Xia et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
National Science Foundation (NSF)
Directorate for Mathematical and Physical Sciences (MPS)
Division of Materials Research (DMR)
APPLICANT(S) University of Washington (Seattle, Washington)
ASSIGNEE(S) University of Washington (Seattle, Washington)
INVENTOR(S) Younan Xia (St. Louis, Missouri);  Sang-Hyuk Im (Pohang-Shi, South Korea);  Yugang Sun (Naperville, Illinois);  Yun Tack Lee (Seattle, Washington);  Benjamin Wiley (Boston, Massachusetts)
ABSTRACT Methods for producing silver nanostructures with improved dimensional control, yield, purity, monodispersed, and scale of synthesis.
FILED Wednesday, March 17, 2021
APPL NO 17/249885
CURRENT CPC
Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder
B22F 1/0025 (20130101)
B22F 9/24 (20130101) Original (OR) Class
B22F 2001/0037 (20130101)
B22F 2009/245 (20130101)
B22F 2301/255 (20130101)
B22F 2304/05 (20130101)
B22F 2998/10 (20130101)

Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 30/00 (20130101)
B82Y 40/00 (20130101)

Production and Refining of Metals; Pretreatment of Raw Materials
C22B 11/04 (20130101)

Alloys
C22C 5/02 (20130101)
C22C 5/06 (20130101)

Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor
C30B 7/00 (20130101)
C30B 29/02 (20130101)
C30B 29/60 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339325 Grogan et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
U.S. Navy
APPLICANT(S) Powdermet, Inc. (Euclid, Ohio)
ASSIGNEE(S)
INVENTOR(S) Mark Grogan (Cleveland, Ohio);  Brian Doud (Cleveland Heights, Ohio);  Andrew Sherman (Mentor, Ohio)
ABSTRACT A heterogeneous composite consisting of near-nano ceramic clusters dispersed within a ductile matrix. The composite is formed through the high temperature compaction of a starting powder consisting of a core of ceramic nanoparticles held together with metallic binder. This core is clad with a ductile metal such that when the final powder is consolidated, the ductile metal forms a tough, near-zero contiguity matrix. The material is consolidated using any means that will maintain its heterogeneous structure.
FILED Thursday, July 08, 2021
APPL NO 17/370431
CURRENT CPC
Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder
B22F 1/025 (20130101)
B22F 3/14 (20130101)
B22F 3/15 (20130101)
B22F 3/17 (20130101)
B22F 3/18 (20130101)
B22F 3/20 (20130101)
B22F 3/24 (20130101)
B22F 3/105 (20130101)

Working of Metal by the Action of a High Concentration of Electric Current on a Workpiece Using an Electrode Which Takes the Place of a Tool; Such Working Combined With Other Forms of Working of Metal
B23H 1/08 (20130101)
B23H 5/04 (20130101)
B23H 5/12 (20130101) Original (OR) Class
B23H 7/00 (20130101)

Metal-working Not Otherwise Provided For; Combined Operations; Universal Machine Tools
B23P 13/02 (20130101)

Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone
C04B 35/5626 (20130101)
C04B 35/58014 (20130101)

Alloys
C22C 29/00 (20130101)
C22C 32/00 (20130101)

Shafts; Flexible Shafts; Elements or Crankshaft Mechanisms; Rotary Bodies Other Than Gearing Elements; Bearings
F16C 17/00 (20130101)
F16C 33/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339488 Cardenas et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Laboratory (ARL)
Combat Capabilities Development Command (CCDC)
APPLICANT(S) U.S. Army Combat Capabilities Development Command, Army Research Laboratory (Adelphi, Maryland)
ASSIGNEE(S)
INVENTOR(S) Jorge A. Cardenas (Durham, North Carolina);  Nathan S. Lazarus (North Bethesda, Maryland);  Harvey H. Tsang (Rockville, Maryland)
ABSTRACT Photonic annealing is used to treat electrically-conductive thermoplastic. The thermoplastic forms, partially or wholly, a part which may be formed by additive manufacturing, like fused filament fabrication (FFF). The photonic annealing improves part conductivity and also alter, enhance, or give rise to other material properties while taking significantly less time than other conventional post-process methods. For instance, the baseline conductivity of the electrically-conductive thermoplastic material may be on the order of 103 S/m or lower. After the photonic annealing, its conductivity may be raised to the order of 104-105 S/m or more. This represents an improvement of 10-100× or even more of conductivity of the electrically-conductive thermoplastic compared to electrically-conductive thermoplastic prior to the photonic annealing.
FILED Monday, May 04, 2020
APPL NO 16/866396
CURRENT CPC
Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing
B29C 64/30 (20170801)
B29C 64/118 (20170801)
B29C 71/02 (20130101) Original (OR) Class
B29C 2071/022 (20130101)

Indexing Scheme Associated With Subclasses B29B, B29C or B29D, Relating to Moulding Materials or to Materials for Reinforcements, Fillers or Preformed Parts, e.g Inserts
B29K 2101/12 (20130101)

Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering
B33Y 10/00 (20141201)
B33Y 30/00 (20141201)
B33Y 40/20 (20200101)
B33Y 80/00 (20141201)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340049 Wiest et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Naval Surface Warfare Center (NSWC)
Secretary of the Navy (SECNAV)
APPLICANT(S) The United States of America, as represented by the Secretary of the Navy (Crane, Indiana)
ASSIGNEE(S) The United States of America, as represented by the Secretary of the Navy (Arlington, Virginia)
INVENTOR(S) Aaron Wiest (Norco, California);  Rebecca Stevens (Anaheim, California);  Robert Dale Conner (Oak Hills, California);  Craig MacDougall (Norco, California);  Sam Pratt (Arlington, Virginia)
ABSTRACT Apparatus and methods for forming and printing hollow bodies from amorphous materials to form three-dimensional objects are provided. Apparatus provide a hollow body forming and printing machine, and methods for determining a desired amount of impact deformation for the hollow spheres, including calculating specific characteristics of the hollow spheres and the amorphous material, deriving a target viscosity range, adjusting the apparatus to satisfy the target viscosity range, and using the apparatus to form a plurality of hollow spheres with controlled deformation.
FILED Monday, June 28, 2021
APPL NO 17/360426
CURRENT CPC
Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing
B29C 64/106 (20170801)
B29C 64/194 (20170801)
B29C 64/393 (20170801)
B29C 2945/7605 (20130101)

Producing Particular Articles From Plastics or From Substances in a Plastic State
B29D 22/04 (20130101)

Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering
B33Y 30/00 (20141201)

Manufacture, Shaping, or Supplementary Processes
C03B 19/1075 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340067 Boakye et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Secretary of the Air Force (SECAF)
APPLICANT(S) Government of the United States as represented by the Secretary of the Air Force (Wright-Patterson AFB, Ohio)
ASSIGNEE(S)
INVENTOR(S) Emmanuel E. Boakye (Centerville, Ohio);  Michael K. Cinibulk (Beavercreek, Ohio);  Randal S. Hay (Beavercreek, Ohio);  Pavel Mogilevsky (Beavercreek, Ohio);  Triplicane A. Parthasarathy (Beavercreek, Ohio);  Kristin A. Keller (Springboro, Ohio)
ABSTRACT A method of manufacturing a coated reinforcing fiber for use in Ceramic Matrix Composites, the method comprising pre-oxidizing a plurality of silicon-based fibers selected from the group consisting of silicon carbide (SiC) fibers, silicon nitride (Si3N4) fibers, SiCO fibers, SiCN fibers, SiCNO fibers, and SiBCN fibers at between 700 to 1300 degrees Celsius in an oxidizing atmosphere to form a silica surface layer on the plurality of silicon-based fibers, forming a plurality of pre-oxidized fibers; applying a rare earth orthophosphate (REPO4) coating to the plurality of pre-oxidized fibers; and heating the plurality of REPO4 coated pre-oxidized fibers at about 1000-1500 degrees Celsius in an inert atmosphere to react the REPO4 with the silica surface layer to form a rare earth silicate or disilicate. The pre-oxidizing step may be 0.5 hours to about 100 hours. The heating step may be about 5 minutes to about 100 hours.
FILED Monday, March 29, 2021
APPL NO 17/214994
CURRENT CPC
Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone
C04B 35/80 (20130101)
C04B 35/62675 (20130101)
C04B 35/62881 (20130101) Original (OR) Class
C04B 2235/5244 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340100 SHAPIRO et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
United States Army (USA)
U.S. Army Medical Research and Materiel Command (USAMRMC)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
APPLICANT(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
ASSIGNEE(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
INVENTOR(S) David J. SHAPIRO (Urbana, Illinois);  Paul J. HERGENROTHER (Champaign, Illinois);  Matthew W. BOUDREAU (Urbana, Illinois)
ABSTRACT A set of small molecules ERα biomodulators that kill therapy-resistant ERα positive breast, ovarian, and endometrial cancer cells. These small molecules have increased therapeutic potential because of an increased ability to kill therapy-resistant breast cancer cells compared to BHPI and other conventional therapies (endocrine therapies, tamoxifen and fulvestrant/ICI). The new compounds do not only inhibit proliferation of the cancer cells but actually kills them, which prevents reactivation of tumors years later.
FILED Thursday, May 13, 2021
APPL NO 17/319447
CURRENT CPC
Preparations for Medical, Dental, or Toilet Purposes
A61K 9/0019 (20130101)

Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations
A61P 35/00 (20180101)

Heterocyclic Compounds
C07D 209/34 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340199 Doudna et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
National Science Foundation (NSF)
APPLICANT(S) The Regents of the University of California (Oakland, California)
ASSIGNEE(S)
INVENTOR(S) Jennifer A. Doudna (Berkeley, California);  Kyle E. Watters (Moraga, California);  Haridha Shivram (Berkeley, California);  Christof Fellmann (Berkeley, California)
ABSTRACT The present disclosure provides AcrIIA7 polypeptides, nucleic acids encoding the AcrIIA7 polypeptides, and kits comprising the AcrIIA7 polypeptides and/or nucleic acids encoding the ACRIIA7 polypeptides. The present disclosure provides methods of inhibiting an activity of a Cas9 polypeptide.
FILED Monday, September 09, 2019
APPL NO 17/270691
CURRENT CPC
Peptides
C07K 14/4703 (20130101) Original (OR) Class
C07K 2319/09 (20130101)
C07K 2319/40 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/22 (20130101)
C12N 15/1137 (20130101)

Enzymes
C12Y 301/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340334 PORTELA et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Cancer Institute (NCI)
APPLICANT(S) California Institute of Technology (Pasadena, California)
ASSIGNEE(S)
INVENTOR(S) Carlos M. PORTELA (Pasadena, California);  Daryl Wei Liang YEE (Pasadena, California);  Dennis M. KOCHMANN (Pasadena, California);  Julia R. GREER (Pasadena, California)
ABSTRACT In an aspect, provided herein are low density materials, including shell-based materials, with three-dimensional architectures formed, in part, via self-assembly processes. Shell-based materials of some embodiments exhibit a combination of ultralow density (e.g., ≤100 mg cm−3 and optionally ≤10 100 mg cm−3) and non-periodic architectures characterized by low defect densities and geometries avoiding stress concentrations. Low density shell based materials of some embodiments have architectures characterized by small curvatures and lack of straight edges providing enhance mechanical response. In some embodiments, for example, the present low density materials, including shell-based materials, providing a combination target mechanical properties including high stiffness-to-density ratios, mechanical resilience and tolerance for deformation.
FILED Friday, September 25, 2020
APPL NO 17/032539
CURRENT CPC
Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 40/00 (20130101)

Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H
C08J 3/02 (20130101) Original (OR) Class
C08J 9/26 (20130101)

Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General
C23C 16/403 (20130101)
C23C 16/45525 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340415 Tran et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Laboratory (ARL)
APPLICANT(S) U.S. Army Research Laboratory (Adelphi, Maryland)
ASSIGNEE(S)
INVENTOR(S) Ngon T. Tran (Aberdeen, Maryland);  Matthew A. Bartucci (Baltimore, Maryland);  Joshua A. Orlicki (Havre de Grace, Maryland);  Daniel B. Knorr, JR. (Oxford, Pennsylvania);  Joseph L. Lenhart (Port Deposit, Maryland)
ABSTRACT Disclosed is a method for improving interfacial adhesion of an adhesive to unprimed substrates and an improved adhesive composition, involving admixing an adhesive with an adhesive modifier, where the modifier is at least partially soluble in the at least one adhesive and includes either a non-aromatic polyol or a molecule having at least one ortho-hydroxyl substitution on a benzene ring.
FILED Friday, July 16, 2021
APPL NO 17/378336
CURRENT CPC
Adhesives; Non-mechanical Aspects of Adhesive Processes in General; Adhesive Processes Not Provided for Elsewhere; Use of Materials as Adhesives
C09J 133/04 (20130101)
C09J 163/00 (20130101)
C09J 175/02 (20130101)
C09J 175/04 (20130101) Original (OR) Class
C09J 175/16 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340486 Andrews et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Office (ARO)
Non-Profit Organization (NPO)
Advanced Regenerative Manufacturing Institute (ARMI)
APPLICANT(S) DEKA Products Limited Partnership (Manchester, New Hampshire)
ASSIGNEE(S)
INVENTOR(S) Richard E. Andrews (Manchester, New Hampshire);  Dave D.B. Cannan (Manchester, New Hampshire);  Alekhya Akkapeddi (Manchester, New Hampshire);  Andrew G. Remec (Manchester, New Hampshire);  Bryan A. Finseth (Newbury, New Hampshire);  Kevin Kim (Hookset, New Hampshire)
ABSTRACT System and method for providing biocompatible, nutrient filled media to the Human Cells, Tissues, and cellular and tissue-based Products (HCT/P) while removing wastes. The present teachings provide for sensing the characteristics of the media, and modifying the characteristics when necessary. The present teachings can also provide components that can provide fluid pumping integrated with fluid gas exchange, and sensing of fluid characteristics at consistent times during the fluid flow cycle. System and method control multiple bioreactors from a centralized media reservoir, while fluidically isolating the bioreactors from cross-contamination.
FILED Wednesday, April 28, 2021
APPL NO 17/243324
CURRENT CPC
Apparatus for Enzymology or Microbiology;
C12M 23/28 (20130101)
C12M 23/42 (20130101)
C12M 23/44 (20130101)
C12M 27/18 (20130101)
C12M 29/00 (20130101)
C12M 29/20 (20130101)
C12M 41/12 (20130101)
C12M 41/16 (20130101)
C12M 41/32 (20130101)
C12M 41/34 (20130101)
C12M 41/48 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340488 RAO et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Navy (DON)
APPLICANT(S) University of Maryland, Baltimore County (Baltimore, Maryland)
ASSIGNEE(S)
INVENTOR(S) Govind RAO (Ellicott city, Maryland);  Yordan KOSTOV (Columbia, Maryland);  Leah TOLOSA (Columbia, Maryland);  Xudong GE (Woodstock, Maryland);  Douglas Frey (Ellicott City, Maryland)
ABSTRACT A portable and mobile bioprocessing system and method for protein manufacturing that is compact, integrated and suited for on-demand production of any type of proteins and for delivery of the produced proteins to patients or for assay purposes. The portable system and method can also be used for efficient on-demand production of any type of protein with point-of-care delivery.
FILED Thursday, July 15, 2021
APPL NO 17/376439
CURRENT CPC
Apparatus for Enzymology or Microbiology;
C12M 41/12 (20130101)
C12M 47/10 (20130101) Original (OR) Class
C12M 47/12 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340519 KING et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Army (DOA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
National Institute of General Medical Sciences (NIGMS)
APPLICANT(S) UNIVERSITY OF WASHINGTON (Seattle, Washington);  UNIVERSITY OF UTAH (Salt Lake City, Utah)
ASSIGNEE(S)
INVENTOR(S) Neil KING (Seattle, Washington);  Wesley SUNDQUIST (Salt Lake City, Utah);  Joerg VOTTELER (Salt Lake City, Utah);  Yang HSIA (Seattle, Washington);  David BAKER (Seattle, Washington);  Jacob BALE (Seattle, Washington);  Marc LAJOIE (Seattle, Washington);  Gabriel BUTTERFIELD (Seattle, Washington);  Elizabeth GRAY (Seattle, Washington);  Daniel STETSON (Seattle, Washington)
ABSTRACT The application discloses multimeric assemblies including multiple oligomeric substructures, where each oligomeric substructure includes multiple proteins that self-interact around at least one axis of rotational symmetry, where each protein includes one or more polypeptide-polypeptide interface (“O interface”); and one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding to one or more proteins in the eukaryotic ESCRT complex (“L domain”); and where the multimeric assembly includes one or more subunits comprising one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), as well as membrane-enveloped versions of the multimeric assemblies.
FILED Wednesday, June 02, 2021
APPL NO 17/336889
CURRENT CPC
Peptides
C07K 14/00 (20130101)
C07K 14/435 (20130101)
C07K 2319/03 (20130101)
C07K 2319/06 (20130101)
C07K 2319/735 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 9/88 (20130101) Original (OR) Class

Enzymes
C12Y 401/02014 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340541 SHARP et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army
U.S. Army Medical Research and Development Command (USAMRDC)
U.S. Army Medical Research and Materiel Command (USAMRMC)
Telemedicine and Advanced Technology Research Center (TATRC)
APPLICANT(S) ALBERT EINSTEIN COLLEGE OF MEDICINE (BRONX, New York)
ASSIGNEE(S) ALBERT EINSTEIN COLLEGE OF MEDICINE (BRONX, New York)
INVENTOR(S) David SHARP (Scarsdale, New York);  Brian O'ROURKE (Rockville Centre, New York)
ABSTRACT Methods and compositions are provided for inhibiting or treating metastasis based on discoveries regarding Kif19 and Cep192. Methods and compositions are provided for enhancing wound healing, treating fibrosis, reducing scarring and treating nerve pain.
FILED Thursday, July 15, 2021
APPL NO 17/377351
CURRENT CPC
Peptides
C07K 14/4738 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 15/113 (20130101) Original (OR) Class
C12N 2310/14 (20130101)

Enzymes
C12Y 306/04004 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340580 Zu et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Laboratory (ARL)
APPLICANT(S) U.S. Army DEVCOM Army Research Laboratory (Adelphi, Maryland)
ASSIGNEE(S)
INVENTOR(S) Theresah N. K. Zu (Elkridge, Maryland);  Christian J. Sund (Bethesda, Maryland);  Sanchao Liu (Ellicott City, Maryland);  Elliot S. Gerlach (Silver Spring, Maryland)
ABSTRACT A method of producing chemicals includes providing fermentative cells; co-feeding any of galacturonate and galacturonate polymers with carbohydrates to the fermentative cells; and producing a chemical from the fermentative cells. The fermentative cells may include any of Clostridium acetobutylicum and Clostridium saccharoperbutylacetonicum. The carbohydrates may include any of glucose, mannose, galactose, fructose, arabinose, xylose, sucrose, lactose, maltose, cellobiose, and starch. The method may include providing a substantially equal proportion of the any of galacturonate and galacturonate polymers and the carbohydrates for co-feeding to the fermentative cells. The method may include altering a proportion of the any of galacturonate and galacturonate polymers to the carbohydrates. The method may include modulating a production of the chemical by altering the proportion of the any of galacturonate and galacturonate polymers to the carbohydrates. The chemical may include any of acetate and butyrate.
FILED Thursday, July 15, 2021
APPL NO 17/376613
CURRENT CPC
Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 1/20 (20130101)

Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture
C12P 7/52 (20130101)
C12P 7/54 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340692 Mirkin et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Office of Scientific Research (AFOSR)
Asian Office of Aerospace Research and Development (AOARD)
Department of Energy (DOE)
Office of Science (DOEOS)
APPLICANT(S) NORTHWESTERN UNIVERSITY (Evanston, Illinois)
ASSIGNEE(S)
INVENTOR(S) Chad A. Mirkin (Wilmette, Illinois);  Taegon Oh (Evanston, Illinois);  Sarah S. Park (Evanston, Illinois)
ABSTRACT A post-synthetic method for stabilizing colloidal crystals programmed from nucleic acid is disclosed herein. In some embodiments, the method relies on Ag+ ions to stabilize the particle-connecting nucleic acid duplexes within the crystal lattice, essentially transforming them from loosely bound structures to ones with very strong interparticle links. In some embodiments, the nucleic acid is DNA. Such crystals do not dissociate as a function of temperature like normal DNA or DNA-interconnected colloidal crystals, and they can be moved from water to organic media or the solid state, and stay intact. The Ag+-stabilization of the nucleic acid (e.g., DNA) bonds is accompanied by a nondestructive contraction of the lattice, and both the stabilization and contraction are reversible with the chemical extraction of the Ag+ ions, e.g., by AgCl precipitation with NaCl.
FILED Wednesday, September 25, 2019
APPL NO 17/272139
CURRENT CPC
Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor
C30B 7/08 (20130101)
C30B 29/02 (20130101) Original (OR) Class
C30B 29/58 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340752 Peterson
FUNDED BY
Department of Defense (DOD)
Air Force Civil Engineer Center (AFCEC)
Department of the Air Force (DAF)
APPLICANT(S) Folding Holdings, LLC (Bothell, Washington)
ASSIGNEE(S)
INVENTOR(S) Elliot Peterson (Bothell, Washington)
ABSTRACT A built-up beam includes a pair of I-beams each having opposing flanges, a web that extends between the opposing flanges, a plurality of flange openings in each of the opposing flanges, a plurality of web openings in the web, and a plurality of bolt holes in one of the opposing flanges. The I-beams are stacked together flange-to-flange in a stacked beam configuration and a plurality of bolts extend through the plurality of bolt holes and secure the pair of I-beams together in the stacked beam configuration.
FILED Wednesday, April 29, 2020
APPL NO 16/862411
CURRENT CPC
General Building Constructions; Walls, e.g Partitions; Roofs; Floors; Ceilings; Insulation or Other Protection of Buildings
E04B 1/19 (20130101) Original (OR) Class

Structural Elements; Building Materials
E04C 3/04 (20130101)
E04C 3/14 (20130101)
E04C 2003/0413 (20130101)
E04C 2003/0452 (20130101)
E04C 2003/0465 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340933 Garcia et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
APPLICANT(S) Northrop Grumman Systems Corporation (Falls Church, Virginia)
ASSIGNEE(S)
INVENTOR(S) Benjamin W.C. Garcia (Tremonton, Utah);  Brian Christensen (Willard, Utah);  David R. Nelson (Logan, Utah);  Braden Day (Nibley, Utah)
ABSTRACT A hybrid metal composite (HMC) structure comprises a first tier comprising a first fiber composite material structure, a second tier longitudinally adjacent the first tier and comprising a first metallic structure and a second fiber composite material structure laterally adjacent the first metallic structure, a third tier longitudinally adjacent the second tier and comprising a third fiber composite material structure, and a fourth tier longitudinally adjacent the third tier and comprising a second metallic structure and a fourth fiber composite material structure laterally adjacent the second metallic structure. At least one lateral end of the second metallic structure is laterally offset from at least one lateral end of the first metallic structure most proximate thereto. Methods of forming an HMC structure, and related rocket motors and multi-stage rocket motor assemblies are also disclosed.
FILED Tuesday, May 25, 2021
APPL NO 17/330040
CURRENT CPC
Cosmonautics; Vehicles or Equipment Therefor
B64G 1/403 (20130101)

Jet-propulsion Plants
F02K 9/34 (20130101) Original (OR) Class
F02K 9/97 (20130101)

Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants
F05D 2300/6032 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340989 Miller et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
United States Air Force (USAF)
APPLICANT(S) Aerojet Rocketdyne, Inc. (Sacramento, California)
ASSIGNEE(S)
INVENTOR(S) Jeff Miller (Simi Valley, California);  Steven Grota (Sacramento, California)
ABSTRACT A pump includes a shaft that is rotatable about a central axis. An inducer is mounted on the shaft and has an inducer blade and inducer shroud attached at an outer end of the inducer blade. An impeller is mounted on the shaft downstream of the inducer and has an impeller blade and an impeller shroud attached at an outer end of the impeller blade. There is an axially-elongated annular seal element disposed at an axial end of the inducer shroud that provides sealing between the inducer shroud and the impeller shroud.
FILED Friday, October 19, 2018
APPL NO 17/282395
CURRENT CPC
Non-positive-displacement Pumps
F04D 29/22 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341261 Klann et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Secretary of the Army (SECARMY)
APPLICANT(S) Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia)
ASSIGNEE(S) Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia)
INVENTOR(S) Shawn C. Klann (Warren, Michigan);  Frederick C. Rickert, II (Royal Oak, Michigan);  David B. Witherspoon (Port Huron, Michigan);  William T. Hoffman (Howell, Michigan)
ABSTRACT An explosive reactive armor (ERA) enclosure for an ERA tile includes a bottom and a plurality of sidewalls extending from the bottom, where the plurality of sidewalls are continuous with each other and with the bottom so as to define an internal volume. The plurality of sidewalls are formed from a fiber-reinforced composite material having a plurality of plies of fiber sheet material. Additionally, a sidewall seam defined by abutting edges of the first ply is offset from a sidewall seam defined by abutting edges of the second ply. Methods of manufacturing ERA enclosures, including applying wrap layers and forming attachment structures for securing the fiber-reinforced composite ERA enclosure to an armor element, are also described. The composite enclosure is inexpensive and lightweight and improves the dynamic capabilities of armored vehicles using such ERA tiles.
FILED Thursday, July 15, 2021
APPL NO 17/376563
CURRENT CPC
Armour; Armoured Turrets; Armoured or Armed Vehicles; Means of Attack or Defence, e.g Camouflage, in General
F41H 5/007 (20130101) Original (OR) Class
F41H 5/013 (20130101)
F41H 7/04 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341264 Starr
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army Contracting Command (ACC)
U.S. Army
APPLICANT(S) SensorMetrix (San Diego, California)
ASSIGNEE(S)
INVENTOR(S) Anthony F. Starr (San Diego, California)
ABSTRACT A ballistic detection system includes one or more light sources configured to transmit collimated light through a detection area; a receiver array arranged with respect to the detection area to receive the collimated light in multiple side-by-side channels, the receiver array including (i) light detectors corresponding to the multiple side-by-side channels, and (ii) lenses arranged to focus respective portions of the collimated light, which has transited the detection area, onto respective ones of the light detectors corresponding to the multiple side-by-side channels; and a ballistics analysis computer coupled with the receiver array and programmed to identify a location of a projectile that passes through the detection area by performing ratiometric comparison of signal data from the light detectors, the signal data corresponding to fractional blockage, by the projectile, of the collimated light in one or more of the multiple side-by-side channels.
FILED Friday, February 05, 2021
APPL NO 17/168907
CURRENT CPC
Targets; Target Ranges; Bullet Catchers
F41J 5/02 (20130101) Original (OR) Class
F41J 5/08 (20130101)

Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags
G01V 8/22 (20130101)

Optical Elements, Systems, or Apparatus
G02B 3/0037 (20130101)
G02B 5/12 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341320 Williams et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Secretary of the Air Force (SECAF)
APPLICANT(S) US Gov't as represented by Secretary of Air Force (Wright-Patterson AFB, Ohio)
ASSIGNEE(S)
INVENTOR(S) Jeremiah Williams (Dayton, Ohio);  Hengky Chandraalim (Beavercreek, Ohio)
ABSTRACT A passive microscopic flow sensor includes a three-dimensional microscopic optical structure formed on a cleaved tip of an optical fiber. The three-dimensional microscopic optical structure includes a post attached off-center to and extending longitudinally from the cleaved tip of the optical fiber. A rotor of the three-dimensional microscopic optical structure is received for rotation on the post. The rotor has more than one blade. Each blade has a reflective undersurface that reflects a light signal back through the optical fiber when center aligned with the optical fiber, the blades of the rotor shaped to rotate at a rate related to a flow rate.
FILED Friday, April 30, 2021
APPL NO 17/245645
CURRENT CPC
Measuring Volume, Volume Flow, Mass Flow or Liquid Level; Metering by Volume
G01F 1/103 (20130101) Original (OR) Class
G01F 1/115 (20130101)

