FedInvent™ Patent Applications
Application Details for Thursday, November 04, 2021
This page was updated on Friday, November 05, 2021 at 11:03 AM GMT
Department of Health and Human Services (HHS)
| US 20210337804 | Roeder et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ABSTRACT | Polymer coatings and surfaces are disclosed with antimicrobial properties. The antimicrobial action is provided by high surface area materials contained within the coating or surface. The high surface area materials may contain photocatalysts that create reactive oxygen species upon exposure to visible light or transition metals that create reactive oxygen species upon exposure to hydrogen peroxide. The high surface area materials may also sorb disinfecting liquids and desorb them over time to provide disinfection. |
| FILED | Wednesday, June 09, 2021 |
| APPL NO | 17/343723 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 25/10 (20130101) A01N 59/06 (20130101) A01N 59/20 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338092 | Akbari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yama Akbari (Irvine, California); Robert H. Wilson (Irvine, California); Christian Crouzet (Irvine, California); Thomas Milner (Irvine, California); Bernard Choi (Irvine, California) |
| ABSTRACT | A portable device for quantitative measurement of tissue autoregulation and neurovascular coupling via portable measurement of blood flow, oxygenation, metabolism, and/or EEG signals and methods for using said device. The device may comprise a body and a plurality of legs pivotably attached to the body. The plurality of legs may comprise at least one reference electrode leg and at least one measurement electrode leg for electrical measurement, and an optical detection fiber leg and at least one optical source fiber leg for optical blood flow, oxygenation, and metabolism measurement. The present invention is additionally directed to a portable device for blood flow measurement and therapeutic photobiomodulation. The device may comprise a body and a plurality of legs. The plurality of legs may comprise at least one optical detection fiber leg and at least one optical source fiber leg, and at least one leg for therapeutic photobiomodulation. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/377123 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0075 (20130101) A61B 5/0261 (20130101) Original (OR) Class A61B 5/6801 (20130101) A61B 5/14553 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338121 | ZAND et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SURGISENSE CORPORATION (Bethesda, Maryland) |
| ASSIGNEE(S) | SURGISENSE CORPORATION (BETHESDA, Maryland) |
| INVENTOR(S) | Jason M. ZAND (Washington, District of Columbia); Gregory S. FISCHER (Jamaica Plain, Massachusetts) |
| ABSTRACT | A surgical instrument may be configured to sense a light re-emitting probe to resolve tissue oxygenation, the surgical instrument including: an optical emitter configured to excite the light re-emitting probe within an absorption band of the light re-emitting probe; an optical detector configured to receive the re-emitted light from the probe; and a signal processor configured to resolve the tissue oxygenation based on the received light. The surgical instrument can be a surgical stapler anvil or a flexible substrate having a tissue interfacing surface. Further, a monitoring device may be configured to map oxygenation of a tissue containing a light re-emitting probe, the monitoring device including: an optical emitter configured to excite the light re-emitting probe; at least one optical detector configured to receive the re-emitted light from the probe; and a signal processor that is configured to resolve the tissue oxygenation at multiple points to generate an oxygen map. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375735 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/01 (20130101) A61B 5/0059 (20130101) A61B 5/1459 (20130101) A61B 5/4836 (20130101) A61B 5/6847 (20130101) A61B 5/14552 (20130101) A61B 5/14556 (20130101) Original (OR) Class A61B 17/068 (20130101) A61B 17/1155 (20130101) A61B 17/07207 (20130101) Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/007 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338140 | AMIR |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | San Diego State University (SDSU) Foundation, dba San Diego State University Research Foundation (San Diego, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Nader AMIR (San Diego, California) |