Measuring Force, Stress, Torque, Work, Mechanical Power, Mechanical Efficiency, or Fluid Pressure
G01L 11/025 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341376 Di Carlo et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Space and Naval Warfare Systems (SPAWAR)
National Science Foundation (NSF)
APPLICANT(S) THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California)
ASSIGNEE(S) THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California)
INVENTOR(S) Dino Di Carlo (Los Angeles, California);  Daniel R. Gossett (Los Angeles, California);  Henry T.K. Tse (San Francisco, California);  Aram Chung (Los Angeles, California)
ABSTRACT A system for deforming and analyzing a plurality of particles carried in a sample volume includes a substrate defining an inlet, configured to receive the sample volume, and an outlet; and a fluidic pathway fluidly coupled to the inlet and the outlet. The fluidic pathway includes a delivery region configured to receive the plurality of particles from the inlet and focus the plurality of particles from a random distribution to a focused state, a deformation region defining an intersection located downstream of the delivery region and coupled to the outlet, and wherein the deformation region is configured to receive the plurality of particles from the delivery region and to transmit each particle in the plurality of particles into the intersection from a single direction, a first branch fluidly coupled to the deformation region and configured to transmit a first flow into the intersection, and a second branch fluidly coupled to the deformation region and configured to transmit a second flow, substantially opposing the first flow, into the intersection, wherein the first flow and the second flow are configured to induce extension of one or more particles in the plurality of particles.
FILED Friday, March 12, 2021
APPL NO 17/200728
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 15/147 (20130101) Original (OR) Class
G01N 15/1404 (20130101)
G01N 15/1434 (20130101)
G01N 15/1436 (20130101)
G01N 15/1459 (20130101)
G01N 15/1484 (20130101)
G01N 21/645 (20130101)
G01N 21/6428 (20130101)
G01N 33/50 (20130101)
G01N 33/5091 (20130101)
G01N 2015/0065 (20130101)

Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/4604 (20130101)

Image Data Processing or Generation, in General
G06T 7/0004 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341403 Shepard et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Naval Air Systems Command (NAVAIR)
APPLICANT(S) Thermal Wave Imaging, Inc. (Madison Heights, Michigan)
ASSIGNEE(S) Thermal Wave Imaging, Inc. (Madison Heights, Michigan)
INVENTOR(S) Steven M. Shepard (Southfield, Michigan);  Maria Frendberg Beemer (Clarkston, Michigan)
ABSTRACT A method for performing non-destructive testing using active thermography includes applying, using at least one thermal excitation device, a first excitation pulse to a workpiece; capturing, using an imaging device, a first iso-time frame of the workpiece; and determining a second excitation pulse by modifying one or more of a duration D of the first excitation pulse, an amplitude A of the first excitation pulse, or a spacing W between the first excitation pulse and the second excitation pulse. The method also includes applying, using the at least one of the thermal excitation device, the second excitation pulse to the workpiece; capturing, using the imaging device, a second iso-time frame of the workpiece; and determining a numerical fit of the first iso-time frame and the second iso-time frame.
FILED Tuesday, April 27, 2021
APPL NO 17/242000
CURRENT CPC
Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry
G01J 5/10 (20130101)
G01J 2005/0081 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 25/72 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341404 Gupta et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of the Navy (DON)
APPLICANT(S) The Board of Trustees of the Leland Stanford Junior University (Stanford, California)
ASSIGNEE(S)
INVENTOR(S) Chaitanya Gupta (San Carlos, California);  Ross M. Walker (Salt Lake City, Utah);  Boris Murmann (Stanford, California);  Roger T. Howe (Stanford, California)
ABSTRACT A high-gain and low-noise negative feedback control (“feedback control”) system can detect charge transfer in quantum systems at room temperatures. The feedback control system can attenuate dissipative coupling between a quantum system and its thermodynamic environment. The feedback control system can be integrated with standard commercial voltage-impedance measurement system, for example, a potentiostat. In one aspect, the feedback control system includes a plurality of electrodes that are configured to electrically couple to a sample, and a feedback mechanism coupled to a first electrode of the plurality of electrodes. The feedback mechanism is configured to detect a potential associated with the sample via the first electrode. The feedback mechanism provides a feedback signal to the sample via a second electrode of the plurality of electrodes, the feedback signal is configured to provide excitation control of the sample at a third electrode of the plurality of electrode.
FILED Tuesday, May 11, 2021
APPL NO 17/317422
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 27/028 (20130101) Original (OR) Class
G01N 27/49 (20130101)
G01N 27/416 (20130101)
G01N 27/3273 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341459 Alden et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Office of Scientific Research (AFOSR)
Department of the Navy (DON)
Office of Naval Research (ONR)
APPLICANT(S) Cornell University (Ithaca, New York)
ASSIGNEE(S)
INVENTOR(S) Jonathan Alden (Ithaca, New York);  Alejandro Cortese (Ithaca, New York);  Arthur Barnard (Hayward, California);  Paul McEuen (Newfield, New York)
ABSTRACT A nanopore-containing substrate includes a substrate, a membrane on the substrate, and at least one nanoscale electronic element disposed on or embedded in the membrane. The membrane defines at least one nanopore. The nanoscale electronic element is aligned with one of the nanopores such that a shortest distance between an edge of the nanoscale electronic element and the edge of the nanopore is less than 50 nm. The nanopores may be formed by etching through a dielectric layer using a solution while applying a voltage to the nanoscale electronic element relative to the solution. The nanopore-containing substrate can be used to detect or sequence a biopolymer, such as a nucleic acid. The nanopore-containing substrate may be used with a biopolymer detection and/or sequencing system.
FILED Monday, May 17, 2021
APPL NO 17/322168
CURRENT CPC
Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes
C12Q 1/6869 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 27/4145 (20130101)
G01N 27/4146 (20130101)
G01N 27/44791 (20130101)
G01N 33/48721 (20130101) Original (OR) Class
G01N 33/54366 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341474 Raphael et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Secretary of the Navy (SECNAV)
APPLICANT(S) The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia)
ASSIGNEE(S)
INVENTOR(S) Marc P. Raphael (Washington, District of Columbia);  Joseph A. Christodoulides (Alexandria, Virginia);  Jeff M. Byers (Fairfax Station, Virginia)
ABSTRACT A method for the spatiotemporal mapping of receptor-ligand binding kinetics in localized surface plasmon resonance (LSPR) imaging using a chip for LSPR imaging having a glass coverslip compatible for use in a standard microscope and at least one array of functionalized plasmonic nanostructures patterned onto the glass coverslip with electron beam nanolithography and projecting a magnified image of the array to a CCD camera and monitoring the binding kinetics of the array. The nanostructures can be regenerated allowing the chip to be used multiple times.
FILED Saturday, July 17, 2021
APPL NO 17/378671
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 21/554 (20130101)
G01N 33/557 (20130101) Original (OR) Class
G01N 33/54346 (20130101)
G01N 33/54373 (20130101)
G01N 33/54386 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341489 ULRICH et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Secretary of the Army (SECARMY)
Defense Threat Reduction Agency (DTRA)
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Allergy and Infectious Diseases (NIAID)
APPLICANT(S) THE GOVERNMENT OF THE UNITED STATES, AS REPRESENTED BY THE SECRETARY OF THE ARMY (Fort Detrick, Maryland)
ASSIGNEE(S)
INVENTOR(S) Robert G. ULRICH (Frederick, Maryland);  Teddy KAMATA (Frederick, Maryland)
ABSTRACT The disclosure relates to compositions, assays, methods and kits comprising one or more amino acid sequences of a filovirus protein, or a fragment thereof, which find use in the detection of a filovirus infection and/or the presence of antibodies specific for a filovirus in a biological sample.
FILED Wednesday, June 03, 2015
APPL NO 15/316020
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 33/6854 (20130101) Original (OR) Class
G01N 2333/08 (20130101)
G01N 2469/20 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341596 Kendra
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
APPLICANT(S) Leidos, Inc. (Reston, Virginia)
ASSIGNEE(S) Leidos, Inc. (Reston, Virginia)
INVENTOR(S) John R. Kendra (Arlington, Virginia)
ABSTRACT A process and systems for constructing arbitrarily large virtual arrays using two or more collection platforms (e.g. AUX and MOV systems) having differing velocity vectors. Referred to as Motion Extended Array Synthesis (MXAS), the resultant imaging system is comprised of the collection of baselines that are created between the two collection systems as a function of time. Because of the unequal velocity vectors, the process yields a continuum of baselines over some range, which constitutes an offset imaging system (OIS) in that the baselines engendered are similar to those for a real aperture of the same size as that swept out by the relative motion, but which are offset by some (potentially very large) distance.
FILED Wednesday, September 30, 2020
APPL NO 17/039602
CURRENT CPC
Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves
G01S 13/46 (20130101)
G01S 13/589 (20130101)
G01S 13/904 (20190501)
G01S 13/9023 (20130101) Original (OR) Class
G01S 2013/0254 (20130101)
G01S 2013/468 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341675 Su et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Materiel Command (AFMC)
Air Force Research Laboratory (AFRL)
Defense Advanced Research Projects Agency (DARPA)
APPLICANT(S) Analog Photonics LLC (Boston, Massachusetts)
ASSIGNEE(S) Analog Photonics LLC (Boston, Massachusetts)
INVENTOR(S) Zhan Su (Boston, Massachusetts);  Erman Timurdogan (Somerville, Massachusetts);  Michael Robert Watts (Hingham, Massachusetts)
ABSTRACT A polarization rotator structure includes: a first core structure formed at a first layer, extending from the first end to a second end, and a second core structure formed at a second layer that is at a different depth than the first layer and formed in proximity to the first core structure. The first core structure and the second core structure provide mode hybridization between at least two orthogonally polarized waveguide modes of the PRS. An optical splitter structure is optically coupled at a first end to the second end of the PRS, and optically coupled at a second end to at least two optical waveguides, and includes: a first core structure that is contiguous with at least one of the first or second core structures of the PRS, and a second core structure that is separate from both of the first and second core structures of the PRS.
FILED Friday, April 30, 2021
APPL NO 17/245385
CURRENT CPC
Optical Elements, Systems, or Apparatus
G02B 6/14 (20130101)
G02B 6/126 (20130101)
G02B 6/2726 (20130101)
G02B 6/2766 (20130101) Original (OR) Class
G02B 6/2773 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341814 SAFAVI-NAEINI et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
National Science Foundation (NSF)
APPLICANT(S) The Board of Trustees of the Leland Stanford Junior University (Stanford, California)
ASSIGNEE(S)
INVENTOR(S) Amir-Hossein SAFAVI-NAEINI (Palo Alto, California);  Christopher John SARABALIS (Menlo Park, California);  Jeremy David WITMER (Palo Alto, California);  Patricio ARRANGOIZ ARRIOLA (San Francisco, California);  Raphael Frank J VAN LAER (Menlo Park, California)
ABSTRACT Systems and methods for steering an optical beam in two dimensions are disclosed. The system includes a substrate comprising an acousto-optic antenna array and an acoustic transducer. Each antenna of the antenna array includes a high-confinement surface waveguide carrying a light signal. The acoustic transducer imparts acoustic energy into each surface waveguide as a mechanical wave. Interaction of the light signal and mechanical wave in each surface waveguide induces light to scatter into free space. The light scattered out of the plurality of waveguides collectively defines the output beam. The longitudinal angle of output beam, relative to the substrate, is determined by the relative frequencies of the mechanical waves and the light signals. The transverse angle of the output beam is controlled by controlling the relative phases of the mechanical waves and/or light signals across the surface-waveguide array.
FILED Monday, May 10, 2021
APPL NO 17/315876
CURRENT CPC
Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters
G02F 1/335 (20130101) Original (OR) Class
G02F 1/2955 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341833 Sreenivasan et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Materiel Command (AFMC)
Air Force Office of Scientific Research (AFOSR)
Air Force Research Laboratory (AFRL)
National Science Foundation (NSF)
Directorate for Engineering (ENG)
Division of Electrical, Communications and Cyber Systems (ECCS)
APPLICANT(S) Board of Regents, The University of Texas System (Austin, Texas)
ASSIGNEE(S)
INVENTOR(S) Sidlgata V. Sreenivasan (Austin, Texas);  Shrawan Singhal (Austin, Texas);  Ovadia Abed (Austin, Texas);  Lawrence Dunn (Austin, Texas);  Paras Ajay (Austin, Texas);  Ofodike Ezekoye (Austin, Texas)
ABSTRACT A method for fabricating patterns on a flexible substrate in a roll-to-roll configuration. Drops of a monomer diluted in a solvent are dispensed on a substrate, where the drops spontaneously spread and merge with one another to form a liquid resist formulation. The solvent is evaporated (e.g., blanket evaporation) from the liquid resist formulation followed by selective multi-component resist film evaporation resulting in a non-uniform and substantially continuous film on the substrate. The gap between the film on the substrate and a template is closed such that the film fills the features of the template. After cross-linking the film to polymerize the film, the template is separated from the substrate thereby leaving the polymerized film on the substrate.
FILED Thursday, August 03, 2017
APPL NO 16/322842
CURRENT CPC
Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor;
G03F 7/0002 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342443 PRVULOVIC et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
National Science Foundation (NSF)
APPLICANT(S) GEORGIA TECH RESEARCH CORPORATION (Atlanta, Georgia)
ASSIGNEE(S)
INVENTOR(S) Milos PRVULOVIC (Atlanta, Georgia);  Chia-Lin CHENG (Atlanta, Georgia);  Luong N. NGUYEN (Atlanta, Georgia);  Alenka ZAJIC (Atlanta, Georgia)
ABSTRACT A system for detecting hardware Trojans in a computerized device includes a digital circuit having switching components operating pursuant to at least one clock frequency and positioned within an interrogation range of an incident carrier wave. A modulated backscatter response is reflected from the digital circuit upon arrival of the incident carrier wave in the presence of the switching operations. A detection device is positioned to receive the modulated backscatter response. A computer connected to the detection device identifies harmonics of a respective clock frequency of the digital circuit from the backscatter response and identifies characteristics of the harmonics indicating a presence or an absence of a hardware Trojan connected to the digital circuit.
FILED Thursday, January 16, 2020
APPL NO 16/973512
CURRENT CPC
Electric Digital Data Processing
G06F 21/44 (20130101)
G06F 21/76 (20130101)
G06F 21/554 (20130101) Original (OR) Class
G06F 21/556 (20130101)
G06F 21/566 (20130101)
G06F 30/398 (20200101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342546 Beigi et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Office (ARO)
Department of the Navy (DON)
Office of Naval Research (ONR)
National Science Foundation (NSF)
APPLICANT(S) Ghazaleh Beigi (Tempe, Arizona);  Kai Shu (Mesa, Arizona);  Ruocheng Guo (Sichuan, China PRC);  Suhang Wang (Mesa, Arizona);  Huan Liu (Tempe, Arizona)
ASSIGNEE(S) Arizona Board of Regents on Behalf of Arizona State University (Tempe, Arizona)
INVENTOR(S) Ghazaleh Beigi (Tempe, Arizona);  Kai Shu (Mesa, Arizona);  Ruocheng Guo (Sichuan, China PRC);  Suhang Wang (Mesa, Arizona);  Huan Liu (Tempe, Arizona)
ABSTRACT Various embodiments of a computer-implemented system which learns textual representations while filtering out potentially personally identifying data and retaining semantic meaning within the textual representations are disclosed herein.
FILED Friday, April 30, 2021
APPL NO 17/245774
CURRENT CPC
Electric Digital Data Processing
G06F 21/6245 (20130101)
G06F 40/30 (20200101) Original (OR) Class
G06F 40/211 (20200101)

Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/6235 (20130101)
G06K 2009/6237 (20130101)

Computer Systems Based on Specific Computational Models
G06N 3/08 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342578 Pezzaniti et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Laboratory (ARL)
U.S. Army
APPLICANT(S) Polaris Sensor Technologies, Inc. (Huntsville, Alabama)
ASSIGNEE(S)
INVENTOR(S) J. Larry Pezzaniti (Huntsville, Alabama);  David B. Chenault (Huntsville, Alabama)
ABSTRACT A method for enhancing an image for facial recognition comprises capturing an image of the face with a polarizer and correcting the polarized image for non-uniformity. Stokes Parameters S0, S1, S2 are obtained by weighted subtraction of the polarized image to form Stokes images. DoLP is computed from the Stokes images, and facial recognition algorithms are applied to the DoLP image. A system for enhancing images for facial recognition comprises a polarimeter configured to record polarized image data of a subject's face, a signal processing unit and logic configured to receive and store in memory the image data from the polarimeter, calculate Stokes parameters from the image data, and compute a DoLP image from the Stokes parameters.
FILED Monday, July 19, 2021
APPL NO 17/379527
CURRENT CPC
Optical Elements, Systems, or Apparatus
G02B 5/201 (20130101)
G02B 27/00 (20130101)
G02B 27/288 (20130101)

Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/209 (20130101)
G06K 9/00255 (20130101)
G06K 9/00275 (20130101)
G06K 9/00288 (20130101) Original (OR) Class
G06K 9/4661 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342652 Glassman
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
United States Army (USA)
APPLICANT(S) BAE Systems Information and Electronics Systems Integration Inc. (Nashua, New Hampshire)
ASSIGNEE(S) BAE Systems Information and Electronic Systems Integration Inc. (Nashua, New Hampshire)
INVENTOR(S) Martin S. Glassman (Nashua, New Hampshire)
ABSTRACT A classifier network has at least two distinct sets of refined data, wherein the first two sets of refined data are sets of numbers representing the features values data received from sensors or a manufactured part. Performing, via at least two distinct types of support vector machines using an associated feature selection process for each classifier independently in a first layer, anomaly detection on the manufactured part. Then, using the stored data including refined data of at least two different types of data transforms and performing, via at least a two distinct types of support vector machines in a second layer, an associated feature selection process for each classifier independently. Forming at least four distinct compound classifier types for anomaly detection on the part using the stored data or coefficients. The ensemble of second layer support vector machine outputs compare the results to determine the presence of an anomaly.
FILED Thursday, April 30, 2020
APPL NO 16/862867
CURRENT CPC
Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/6228 (20130101)
G06K 9/6232 (20130101)
G06K 9/6262 (20130101)
G06K 9/6269 (20130101) Original (OR) Class
G06K 9/6289 (20130101)

Computer Systems Based on Specific Computational Models
G06N 20/10 (20190101)
G06N 20/20 (20190101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342656 MITTAL et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Office (ARO)
APPLICANT(S) UNIVERSITY OF MARYLAND, COLLEGE PARK (College Park, Maryland)
ASSIGNEE(S)
INVENTOR(S) Trisha MITTAL (College Park, Maryland);  Aniket BERA (Greenbelt, Maryland);  Uttaran BHATTACHARYA (College Park, Maryland);  Rohan CHANDRA (College Park, Maryland);  Dinesh MANOCHA (Chapel Hill, North Carolina)
ABSTRACT Systems, methods, apparatuses, and computer program products for providing multimodal emotion recognition. The method may include receiving raw input from an input source. The method may also include extracting one or more feature vectors from the raw input. The method may further include determining an effectiveness of the one or more feature vectors. Further, the method may include performing, based on the determination, multiplicative fusion processing on the one or more feature vectors. The method may also include predicting, based on results of the multiplicative fusion processing, one or more emotions of the input source.
FILED Wednesday, February 10, 2021
APPL NO 17/173018
CURRENT CPC
Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/623 (20130101)
G06K 9/6232 (20130101)
G06K 9/6288 (20130101) Original (OR) Class

Speech Analysis or Synthesis; Speech Recognition; Speech or Voice Processing; Speech or Audio Coding or Decoding
G10L 21/10 (20130101)
G10L 25/63 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342667 OLSON et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
APPLICANT(S) THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan)
ASSIGNEE(S)
INVENTOR(S) Edwin OLSON (Ann Arbor, Michigan);  Dhanvin H. MEHTA (Ann Arbor, Michigan);  Gonzalo FERRER (Ann Arbor, Michigan)
ABSTRACT In Multi-Policy Decision-Making (MPDM), many computationally-expensive forward simulations are performed in order to predict the performance of a set of candidate policies. In risk-aware formulations of MPDM, only the worst outcomes affect the decision making process, and efficiently finding these influential outcomes becomes the core challenge. Recently, stochastic gradient optimization algorithms, using a heuristic function, were shown to be significantly superior to random sampling. In this disclosure, it was shown that accurate gradients can be computed-even through a complex forward simulation—using approaches similar to those in dep networks. The proposed approach finds influential outcomes more reliably, and is faster than earlier methods, allowing one to evaluate more policies while simultaneously eliminating the need to design an easily-differentiable heuristic function.
FILED Friday, July 09, 2021
APPL NO 17/371221
CURRENT CPC
Computer Systems Based on Specific Computational Models
G06N 3/02 (20130101) Original (OR) Class
G06N 3/008 (20130101)
G06N 3/084 (20130101)
G06N 7/005 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342749 Wang et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Office (ARO)
APPLICANT(S) International Business Machines Corporation (Armonk, New York)
ASSIGNEE(S)
INVENTOR(S) Shiqiang Wang (White Plains, New York);  Tiffany Tuor (London, United Kingdom);  Changchang Liu (White Plains, New York);  Thai Franck Le (White Plains, New York)
ABSTRACT Techniques for adaptive asynchronous federated learning are described herein. An aspect includes providing a first version of a global parameter to a first client and a second client. Another aspect includes receiving, from the first client, a first gradient, wherein the first gradient was computed by the first client based on the first version of the global parameter and a respective first local dataset of the first client. Another aspect includes determining whether the first version of the global parameter matches a most recent version of the global parameter. Another aspect includes, based on determining that the first version of the global parameter does not match the most recent version of the global parameter, selecting a version of the global parameter. Another aspect includes aggregating the first gradient with the selected version of the global parameter to determine an updated version of the global parameter.
FILED Wednesday, April 29, 2020
APPL NO 16/861284
CURRENT CPC
Computer Systems Based on Specific Computational Models
G06N 20/20 (20190101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343186 LAMPOTANG et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army
Army Medical Research Acquisition Activity (USAMRAA)
U.S. Army Medical Research and Materiel Command (USAMRMC)
APPLICANT(S) University of Florida Research Foundation, Incorporated (Gainesville, Florida)
ASSIGNEE(S)
INVENTOR(S) Samsun LAMPOTANG (Gainesville, Florida);  David Erik Lizdas (Gainesville, Florida);  Barys Valerievich Ihnatsenka (Gainesville, Florida)
ABSTRACT Techniques and systems are described for providing modularity, tracking and simulation features of a mixed reality simulator. A modular approach to tracking systems, tracked instruments, and interchangeable modular physical models is described. Enhanced indicators and indicator interfaces improve imaging probe and instrument orientation and alignment with respect to a physical target, including but not necessarily within a combined physical and virtual system; these include anisotropy indicators, indicators of alignment in both in-plane and out-of-plane ultrasound or other imaging techniques, and perpendicularity indicators for better placement of probes and instruments over curved surfaces. A universal needle hub is described that integrates tracking system components and simulation feedback components usably with varying needle types.
FILED Thursday, July 15, 2021
APPL NO 17/376498
CURRENT CPC
Image Data Processing or Generation, in General
G06T 19/006 (20130101)

Educational or Demonstration Appliances; Appliances for Teaching, or Communicating With, the Blind, Deaf or Mute; Models; Planetaria; Globes; Maps; Diagrams
G09B 9/00 (20130101)
G09B 19/00 (20130101)
G09B 23/285 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343321 Wang et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
APPLICANT(S) Regents of the University of Minnesota (Minneapolis, Minnesota)
ASSIGNEE(S)
INVENTOR(S) Jian-Ping Wang (Shoreview, Minnesota);  Delin Zhang (Saint Paul, Minnesota);  Protyush Sahu (Minneapolis, Minnesota)
ABSTRACT A magnetic device may include a layer stack. The layer stack may include a first ferromagnetic layer; a spacer layer on the first ferromagnetic layer; a second ferromagnetic layer on the spacer layer; and a dielectric barrier layer on the second ferromagnetic layer. In some examples, the layer stack may also include an additional ferromagnetic layer and an additional spacer layer. The magnetic device also may include a voltage source configured to apply a bias voltage across the layer stack to cause switching of a magnetic orientation of the second ferromagnetic layer without application of an external magnetic field.
FILED Wednesday, April 29, 2020
APPL NO 16/861869
CURRENT CPC
Static Stores
G11C 11/18 (20130101)
G11C 11/161 (20130101) Original (OR) Class
G11C 11/1673 (20130101)
G11C 11/1675 (20130101)

Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 27/222 (20130101)
H01L 43/04 (20130101)
H01L 43/06 (20130101)
H01L 43/10 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343519 Ramsey et al.
FUNDED BY
Department of Defense (DOD)
Defense Threat Reduction Agency (DTRA)
APPLICANT(S) The University of North Carolina at Chapel Hill (Chapel Hill, North Carolina)
ASSIGNEE(S)
INVENTOR(S) John Michael Ramsey (Chapel Hill, North Carolina);  Andrew Hampton (Auburn, Alabama);  Kevin Schultze (Chapel Hill, North Carolina)
ABSTRACT A miniature electrode apparatus is disclosed for trapping charged particles, the apparatus includes, along a longitudinal direction, a first end cap electrode, a central electrode having an aperture, and a second end cap electrode. The aperture is elongated in the lateral plane and extends through the central electrode along the longitudinal direction and the central electrode surrounds the aperture in a lateral plane perpendicular to the longitudinal direction to define a transverse cavity for trapping charged particles. Electric fields can be applied in a y-direction of the lateral plane across one or more planes perpendicular to the longitudinal axis to translocate and/or manipulate ion trajectories.
FILED Monday, March 01, 2021
APPL NO 17/188215
CURRENT CPC
Electric Discharge Tubes or Discharge Lamps
H01J 49/022 (20130101)
H01J 49/0027 (20130101)
H01J 49/065 (20130101) Original (OR) Class
H01J 49/424 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343618 Ma et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Office of Scientific Research (AFOSR)
United States Air Force (USAF)
Department of the Navy (DON)
Office of Naval Research (ONR)
Department of Agriculture (USDA)
U.S. Forest Service (FS)
APPLICANT(S) Wisconsin Alumni Research Foundation (Madison, Wisconsin)
ASSIGNEE(S)
INVENTOR(S) Zhenqiang Ma (Middleton, Wisconsin);  Huilong Zhang (Madison, Wisconsin);  Shaoqin Gong (Middleton, Wisconsin)
ABSTRACT Flexible transistors and electronic circuits incorporating the transistors are provided. The flexible transistors promote heat dissipation from the active regions of the transistors while preserving their mechanical flexibility and high-frequency performance. The transistor designs utilize thru-substrate vias (TSVs) beneath the active regions of thin-film type transistors on thin flexible substrates. To promote rapid heat dissipation, the TSVs are coated with a material having a high thermal conductivity that transfers heat from the active region of the transistor to a large-area ground.
FILED Thursday, April 30, 2020
APPL NO 16/862825
CURRENT CPC
Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 23/3672 (20130101) Original (OR) Class
H01L 23/5226 (20130101)
H01L 29/778 (20130101)
H01L 29/66431 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343701 Urciuoli
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Laboratory (ARL)
Combat Capabilities Development Command (CCDC)
APPLICANT(S) U.S Army Combat Capabilities Development Command, Army Research Laboratory (Adelphi, Maryland)
ASSIGNEE(S)
INVENTOR(S) Damian P. Urciuoli (Bowie, Maryland)
ABSTRACT A circuit comprising a first device (e.g., a high voltage MOSFET) coupled in series with a second device (e.g., a low voltage MOSFET or HEMT). The first device comprises a body diode. Additionally, the circuit comprises a diode coupled across the pair of devices. The diode is arranged antiparallel to the first device. In one exemplary embodiment, the first device is a SiC MOSFET and the second device is a Si MOSFET or GaN HEMT.
FILED Wednesday, April 29, 2020
APPL NO 16/861274
CURRENT CPC
Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 27/0266 (20130101) Original (OR) Class
H01L 29/1608 (20130101)
H01L 29/7786 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343862 NUZZO et al.
FUNDED BY
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Department of Energy (DOE)
APPLICANT(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
ASSIGNEE(S) The Board of Trustees of the University of Illinois (Urbana, Illinois)
INVENTOR(S) Ralph G. NUZZO (Champaign, Illinois);  John A. ROGERS (Wilmette, Illinois);  Etienne MENARD (Voglans, France);  Keon Jae LEE (Daejeon, South Korea);  Dahl-Young KHANG (Seoul, South Korea);  Yugang SUN (Gladwyne, Pennsylvania);  Matthew MEITL (Durham, North Carolina);  Zhengtao ZHU (Rapid City, South Dakota)
ABSTRACT The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations.
FILED Thursday, June 24, 2021
APPL NO 17/357697
CURRENT CPC
Processes or Apparatus Specially Adapted for the Manufacture or Treatment of Microstructural Devices or Systems
B81C 2201/0185 (20130101)

Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures
B82Y 10/00 (20130101)

Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 21/308 (20130101)
H01L 21/322 (20130101)
H01L 21/02521 (20130101)
H01L 21/02603 (20130101)
H01L 21/02628 (20130101)
H01L 21/6835 (20130101)
H01L 23/02 (20130101)
H01L 24/03 (20130101)
H01L 24/05 (20130101)
H01L 24/08 (20130101)
H01L 24/29 (20130101)
H01L 24/32 (20130101)
H01L 24/80 (20130101)
H01L 24/83 (20130101)
H01L 24/94 (20130101)
H01L 24/97 (20130101)
H01L 25/0753 (20130101)
H01L 27/1285 (20130101)
H01L 27/1292 (20130101)
H01L 29/04 (20130101)
H01L 29/06 (20130101)
H01L 29/12 (20130101)
H01L 29/068 (20130101)
H01L 29/76 (20130101) Original (OR) Class
H01L 29/0665 (20130101)
H01L 29/0673 (20130101)
H01L 29/0676 (20130101)
H01L 29/78603 (20130101)
H01L 29/78681 (20130101)
H01L 29/78696 (20130101)
H01L 31/0392 (20130101)
H01L 31/1804 (20130101)
H01L 31/1864 (20130101)
H01L 31/1896 (20130101)
H01L 31/03926 (20130101)
H01L 33/007 (20130101)
H01L 33/32 (20130101)
H01L 33/0093 (20200501)
H01L 2221/68368 (20130101)
H01L 2221/68381 (20130101)
H01L 2224/03 (20130101)
H01L 2224/80 (20130101)
H01L 2224/83 (20130101)
H01L 2224/94 (20130101)
H01L 2224/95 (20130101)
H01L 2224/97 (20130101)
H01L 2224/0332 (20130101)
H01L 2224/0345 (20130101)
H01L 2224/0362 (20130101)
H01L 2224/2919 (20130101)
H01L 2224/03614 (20130101)
H01L 2224/05073 (20130101)
H01L 2224/05082 (20130101)
H01L 2224/05124 (20130101)
H01L 2224/05144 (20130101)
H01L 2224/05155 (20130101)
H01L 2224/05166 (20130101)
H01L 2224/05552 (20130101)
H01L 2224/05553 (20130101)
H01L 2224/05554 (20130101)
H01L 2224/05555 (20130101)
H01L 2224/05644 (20130101)
H01L 2224/05666 (20130101)
H01L 2224/08225 (20130101)
H01L 2224/8385 (20130101)
H01L 2224/9202 (20130101)
H01L 2224/32225 (20130101)
H01L 2224/80006 (20130101)
H01L 2224/80121 (20130101)
H01L 2224/80862 (20130101)
H01L 2224/80895 (20130101)
H01L 2224/83005 (20130101)
H01L 2224/83121 (20130101)
H01L 2224/83192 (20130101)
H01L 2224/83193 (20130101)
H01L 2224/83862 (20130101)
H01L 2924/00012 (20130101)
H01L 2924/14 (20130101)
H01L 2924/0665 (20130101)
H01L 2924/01032 (20130101)
H01L 2924/1305 (20130101)
H01L 2924/1306 (20130101)
H01L 2924/1461 (20130101)
H01L 2924/1579 (20130101)
H01L 2924/10253 (20130101)
H01L 2924/10329 (20130101)
H01L 2924/12032 (20130101)
H01L 2924/12036 (20130101)
H01L 2924/12041 (20130101)
H01L 2924/12042 (20130101)
H01L 2924/12043 (20130101)
H01L 2924/12044 (20130101)
H01L 2924/13055 (20130101)
H01L 2924/13063 (20130101)
H01L 2924/13091 (20130101)
H01L 2924/15159 (20130101)
H01L 2924/15162 (20130101)
H01L 2924/15788 (20130101)

Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution
Y02E 10/547 (20130101)

Climate Change Mitigation Technologies in the Production or Processing of Goods
Y02P 70/50 (20151101)

Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests
Y10S 977/707 (20130101)
Y10S 977/724 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343923 OLIVER et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
Army Research Office (ARO)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) William D. OLIVER (Arlington, Massachusetts);  Simon GUSTAVSSON (Cambridge, Massachusetts);  I-Jan WANG (Cambridge, Massachusetts)
ABSTRACT A superconducting qubit is manufactured by stacking up atomically-thin, crystalline monolayers to form a heterostructure held together by van der Waals forces. Two sheets of superconducting material are separated by a third, thin sheet of dielectric to provide both a parallel plate shunting capacitor and a Josephson tunneling barrier. The superconducting material may be a transition metal dichalcogenide (TMD), such as niobium disilicate, and the dielectric may be hexagonal boron nitride. The qubit is etched, or material otherwise removed, to form a magnetic flux loop for tuning. The heterostructure may be protected by adhering additional layers of the dielectric or other insulator on its top and bottom. For readout, the qubit may be coupled to an external resonator, or the resonator may be integral with one of the sheets of superconducting material.
FILED Monday, November 30, 2020
APPL NO 17/106562
CURRENT CPC
Computer Systems Based on Specific Computational Models
G06N 10/00 (20190101)

Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 39/025 (20130101)
H01L 39/223 (20130101) Original (OR) Class
H01L 39/2416 (20130101)
H01L 39/2493 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343948 Dou et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
APPLICANT(S) Purdue Research Foundation (West Lafayette, Indiana)
ASSIGNEE(S) Purdue Research Foundation (West Lafayette, Indiana)
INVENTOR(S) Letian Dou (West Lafayette, Indiana);  Yao Gao (West Lafayette, Indiana);  Enzheng Shi (West Lafayette, Indiana)
ABSTRACT The present disclosure relates to novel two-dimensional halide perovskite materials, and the method of making and using the two-dimensional halide perovskite materials.
FILED Friday, September 04, 2020
APPL NO 17/012137
CURRENT CPC
Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium
C07F 7/24 (20130101)

Materials for Miscellaneous Applications, Not Provided for Elsewhere
C09K 11/06 (20130101)
C09K 2211/188 (20130101)

Capacitors; Capacitors, Rectifiers, Detectors, Switching Devices or Light-sensitive Devices, of the Electrolytic Type
H01G 9/20 (20130101)

Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for
H01L 35/24 (20130101)
H01L 35/26 (20130101)
H01L 51/0077 (20130101) Original (OR) Class

Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical
H01S 5/36 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344001 Hopkins et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Secretary of the Navy (SECNAV)
APPLICANT(S) The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia)
ASSIGNEE(S) The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia)
INVENTOR(S) Brandon J. Hopkins (Bethesda, Maryland);  Joseph F. Parker (Riva, Maryland);  Jeffrey W. Long (Alexandria, Virginia);  Debra R. Rolison (Arlington, Virginia)
ABSTRACT Disclosed are methods of making porous zinc electrodes. Taken together, the steps are: forming a mixture of water, a soluble compound that increases the viscosity of the mixture, an insoluble porogen, and metallic zinc powder; placing the mixture in a mold to form a sponge; optionally drying the sponge; placing the sponge in a metal mesh positioned to allow air flow through substantially all the openings in the mesh; heating the sponge in an inert atmosphere at a peak temperature of 200 to 420° C. to fuse the zinc particles to each other to form a sintered sponge; and heating the sintered sponge in an oxygen-containing atmosphere at a peak temperature of 420 to 700° C. to form ZnO on the surfaces of the sintered sponge. The heating steps burn out the porogen.
FILED Wednesday, July 14, 2021
APPL NO 17/375381
CURRENT CPC
Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder
B22F 3/11 (20130101)
B22F 3/1007 (20130101)
B22F 3/1143 (20130101)
B22F 2301/30 (20130101)

Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy
H01M 4/30 (20130101) Original (OR) Class
H01M 4/38 (20130101)
H01M 4/244 (20130101)
H01M 4/0433 (20130101)
H01M 4/0471 (20130101)
H01M 10/24 (20130101)
H01M 2004/027 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344036 Hersam et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Materiel Command (AFMC)
Air Force Research Laboratory (AFRL)
Department of Energy (DOE)
Argonne National Laboratory (ANL)
APPLICANT(S) NORTHWESTERN UNIVERSITY (Evanston, Illinois)
ASSIGNEE(S)
INVENTOR(S) Mark C. Hersam (Wilmette, Illinois);  Kan-Sheng Chen (Chicago, Illinois);  Ethan B. Secor (Chicago, Illinois)
ABSTRACT Composites comprising anode and cathode active materials conformally coupled to few-layered graphene, corresponding electrodes and related methods of preparation.
FILED Wednesday, July 07, 2021
APPL NO 17/369058
CURRENT CPC
Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy
H01M 4/131 (20130101)
H01M 4/133 (20130101)
H01M 4/134 (20130101)
H01M 4/136 (20130101)
H01M 4/139 (20130101)
H01M 4/0416 (20130101)
H01M 4/505 (20130101)
H01M 4/625 (20130101)
H01M 4/1393 (20130101)
H01M 10/0525 (20130101) Original (OR) Class
H01M 2004/028 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344081 Eskra et al.
FUNDED BY
Department of Defense (DOD)
Defense Logistics Agency (DLA)
Missile Defense Agency (MDA)
APPLICANT(S) Eskra Technical Products, Inc. (Saukville, Wisconsin)
ASSIGNEE(S)
INVENTOR(S) Michael David Eskra (Saukville, Wisconsin);  Paula Margaret Ralston (Frederick, Maryland)
ABSTRACT A system and method for providing a ceramic-based separator onto an electrode is disclosed. A separator is formed on the electrode via a dry, solvent-free application of a ceramic-based separator to the electrode. An electrode is provided to an application area via a feed mechanism and a separator layer is then applied to the electrode that is comprised of a binder including at least one of a thermoplastic material and a thermoset material and an electrically non-conductive separator material, with the separator layer being applied to the electrode via a dry dispersion application.
FILED Monday, June 28, 2021
APPL NO 17/304862
CURRENT CPC
Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy
H01M 10/052 (20130101)
H01M 50/46 (20210101) Original (OR) Class
H01M 50/403 (20210101)
H01M 50/446 (20210101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344306 ROTHE et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Research Laboratory (AFRL)
Defense Advanced Research Projects Agency (DARPA)
APPLICANT(S) THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan)
ASSIGNEE(S) THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan)
INVENTOR(S) Rohit ROTHE (Ann Arbor, Michigan);  Sechang OH (Ann Arbor, Michigan);  Kyojin CHOO (Ann Arbor, Michigan);  Seok Hyeon JEONG (Ann Arbor, Michigan);  Dennis SYLVESTER (Ann Arbor, Michigan);  David T. BLAAUW (Ann Arbor, Michigan)
ABSTRACT An amplifier is presented with a sample and average common mode feedback resistor. The amplifier circuit includes a feedback capacitor and a feedback resistor in parallel with the feedback capacitor, where the feedback capacitor and the feedback resistor form part of the negative feedback path for the amplifier. Of note, the feedback resistor is comprised of a low pass filter in series with a switched capacitor resistor, such that the low pass filter is electrically coupled to the output of the amplifier circuit and the switched capacitor resistor is electrically coupled to the inverting input of the amplifier circuit. The amplifier circuit further includes a control circuit interfaced with switches of the switched capacitor resistor. The high pass corner of the switched capacitor resistor is preferably lower than corner of the low pass filter.
FILED Thursday, April 29, 2021
APPL NO 17/243721
CURRENT CPC
Amplifiers
H03F 1/34 (20130101) Original (OR) Class
H03F 3/45475 (20130101)
H03F 2200/171 (20130101)
H03F 2200/331 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344417 AHADIAN et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Research Laboratory (AFRL)
APPLICANT(S) ULTRA COMMUNICATIONS, INC. (Vista, California)
ASSIGNEE(S)
INVENTOR(S) Joseph F. AHADIAN (San Marcos, California);  Vahid NAZER (San Marcos, California);  Sandra SKENDZIC (Vista, California);  Charles B. KUZNIA (Encinitas, California);  Richard J. WEISS (San Diego, California)
ABSTRACT Methods and systems for automated health assessment of fiber optic links of a fiber optic communication system are described. Tables are used to describe the fiber optic links, including access addresses to communication modules used in the links. Telemetry data representative of operation of the communication modules can be read via the access addresses into a central station. OTDR/OFDR measurement data of fiber optic segments used in the links can be read via the access addresses into the central station. The telemetry and/or OTDR/OFDR measurement data can be used by the central station for comparison against reference data to assess health of the links. The communication modules locally and continuously capture the telemetry data to detect transient events that may be the result of tampering of the links.
FILED Monday, May 17, 2021
APPL NO 17/322743
CURRENT CPC
Transmission
H04B 10/071 (20130101) Original (OR) Class
H04B 10/0793 (20130101)
H04B 10/07955 (20130101)
H04B 10/07957 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344554 Farritor et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
U.S. Army
U.S. Army Medical Research and Development Command (USAMRDC)
U.S. Army Medical Research and Materiel Command (USAMRMC)
National Aeronautics and Space Administration (NASA)
National Science Foundation (NSF)
Directorate for Education and Human Resources (EHR)
Division of Graduate Education (DGE)
APPLICANT(S) Board of Regents of the University of Nebraska (Lincoln, Nebraska)
ASSIGNEE(S)
INVENTOR(S) Shane Farritor (Lincoln, Nebraska);  Tyler Wortman (Grand Island, Nebraska);  Kyle Strabala (Pittsburgh, Pennsylvania);  Ryan McCormick (Valencia, California);  Amy Lehman (York, Nebraska);  Dmitry Oleynikov (Omaha, Nebraska);  Eric Markvicka (Lincoln, Nebraska)
ABSTRACT Various medical devices and related systems, including robotic and/or in vivo medical devices, and various robotic surgical devices for in vivo medical procedures. Included herein, for example, is a robotic surgical system having a support beam positionable through an incision, and a robotic device having a device body, first and second rotating shoulder components coupled to the device body, and first and second robotic arms coupled to the first and second shoulder components, respectively.
FILED Monday, June 07, 2021
APPL NO 17/340669
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 34/30 (20160201)
A61B 90/30 (20160201)
A61B 90/361 (20160201)
A61B 2034/302 (20160201)

Manipulators; Chambers Provided With Manipulation Devices
B25J 9/06 (20130101)
B25J 9/0087 (20130101)

Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements
G05B 2219/40418 (20130101)

Transmission of Digital Information, e.g Telegraphic Communication
H04L 41/0631 (20130101) Original (OR) Class
H04L 43/08 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210344616 Blumrich et al.
FUNDED BY
Department of Defense (DOD)
National Security Agency (NSA)
APPLICANT(S) NVIDIA Corp. (Santa Clara, California)
ASSIGNEE(S) NVIDIA Corp. (Santa Clara, California)
INVENTOR(S) Matthias Augustin Blumrich (Ridgefield, Connecticut);  Nan Jiang (Acton, Massachusetts);  Larry Robert Dennison (Mendon, Massachusetts)
ABSTRACT A switch architecture enables ports to stash packets in unused buffers on other ports, exploiting excess internal bandwidth that may exist, for example, in a tiled switch. This architecture leverages unused port buffer memory to improve features such as congestion handling and error recovery.
FILED Friday, July 16, 2021
APPL NO 17/377943
CURRENT CPC
Transmission of Digital Information, e.g Telegraphic Communication
H04L 49/70 (20130101)
H04L 49/101 (20130101) Original (OR) Class
H04L 49/254 (20130101)
H04L 49/3036 (20130101)
H04L 49/9047 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210345038 Ghaffarivardavagh et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Reza Ghaffarivardavagh (Boston, Massachusetts);  Sayed Saad Afzal (Cambridge, Massachusetts);  Osvy Rodriguez (Cambridge, Massachusetts);  Fadel Adib (Cambridge, Massachusetts)
ABSTRACT An ultra-wide bandwidth acoustic transducer may include multiple layers, including an inner piezoelectric layer, a polymer coupling layer and an outer piezoelectric layer. The polymer layer may be located between, and may be bonded to, the inner and outer piezoelectric layers. The transducer may have multiple eigenfrequencies of vibration. These eigenfrequencies may include primary resonant frequencies of the inner and outer piezoelectric layers respectively and may also include resonant frequencies that arise due to coupling between the layers. An acoustic backscatter system may employ such a transducer in backscatter nodes as well as in a transmitter. The multiple eigenfrequencies may enable the system to perform spread-spectrum communication at a high throughput. These multiple eigenfrequencies may also enable each backscatter node to shift frequency of an uplink signal, which in turn may enable the system to mitigate self-interference and to decode concurrent signals from multiple backscatter nodes.
FILED Sunday, April 11, 2021
APPL NO 17/227334
CURRENT CPC
Loudspeakers, Microphones, Gramophone Pick-ups or Like Acoustic Electromechanical Transducers; Deaf-aid Sets; Public Address Systems
H04R 1/44 (20130101) Original (OR) Class
H04R 17/005 (20130101)
H04R 17/10 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210345102 Win et al.
FUNDED BY
Department of Defense (DOD)
Department of the Navy (DON)
Office of Naval Research (ONR)
Defense University Research Instrumentation Program (DURIP)
APPLICANT(S) Massachusetts Institute of Technology (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Moe Z. Win (Framingham, Massachusetts);  Tianyi Peng (Somerville, Massachusetts);  Wenhan Dai (Cambridge, Massachusetts);  Zehao Yu (Cambridge, Massachusetts)
ABSTRACT Physical layer key generation provides privacy protection technique suitable for devices with limited computational ability. A key generation algorithm is based on OFDM waveforms. By exploiting the holistic CSI, key generation rate (KGR) is improved significantly. A cross-layer encryption protocol is based on the key generation algorithm and the AES. The secrecy of the encryption is enhanced compared to traditional encryption schemes with one pre-shared key (e.g., WPA2-PSK), even when some generated keys are leaked to the eavesdropper. The results lead to practical and robust applications of physical layer key generation.
FILED Tuesday, September 08, 2020
APPL NO 17/014611
CURRENT CPC
Transmission of Digital Information, e.g Telegraphic Communication
H04L 9/085 (20130101)
H04L 9/0875 (20130101)

Wireless Communication Networks
H04W 12/03 (20210101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210345132 Jagannath et al.
FUNDED BY
Department of Defense (DOD)
Department of the Army (DOA)
APPLICANT(S) ANDRO Computational Solutions, LLC (Rome, New York)
ASSIGNEE(S)
INVENTOR(S) Jithin Jagannath (Oriskany, New York);  Anu Jagannath (Oriskany, New York);  Andrew Louis Drozd (Rome, New York)
ABSTRACT Embodiments of the disclosure provide a system for operating a radio frequency (RF) network having a plurality of communication nodes. A network transceiver communicates with communication nodes in the RF network. A computing device coupled to the network transceiver performs actions including: evaluating a state of the RF network using a machine learning model, based on a spectrum environment and a communication objective, generating a set of communication parameters based on the state of the RF network, causing the network transceiver to communicate with the a communication node using the generated set of communication parameters, and modifying the machine learning model based on a result of causing the network transceiver to communicate with the communication node.
FILED Friday, April 30, 2021
APPL NO 17/245156
CURRENT CPC
Wireless Communication Networks
H04W 24/02 (20130101) Original (OR) Class
H04W 72/085 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 

Department of Energy (DOE) 

US 20210338142 Arnold et al.
FUNDED BY
Department of Energy (DOE)
National Nuclear Security Administration (NNSA)
National Technology and Engineering Solutions of Sandia, LLC (NTESS)
APPLICANT(S) KNOW BIOLOGICAL, INC. (Milton, Georgia);  National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico)
ASSIGNEE(S)
INVENTOR(S) Gary Stephen Arnold (Cumming, Georgia);  Matthew Wallace Moorman (Albuquerque, New Mexico);  Joshua Jonathan Whiting (Albuquerque, New Mexico)
ABSTRACT Example aspects of a volatile organic compound detection device, a wearable health monitoring device, and a method of monitoring a user's health are disclosed. The volatile organic compound detection device can comprise a collector comprising a collector material configured to collect volatile organic compounds given off from a user's skin; a separator comprising a gas chromatography column configured to separate mixtures of the volatile organic compounds into their constituent chemicals; and an identifier comprising a detector and a processor, the detector configured to transduce the the constituent chemicals into a signal, the processor configured to process the signal to identify specific volatile organic compounds indicative of a health condition.
FILED Monday, June 07, 2021
APPL NO 17/340195
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/443 (20130101)
A61B 5/4094 (20130101) Original (OR) Class
A61B 5/6831 (20130101)
A61B 5/6833 (20130101)
A61B 10/00 (20130101)
A61B 2010/0083 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 30/00 (20130101)
G01N 30/20 (20130101)
G01N 30/64 (20130101)
G01N 30/80 (20130101)
G01N 2030/025 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338463 Mukerjee et al.
FUNDED BY
Department of Energy (DOE)
Lawrence Livermore National Laboratory (LLNL)
Lawrence Livermore National Security LLC (LLNS)
APPLICANT(S) LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California)
ASSIGNEE(S) LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California);  The Brigham and Women's Hospital, Inc. (Boston, Massachusetts);  Duke University (Durham, North Carolina)
INVENTOR(S) Erik V. Mukerjee (Livermore, California);  Jane A. Leopold (Chestnut Hill, Massachusetts);  Amanda Randles (Durham, North Carolina)
ABSTRACT A stent apparatus, system, and method that senses wall shear stress by measuring fluid flow at localized areas within the stent, that processes measured information through an integrated circuit, and selectively sends power to mechanically controllable stent surfaces which results in localized geometric changes. In various embodiments the stent apparatus, system, and method sends data to outside the body in real time.
FILED Tuesday, July 13, 2021
APPL NO 17/374616
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/4851 (20130101)
A61B 5/6862 (20130101)
A61B 5/6876 (20130101)

Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits
A61F 2/07 (20130101)
A61F 2/90 (20130101) Original (OR) Class
A61F 2002/828 (20130101)

Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles
A61L 31/14 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210338880 Maitland et al.
FUNDED BY
Department of Energy (DOE)
Lawrence Livermore National Laboratory (LLNL)
Lawrence Livermore National Security LLC (LLNS)
APPLICANT(S) LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California);  THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas)
ASSIGNEE(S)
INVENTOR(S) Duncan J. Maitland (College Station, Texas);  Todd Lawrence Landsman (College Station, Texas);  Tyler Joseph Touchet (Cypress, Texas);  Elizabeth L. Cosgriff-Hernandez (College Station, Texas);  Thomas S. Wilson (San Leandro, California)
ABSTRACT An embodiment includes a wound dressing comprising: a shape memory polymer (SMP) foam, including open cells, having first and second states; and a hydrogel (HG) included within the cells; wherein (a) in a first position a composite, including the SMP foam and the HG, is configured to be located proximate a hemorrhagic tissue with the SMP foam in the first state; (b) in a second position the composite is configured to be expanded to the second state against the hemorrhagic tissue when the SMP foam is plasticized at 37° C. depressing a glass transition temperature (Tg) of the SMP foam to below 25° C. Other embodiments are described herein.
FILED Tuesday, June 01, 2021
APPL NO 17/335316
CURRENT CPC
Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits
A61F 13/00017 (20130101)

Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles
A61L 15/18 (20130101) Original (OR) Class
A61L 15/26 (20130101)
A61L 15/46 (20130101)
A61L 15/425 (20130101)
A61L 24/0015 (20130101)
A61L 24/0036 (20130101)
A61L 24/0094 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339186 Li et al.
FUNDED BY
Department of Energy (DOE)
APPLICANT(S) Rutgers, The State University of New Jersey (New Brunswick, New Jersey)
ASSIGNEE(S)
INVENTOR(S) Jing Li (Piscataway, New Jersey);  Hao Wang (Shenzhen, China PRC)
ABSTRACT The present disclosure relates to novel metal-organic frameworks (MOFs) comprising tetratopic ligands with small pore apertures. The present disclosure further relates to methods of utilizing the MOFs of the disclosure to separate hydrocarbons through adsorptive processes.
FILED Friday, September 13, 2019
APPL NO 17/274388
CURRENT CPC
Separation
B01D 53/0423 (20130101) Original (OR) Class
B01D 2253/204 (20130101)
B01D 2256/24 (20130101)
B01D 2257/7022 (20130101)

Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium
C07F 5/003 (20130101)
C07F 7/003 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339473 MORAN
FUNDED BY
Department of Energy (DOE)
Lawrence Livermore National Laboratory (LLNL)
Lawrence Livermore National Security LLC (LLNS)
APPLICANT(S) Lawrence Livermore National Security, LLC (Livermore, California)
ASSIGNEE(S)
INVENTOR(S) Bryan D. MORAN (Pleasanton, California)
ABSTRACT The present disclosure relates to a method for forming a three dimensional (3D) component from a photopolymer resin. The method may involve generating a first optical beam at a first wavelength, with the first optical beam causing polymerization of a photopolymerizable resist. A second optical beam is generated at a second wavelength, different from the first wavelength, which inhibits polymerization of the photopolymerizable resist. A device is used to receive the first and second optical beams and to generate therefrom corresponding separate first and second light patterns, respectively, where the first light pattern forms a first image on the photopolymerizable resist to cause polymerization of a first portion of the photopolymerizable resist, while the second light pattern forms a second image on the photopolymerizable resist and inhibits polymerization of a second portion of the photopolymerizable resist.
FILED Friday, June 11, 2021
APPL NO 17/345158
CURRENT CPC
Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing
B29C 64/268 (20170801) Original (OR) Class
B29C 64/277 (20170801)
B29C 64/393 (20170801)

Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering
B33Y 50/02 (20141201)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210339515 Holowczak et al.
FUNDED BY
Department of Energy (DOE)
Office of Energy Efficiency and Renewable Energy (EERE)
APPLICANT(S) Hamilton Sundstrand Corporation (Charlotte, North Carolina)
ASSIGNEE(S)
INVENTOR(S) John E. Holowczak (South Windsor, Connecticut);  Paul Sheedy (Bolton, Connecticut);  Justin B. Alms (Coventry, Connecticut);  John J. Gangloff, JR. (Middletown, Connecticut);  Daniel A. Mosher (Glastonbury, Connecticut);  Rajiv Ranja (South Windsor, Connecticut);  Brian St. Rock (Andover, Connecticut)
ABSTRACT A laminate composite structure having at least one tubular region and at least one bonded region. The structure has a first composite layer, a second composite layer, a cavity, and one or more reinforcing fibers. Each composite layer comprises composite material with a top face and a bottom face opposite the top face. The top face of one is joined to the bottom face of the other along an interlaminar region. The cavity separates the bottom face and the top face to form a tube. The tube has an internal boundary defined by the bottom face and the top face. The reinforcing fibers line the internal boundary and are arranged so that the reinforcing fibers reduce the propensity of the composites layer to separate under internal pressure loading.
FILED Thursday, February 18, 2021
APPL NO 17/179038
CURRENT CPC
Layered Products, i.e Products Built-up of Strata of Flat or Non-flat, e.g Cellular or Honeycomb, Form
B32B 18/00 (20130101)
B32B 37/10 (20130101)
B32B 37/0053 (20130101) Original (OR) Class
B32B 38/1808 (20130101)
B32B 2038/0072 (20130101)

Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone
C04B 35/83 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340011 LAINE et al.
FUNDED BY
Department of Energy (DOE)
Office of Energy Efficiency and Renewable Energy (EERE)
National Science Foundation (NSF)
APPLICANT(S) THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan)
ASSIGNEE(S) THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan)
INVENTOR(S) Richard M. LAINE (Ann Arbor, Michigan);  Eleni TEMECHE (Ann Arbor, Michigan);  Xinyu ZHANG (Ann Arbor, Michigan)
ABSTRACT A method of synthesizing a precursor for making a polymer, glass, or ceramic material is provided. The method includes reacting OPCl3 with NH3 or MNH2, where M is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form O═P(NH2)3. The method then includes either: (i) reacting the O═P(NH2)3 with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor; or (ii) heating the O═P(NH2)3 to form a branched or cyclomeric compound, and reacting the branched or cyclomeric compound with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor. The precursor is an oligomer or a polymer. Uses for the precursor and the polymer, glass, or ceramic material as binders, sintering aids, adhesives, and electrolytes in battery components are also provided.
FILED Friday, August 30, 2019
APPL NO 17/271244
CURRENT CPC
Non-metallic Elements; Compounds Thereof;
C01B 21/0823 (20130101) Original (OR) Class

Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy
H01M 10/0525 (20130101)
H01M 10/0562 (20130101)
H01M 2300/0071 (20130101)
H01M 2300/0085 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340048 Visco et al.
FUNDED BY
Department of Energy (DOE)
Advanced Research Projects Agency - Energy (ARPA-E)
APPLICANT(S) PolyPlus Battery Company (Berkeley, California)
ASSIGNEE(S) PolyPlus Battery Company (Berkeley, California)
INVENTOR(S) Steven J. Visco (Berkeley, California);  Yevgeniy S. Nimon (Danville, California);  Bruce D. Katz (Moraga, California)
ABSTRACT Manufacturing methods can involve use of a vessel apparatus for making Li ion conducting sulfide glass by melt processing the inside the vessel apparatus, the apparatus having a liner assembly in an ampoule assembly providing an interior wall component that is chemically compatible in direct contact with the molten sulfide glass and maintains intimate thermal contact with the interior wall surface of the ampoule assembly.
FILED Wednesday, April 28, 2021
APPL NO 17/243429
CURRENT CPC
Manufacture, Shaping, or Supplementary Processes
C03B 5/43 (20130101) Original (OR) Class
C03B 17/064 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340070 Sandhage
FUNDED BY
Department of Energy (DOE)
Office of Energy Efficiency and Renewable Energy (EERE)
APPLICANT(S) Purdue Research Foundation (West Lafayette, Indiana)
ASSIGNEE(S)
INVENTOR(S) Kenneth Henry Sandhage (Lafayette, Indiana)
ABSTRACT Materials systems resistant to penetration of molten salts and may be present within a molten-salt-facing wall of a device for containing a molten salt bath at an elevated temperature, and molten-salt-facing walls and devices formed by such materials systems. A first layer of such a system defines an outer surface for direct contact with the molten salt bath, and resists erosion and corrosion and is penetrable by the molten salt at the elevated temperature. A second layer is located adjacent to the first layer and exhibits little or no wetting by the molten salt so that at least a portion of a thickness of the second layer is not penetrable by the molten salt. A third layer is located adjacent to the second layer and is porous and exhibits a low thermal conductivity at the elevated temperature.
FILED Thursday, April 01, 2021
APPL NO 17/220605
CURRENT CPC
Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus
B01J 19/02 (20130101)
B01J 19/0013 (20130101)

Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone
C04B 28/06 (20130101)
C04B 28/105 (20130101)
C04B 41/009 (20130101)
C04B 41/65 (20130101) Original (OR) Class
C04B 41/5001 (20130101)
C04B 2111/2084 (20130101)

Materials for Miscellaneous Applications, Not Provided for Elsewhere
C09K 5/12 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340307 Noonan et al.
FUNDED BY
Department of Energy (DOE)
Office of Science (DOEOS)
APPLICANT(S) CARNEGIE MELLON UNIVERSITY (PITTSBURGH, Pennsylvania)
ASSIGNEE(S)
INVENTOR(S) Kevin Noonan (Pittsburgh, Pennsylvania);  Ryan Selhorst (Dayton, Ohio);  Jamie Gaitor (Pittsburgh, Pennsylvania)
ABSTRACT A statistical, cationic-functionalized norbornene copolymer is formed by a process including performing a vinyl addition polymerization in the presence of a metal catalyst of a first norbornene monomer substituted with a first alkyl group and at least a second norbornene monomer substituted with a second alkyl group, to form an intermediate norbornene copolymer. The second alkyl group includes a substituent which undergoes a substitution reaction with a precursor of a cationic group. The process further includes adding the precursor for the cationic group to the intermediate norbornene copolymer to form the cationic functionalized norbornene copolymer. The cationic group has a volume of 0.25 cm3/mol or greater (for example, a phosphonium group or an imidazolium group).
FILED Thursday, April 29, 2021
APPL NO 17/243877
CURRENT CPC
Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds
C08F 232/08 (20130101)
C08F 287/00 (20130101)
C08F 299/00 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340423 Li et al.
FUNDED BY
Department of Energy (DOE)
UT-Battelle, LLC (UT-BATTELLE)
APPLICANT(S) UT-Battelle, LLC (Oak Ridge, Tennessee)
ASSIGNEE(S)
INVENTOR(S) Yuzhan Li (Oak Ridge, Tennessee);  Kyle R. Gluesenkamp (Oak Ridge, Tennessee);  Monojoy Goswami (Oak Ridge, Tennessee);  Navin Kumar (Oak Ridge, Tennessee);  Timothy J. Laclair (Oak Ridge, Tennessee);  Orlando Rios (Oak Ridge, Tennessee)
ABSTRACT A phase change material composition for latent heat storage is provided. In one embodiment, the phase change material includes a salt hydrate having a melting temperature (Tm) of from 1° C. to 100° C. as determined in accordance with ASTM E793. The phase change material further includes a stabilizing matrix including a polysaccharide selected from the group of a nanocellulose, a sulfonated polysaccharide, a starch, a glycogen, a chitin, and combinations thereof. A composite article including the phase change material composition is also provided.
FILED Tuesday, April 13, 2021
APPL NO 17/229035
CURRENT CPC
Materials for Miscellaneous Applications, Not Provided for Elsewhere
C09K 5/063 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340437 Mabe et al.
FUNDED BY
Department of Energy (DOE)
Lawrence Livermore National Laboratory (LLNL)
Lawrence Livermore National Security LLC (LLNS)
National Nuclear Security Administration (NNSA)
National Technology and Engineering Solutions of Sandia, LLC (NTESS)
APPLICANT(S) Lawrence Livermore National Security, LLC (Livermore, California);  Ludlum Measurements, Inc. (Sweetwater, Texas);  National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico)
ASSIGNEE(S) Lawrence Livermore National Security, LLC (Livermore, California);  National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico);  Ludlum Measurements, Inc. (Sweetwater, Texas);  National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico)
INVENTOR(S) Andrew Neil Mabe (Livermore, California);  M Leslie Carman (San Ramon, California);  Stephen Anthony Payne (Castro Valley, California);  Natalia P. Zaitseva (Livermore, California);  Charles R. Hurlbut (Sweetwater, Texas);  Terence C. O'Brien (Sweetwater, Texas);  Kyle Ray Shipp (Sweetwater, Texas);  Nicholas Richard Myllenbeck (Livermore, California)
ABSTRACT A plastic scintillator includes a polymer matrix, an aliphatic additive present in the polymer matrix in an effective amount to impart fog resistance to the plastic scintillator, and at least one fluorescent dye in the polymer matrix, the dye being effective to provide scintillation upon exposure to radiation. The effective amount of the aliphatic additive is in a range of greater than 0 weight percent up to 5 weight percent relative to the total weight of the plastic scintillator. Moreover, the aliphatic additive has a structure comprising up to 300 repeat units.
FILED Thursday, April 29, 2021
APPL NO 17/244805
CURRENT CPC
Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H
C08J 3/20 (20130101)

Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients
C08K 5/353 (20130101)

Materials for Miscellaneous Applications, Not Provided for Elsewhere
C09K 11/02 (20130101) Original (OR) Class
C09K 11/06 (20130101)
C09K 2211/1007 (20130101)
C09K 2211/1018 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340452 HAFENSTINE et al.
FUNDED BY
Department of Energy (DOE)
Office of Energy Efficiency and Renewable Energy (EERE)
Alliance for Sustainable Energy, LLC (ASE)
National Renewable Energy Laboratory (NREL)
APPLICANT(S) Alliance for Sustainable Energy, LLC (Golden, Colorado)
ASSIGNEE(S)
INVENTOR(S) Glenn Richard HAFENSTINE (Wheat Ridge, Colorado);  Derek Richard VARDON (Lakewood, Colorado);  Xiangchen HUO (Golden, Colorado);  Nabila Asem HUQ (Boulder, Colorado)
ABSTRACT The present disclosure relates to a composition that includes a first oxide having a phosphate, a ratio of Brønsted acid sites to Lewis acid sites between 0.05 and 1.00, and a total acidity between 50 μmol/g and 300 μmol/g, where the phosphate is at least one of a functional group covalently bonded to the first oxide and/or an anion ionically bonded to the first oxide.
FILED Monday, July 19, 2021
APPL NO 17/379477
CURRENT CPC
Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus
B01J 23/44 (20130101)
B01J 27/195 (20130101)
B01J 27/1802 (20130101)
B01J 35/023 (20130101)
B01J 35/026 (20130101)
B01J 35/1014 (20130101)
B01J 35/1019 (20130101)
B01J 35/1038 (20130101)
B01J 35/1042 (20130101)

Acyclic or Carbocyclic Compounds
C07C 41/09 (20130101)

Fuels Not Otherwise Provided for; Natural Gas; Synthetic Natural Gas Obtained by Processes Not Covered by Subclasses C10G, C10K; Liquefied Petroleum Gas; Adding Materials to Fuels or Fires to Reduce Smoke or Undesirable Deposits or to Facilitate Soot Removal; Firelighters
C10L 1/02 (20130101)
C10L 1/023 (20130101)
C10L 1/026 (20130101) Original (OR) Class
C10L 2200/0423 (20130101)
C10L 2200/0446 (20130101)
C10L 2270/023 (20130101)
C10L 2270/026 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340553 Hittinger et al.
FUNDED BY
Department of Energy (DOE)
National Science Foundation (NSF)
Directorate for Biological Sciences (BIO)
Division of Environmental Biology (DEB)
Department of Agriculture (USDA)
National Institute of Food and Agriculture (NIFA)
APPLICANT(S) Wisconsin Alumni Research Foundation (Madison, Wisconsin)
ASSIGNEE(S) Wisconsin Alumni Research Foundation (Madison, Wisconsin)
INVENTOR(S) Chris Todd Hittinger (Madison, Wisconsin);  EmilyClare Patricia Baker (Madison, Wisconsin)
ABSTRACT Polypeptides comprising maltose/maltotriose transporters are provided. Additionally, polynucleotides, DNA constructs, and vectors encoding a maltose/maltotriose transporter, or yeast cells harboring such polynucleotides are provided. The yeast cell may be a Saccharomyces eubayanus cell modified to increase the expression or transport activity of a maltose/maltotriose transporter at the plasma membrane of the cell. Further, methods are provided for making a fermentation product by culturing any one of the yeast cells described herein with a fermentable substrate. Finally, methods are provided to select for and isolate maltotriose-utilizing strains of Saccharomyces eubayanus.
FILED Monday, June 07, 2021
APPL NO 17/341224
CURRENT CPC
Peptides
C07K 14/395 (20130101)

Beer; Preparation of Beer by Fermentation; Preparation of Malt for Making Beer; Preparation of Hops for Making Beer
C12C 11/00 (20130101)

Wine; Preparation Thereof; Alcoholic Beverages; Preparation of Alcoholic Beverages Not Provided for in Subclasses C12C or C12H
C12G 1/0203 (20130101)
C12G 3/02 (20130101)

Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media
C12N 1/16 (20130101)
C12N 15/81 (20130101) Original (OR) Class
C12N 2500/34 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340683 Zhang et al.
FUNDED BY
Department of Energy (DOE)
Office of Energy Efficiency and Renewable Energy (EERE)
APPLICANT(S) University of Tennessee Research Foundation (Knoxville, Tennessee)
ASSIGNEE(S)
INVENTOR(S) Feng Yuan Zhang (Tullahoma, Tennessee);  Kui Li (Tullahoma, Tennessee)
ABSTRACT A ruthenium-copper (RuCu) nano-sponge (NSP) electrocatalyst for use in the electrolytic reduction of nitrogen to provide ammonia is described. The RuCu NSP can be prepared as a porous nanoparticle comprising a RuCu alloy via facile reduction of Ru and Cu precursors under ambient conditions. Electrodes prepared with surface disposed RuCu NSPs can be used to prepare ammonia from nitrogen with good yields and Faradaic efficiency at room temperature and atmospheric pressure.
FILED Friday, October 30, 2020
APPL NO 17/085720
CURRENT CPC
Ammonia; Cyanogen; Compounds Thereof
C01C 1/00 (20130101)

Electrolytic or Electrophoretic Processes for the Production of Compounds or Non-metals; Apparatus Therefor
C25B 1/00 (20130101)
C25B 11/035 (20130101) Original (OR) Class
C25B 11/0431 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340688 FREIDERICH et al.
FUNDED BY
Department of Energy (DOE)
National Nuclear Security Administration (NNSA)
APPLICANT(S) Consolidated Nuclear Security, LLC (Oak Ridge, Tennessee)
ASSIGNEE(S)
INVENTOR(S) John W. FREIDERICH (Oak Ridge, Tennessee);  Tasha L. BOYD (Clinton, Tennessee)
ABSTRACT Methods for electropolishing and coating aluminum on a surface of an air and/or moisture sensitive substrate, including: in a vessel, submerging the substrate in a first molten salt bath and applying an anodizing current to the substrate at a first temperature to electropolish the surface of the substrate; wherein the first molten salt bath includes one of a first organic salt bath and first inorganic salt bath; wherein, when used, the first organic salt bath includes one of (a) aluminum halide and ionic liquid, (b) a combination of an aluminum halide and halogenatedmethylphenylsulfone (C6(H5-y,Xy)SO2CX3, where y is a number from 0-5), (c) a combination of an aluminum halide, an ionic liquid, and halogenatedmethylphenylsulfone (C6(H5-y,Xy)SO2CX3), and (d) AlF3-organofluoride-hydrofluoric acid adduct; wherein, when used, the first inorganic salt bath includes aluminum halide and alkali metal halide; and wherein the anodizing current is 10-30 mA/cm2.
FILED Monday, July 19, 2021
APPL NO 17/379395
CURRENT CPC
Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General
C23C 18/31 (20130101)

Processes for the Electrolytic or Electrophoretic Production of Coatings; Electroforming; Apparatus Therefor
C25D 3/44 (20130101)
C25D 3/665 (20130101)
C25D 5/44 (20130101)

Processes for the Electrolytic Removal of Materials From Objects; Apparatus Therefor
C25F 3/16 (20130101)
C25F 3/20 (20130101) Original (OR) Class
C25F 3/22 (20130101)
C25F 3/26 (20130101)
C25F 3/28 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210340692 Mirkin et al.
FUNDED BY
Department of Defense (DOD)
Department of the Air Force (DAF)
Air Force Office of Scientific Research (AFOSR)
Asian Office of Aerospace Research and Development (AOARD)
Department of Energy (DOE)
Office of Science (DOEOS)
APPLICANT(S) NORTHWESTERN UNIVERSITY (Evanston, Illinois)
ASSIGNEE(S)
INVENTOR(S) Chad A. Mirkin (Wilmette, Illinois);  Taegon Oh (Evanston, Illinois);  Sarah S. Park (Evanston, Illinois)
ABSTRACT A post-synthetic method for stabilizing colloidal crystals programmed from nucleic acid is disclosed herein. In some embodiments, the method relies on Ag+ ions to stabilize the particle-connecting nucleic acid duplexes within the crystal lattice, essentially transforming them from loosely bound structures to ones with very strong interparticle links. In some embodiments, the nucleic acid is DNA. Such crystals do not dissociate as a function of temperature like normal DNA or DNA-interconnected colloidal crystals, and they can be moved from water to organic media or the solid state, and stay intact. The Ag+-stabilization of the nucleic acid (e.g., DNA) bonds is accompanied by a nondestructive contraction of the lattice, and both the stabilization and contraction are reversible with the chemical extraction of the Ag+ ions, e.g., by AgCl precipitation with NaCl.
FILED Wednesday, September 25, 2019
APPL NO 17/272139
CURRENT CPC
Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor
C30B 7/08 (20130101)
C30B 29/02 (20130101) Original (OR) Class
C30B 29/58 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341369 GE et al.
FUNDED BY
Department of Energy (DOE)
Basic Energy Sciences (BES)
National Science Foundation (NSF)
Directorate for Mathematical and Physical Sciences (MPS)
Division of Materials Research (DMR)
APPLICANT(S) President and Fellows of Harvard College (Cambridge, Massachusetts)
ASSIGNEE(S)
INVENTOR(S) Shencheng GE (Boston, Massachusetts);  Yunzhe WANG (Baltimore, Maryland);  Nicolas J. DESHLER (Berkeley, California);  Daniel J. PRESTON (Houston, Texas);  George M. WHITESIDES (Newton, Massachusetts)
ABSTRACT A device is disclosed, including: a plate including a sample deposition tube adapted to receive a sample comprising one or more analytes, the sample deposition tube defining a vertical axis substantially perpendicular to a main surface of the plate; and a mirror positioned to project, substantially parallel to the main surface of the plate, an image of the sample deposition tube along its vertical axis, so as to allow determination of the vertical location of the one or more analytes inside the sample deposition tube. Methods for determining the density of one or more analytes using various embodiments of the device are also described.
FILED Friday, May 17, 2019
APPL NO 17/056142
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 9/18 (20130101) Original (OR) Class
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341399 Graves et al.
FUNDED BY
Department of Energy (DOE)
Office of Science (DOEOS)
National Science Foundation (NSF)
APPLICANT(S) Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona)
ASSIGNEE(S)
INVENTOR(S) William Graves (Tempe, Arizona);  Lucas Malin (Tempe, Arizona)
ABSTRACT A method includes simulating diffraction in a transmission geometry of relativistic electron bunches from a crystallographic structure of a crystal thereby simulating diffraction of the relativistic electron bunches into a plurality of Bragg peaks. The method includes selecting a range of angles between a direction of propagation of the relativistic electron bunches and a normal direction of crystal including an angle at which a diffraction portion is maximized. The method includes sequentially accelerating a plurality of physical electron bunches to relativistic energies toward a physical crystal having the crystallographic structure and diffracting the plurality of physical electron bunches off the physical crystal at different angles and measuring the diffraction portion into the respective Bragg peak at the different angles. The method includes selecting a final angle based on the measured diffraction portion into the respective Bragg peak at the different angles and generating a pulse of light.
FILED Friday, July 16, 2021
APPL NO 17/378094
CURRENT CPC
Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 23/20008 (20130101) Original (OR) Class
G01N 2223/102 (20130101)
G01N 2223/0565 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341439 Van Berkel
FUNDED BY
Department of Energy (DOE)
UT-Battelle, LLC (UT-BATTELLE)
Oak Ridge National Laboratory (ORNL)
APPLICANT(S) UT-BATTELLE, LLC (Oak Ridge, Tennessee)
ASSIGNEE(S)
INVENTOR(S) Gary J. Van Berkel (Oak Ridge, Tennessee)
ABSTRACT A system for sampling a sample material includes a probe which can have an outer probe housing with an open end. A liquid supply conduit within the housing has an outlet positioned to deliver liquid to the open end of the housing. The liquid supply conduit can be connectable to a liquid supply for delivering liquid at a first volumetric flow rate to the open end of the housing. A liquid exhaust conduit within the housing is provided for removing liquid from the open end of the housing. A liquid exhaust system can be provided for removing liquid from the liquid exhaust conduit at a second volumetric flow rate. A droplet dispenser can dispense drops of a sample or a sample-containing solvent into the open end of the housing. A sensor and a processor can be provided to monitor and maintain a liquid dome present at the open end.
FILED Tuesday, January 12, 2021
APPL NO 17/147450
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/443 (20130101)
A61B 10/02 (20130101)

Investigating or Analysing Materials by Determining Their Chemical or Physical Properties
G01N 1/00 (20130101)
G01N 1/20 (20130101)
G01N 30/7233 (20130101) Original (OR) Class
G01N 35/1095 (20130101)
G01N 2030/027 (20130101)

Electric Discharge Tubes or Discharge Lamps
H01J 49/0404 (20130101)
H01J 49/0431 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341764 Du et al.
FUNDED BY
Department of Energy (DOE)
Lawrence Berkeley National Laboratory (LBNL)
APPLICANT(S) The Regents of the University of California (Oakland, California)
ASSIGNEE(S)
INVENTOR(S) Qiang Du (Pleasanton, California);  Russell B. Wilcox (Berkeley, California);  Tong Zhou (San Pablo, California);  Lawrence R. Doolittle (Walnut Creek, California);  Gang Huang (Fremont, California);  Derun Li (Concord, California)
ABSTRACT This disclosure provides systems, methods, and apparatus related to optical systems. In one aspect, a method includes: generating a plurality of laser beams; receiving the plurality of laser beams at the point at a diffractive optical element, the diffracting optical element diffracting the plurality of laser beams to generate a plurality of output laser beams including a central laser beam and a plurality of side laser beams; measuring a power of at least two of the plurality of output laser beams generated by the diffractive optical element; determining a phase error in laser beams of the plurality of laser beams from the power of the at least two of the plurality of output laser beams; and changing the phase N−1 laser beams of the plurality of laser beams, with N being a number of the plurality of laser beams.
FILED Thursday, April 22, 2021
APPL NO 17/237384
CURRENT CPC
Optical Elements, Systems, or Apparatus
G02B 27/1086 (20130101)
G02B 27/4277 (20130101)

Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters
G02F 1/0121 (20130101) Original (OR) Class
G02F 2203/50 (20130101)

Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical
H01S 3/23 (20130101)
H01S 3/0085 (20130101)
H01S 3/06754 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341903 Vernon
FUNDED BY
Department of Energy (DOE)
National Nuclear Security Administration (NNSA)
Kansas City National Security Campus (KCNSC)
Honeywell Federal Manufacturing and Technologies, LLC (FM&T)
APPLICANT(S) Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri)
ASSIGNEE(S) Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri)
INVENTOR(S) Gregory John Vernon (Kansas City, Missouri)
ABSTRACT A system and method of creating a shape-conforming lattice structure for a part formed via additive manufacturing. The method includes receiving a computer model of the part and generating a finite element mesh. A lattice structure including a number of lattice cellular components may also be generated. Some of the mesh elements of the finite element mesh may be deformed so that the finite element mesh conforms to the overall shape of the part. The lattice structure may then be deformed so that the lattice structure has a cellular periodicity corresponding to the finite elements of the finite element mesh. In this way, the part retains the benefits of its overall shape and the benefits of lattice features without introducing structural weak points, directional stresses, and other structural deficiencies.
FILED Tuesday, July 06, 2021
APPL NO 17/367936
CURRENT CPC
Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing
B29C 64/386 (20170801)

Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering
B33Y 50/02 (20141201)

Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements
G05B 19/4099 (20130101) Original (OR) Class
G05B 2219/35134 (20130101)
G05B 2219/49007 (20130101)

Climate Change Mitigation Technologies in the Production or Processing of Goods
Y02P 90/02 (20151101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210341991 Yoon et al.
FUNDED BY
Department of Energy (DOE)
Battelle Energy Alliance, LLC (BEA)
APPLICANT(S) Battelle Energy Alliance, LLC (Idaho Falls, Idaho)
ASSIGNEE(S)
INVENTOR(S) Su Jong Yoon (Idaho Falls, Idaho);  Jeffery A. Aguiar (Salt Lake City, Utah);  Johanna H. Oxstrand (ldaho Falls, Idaho);  Katya L. Le Blanc (ldaho Falls, Idaho)
ABSTRACT Systems, devices, and methods are described for performing augmented reality (AR) to assist user performing a task in an environment. An AR device may be configured to capture real-time data. An AR engine may be configured to monitor user behavior from the real-time data responsive to feature extraction from the real-time data, compare the user behavior to pre-defined work procedures, and generate augmented reality objects to be output by the AR device.
FILED Wednesday, October 02, 2019
APPL NO 17/250895
CURRENT CPC
Diagnosis; Surgery; Identification
A61B 5/02438 (20130101)

Electric Digital Data Processing
G06F 3/011 (20130101) Original (OR) Class
G06F 3/017 (20130101)

Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers
G06K 9/00335 (20130101)
G06K 9/00671 (20130101)

Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for
G06Q 10/063114 (20130101)

Wireless Communication Networks
H04W 4/80 (20180201)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342285 SEYEDZADEHDELCHEH et al.
FUNDED BY
Department of Energy (DOE)
Exascale Computing Project (ECP)
PathForward Project (PATHFORWARD)
Lawrence Livermore National Laboratory (LLNL)
APPLICANT(S) ADVANCED MICRO DEVICES, INC. (Santa Clara, California)
ASSIGNEE(S)
INVENTOR(S) SeyedMohammad SEYEDZADEHDELCHEH (Bellevue, Washington);  Steven RAASCH (Austin, Texas);  Sergey BLAGODUROV (Bellevue, Washington)
ABSTRACT Data are serially communicated over an interconnect between an encoder and a decoder. The encoder includes a first training unit to count a frequency of symbol values in symbol blocks of a set of N number of symbol blocks in an epoch. A circular shift unit of the encoder stores a set of most-recently-used (MRU) amplitude values. An XOR unit is coupled to the first training unit and the first circular shift unit as inputs and to the interconnect as output. A transmitter is coupled to the encoder XOR unit and the interconnect and thereby contemporaneously sends symbols and trains on the symbols. In a system, a device includes a receiver and decoder that receive, from the encoder, symbols over the interconnect. The decoder includes its own training unit for decoding the transmitted symbols.
FILED Thursday, April 30, 2020
APPL NO 16/863149
CURRENT CPC
Electric Digital Data Processing
G06F 13/4027 (20130101) Original (OR) Class
G06F 13/4282 (20130101)

Coding; Decoding; Code Conversion in General
H03M 7/30 (20130101)
H03M 9/00 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210342958 Dobrzynski et al.
FUNDED BY
Department of Energy (DOE)
Argonne National Laboratory (ANL)
UChicago Argonne, LLC (UCHICAGO)
APPLICANT(S) UCHICAGO ARGONNE, LLC (Chicago, Illinois)
ASSIGNEE(S) UCHICAGO ARGONNE, LLC (Chicago, Illinois)
INVENTOR(S) Daniel S. Dobrzynski (Forest Park, Illinois);  Jason D. Harper (Plainfield, Illinois)
ABSTRACT A charging management system includes a network interface, a memory, and a processing circuit including a processor. The processing circuit is configured to determine monetary information related to an energy price, determine an electrical vehicle (EV) power limit PLIM for a total amount of EVs in an EV charging network, transmit the monetary information to two or more agents, each of the two or more agents associated with an EV in the EV charging network, receive, from each of the two or more agents, a bid including: an agent monetary value, a desired charging rate PD, and a charging interval, and allow the EVs associated with the two or more agents to be charged based on each of the bids.
FILED Thursday, April 30, 2020
APPL NO 16/863958
CURRENT CPC
Propulsion of Electrically-propelled Vehicles; Supplying Electric Power for Auxiliary Equipment of Electrically-propelled Vehicles; Electrodynamic Brake Systems for Vehicles in General; Magnetic Suspension or Levitation for Vehicles; Monitoring Operating Variables of Electrically-propelled Vehicles; Electric Safety Devices for Electrically-propelled Vehicles
B60L 53/62 (20190201)
B60L 53/665 (20190201)

Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for
G06Q 10/06312 (20130101)
G06Q 20/145 (20130101)
G06Q 30/08 (20130101)
G06Q 30/0234 (20130101)
G06Q 40/04 (20130101)
G06Q 50/06 (20130101) Original (OR) Class

Circuit Arrangements or Systems for Supplying or Distributing Electric Power; Systems for Storing Electric Energy
H02J 7/007 (20130101)
VIEW PATENT @ USPTO:  Full Text   PDF 
US 20210343444 Graves
FUNDED BY
Department of Energy (DOE)
National Energy Technology Laboratory (NETL)
National Science Foundation (NSF)
APPLICANT(S) Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona)
ASSIGNEE(S)
INVENTOR(S) William Graves (Tempe, Arizona)
ABSTRACT A method includes accelerating an electron bunch along a direction of propagation to a relativistic energy and partitioning the electron bunch by transmitting the electron bunch through a grating at the relativistic energy. The grating includes a plurality of al