| ABSTRACT | In alternative embodiments, provided are products of manufacture, including devices and integrated systems, and methods, for reducing error-related negativity (ERN) and anxiety, and for treating or ameliorating Anxiety Disorders such as Generalized Anxiety Disorder (GAD) or Social Anxiety Disorder (SAD) and obsessive-compulsive disorder (OCD). |
| FILED | Thursday, November 12, 2020 |
| APPL NO | 17/096368 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/31 (20210101) A61B 5/38 (20210101) A61B 5/055 (20130101) A61B 5/165 (20130101) A61B 5/291 (20210101) A61B 5/297 (20210101) A61B 5/315 (20210101) A61B 5/372 (20210101) A61B 5/375 (20210101) Original (OR) Class A61B 5/378 (20210101) A61B 5/384 (20210101) A61B 5/386 (20210101) A61B 5/398 (20210101) A61B 5/486 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338195 | Reiche et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF UTAH RESEARCH FOUNDATION (Salt Lake City, Utah) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Christopher F. Reiche (Salt Lake City, Utah); Navid Farhoudi (Salt Lake City, Utah); Florian Solzbacher (Salt Lake City, Utah); Jules J. Magda (Salt Lake City, Utah) |
| ABSTRACT | Microresonator structures including a top polymer film layer, a bottom polymer film layer, and a smart hydrogel structure sandwiched between the polymer film layers. An ultrasound resonator cavity having a resonance frequency is defined between the top and bottom polymer layers, and the smart hydrogel structure is configured to provide a change in height to the ultrasound resonator cavity due to volumetric expansion or contraction of the smart hydrogel structure, in response to interaction of the smart hydrogel structure with one or more predefined analytes in an in vivo or other environment. Related methods of use for determining the presence or concentration of a given target analyte, as well as methods of fabricating such microresonator structures are also described. |
| FILED | Friday, July 02, 2021 |
| APPL NO | 17/366743 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 8/481 (20130101) A61B 8/0841 (20130101) Original (OR) Class A61B 90/39 (20160201) A61B 2090/3929 (20160201) Preparations for Medical, Dental, or Toilet Purposes A61K 49/226 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338205 | Greenleaf et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Mayo Foundation for Medical Education and Research (Rochester, Minnesota) |
| ASSIGNEE(S) | |
| INVENTOR(S) | James F. Greenleaf (Rochester, Minnesota); Shigao Chen (Rochester, Minnesota); Pengfei Song (Champaign, Illinois); Armando Manduca (Rochester, Minnesota) |
| ABSTRACT | Systems and methods for performing shear wave elastography using push and/or detection ultrasound beams that are generated by subsets of the available number of transducer elements in an ultrasound transducer. These techniques provide several advantages over currently available approaches to shear wave elastography, including the ability to use a standard, low frame rate ultrasound imaging system and the ability to measure shear wave speed throughout the entire field-of-view rather than only those regions where the push beams are not generated. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/372182 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 8/08 (20130101) A61B 8/485 (20130101) Original (OR) Class A61B 8/4488 (20130101) A61B 8/4494 (20130101) A61B 8/5223 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 29/07 (20130101) G01N 29/262 (20130101) G01N 2291/011 (20130101) G01N 2291/0422 (20130101) G01N 2291/02475 (20130101) G01N 2291/02827 (20130101) Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/5209 (20130101) G01S 7/52022 (20130101) G01S 7/52042 (20130101) G01S 15/8915 (20130101) G01S 15/8927 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338383 | TAPALTSYAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF CENTRAL OKLAHOMA (Edmond, Oklahoma) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Vagan TAPALTSYAN (El Cerrito, California); Morshed KHANDAKER (Edmond, Oklahoma); Shahram RIAHINEZHAD (Fort Lee, New Jersey); Rami Mohanad Mahdi ALKHALEELI (Edmond, Oklahoma); Niyaf Nidhal Kadhem ALKADHEM (Edmond, Oklahoma) |
| ABSTRACT | The present invention enables modification of an intraosseous implant device that is not only biologically non-inert, but can stimulate bone and vascular growth; decrease localized inflammation; and fight local infections. The method of the present invention provides a fiber with any of the following modifications: (1) Nanofiber with PDGF, (2) Nanofiber with PDGF+BMP2, and (3) Nanofiber with BMP2 and Ag. Nanofiber can be modified with other growth factors that have been shown to improve bone growth and maturation—BMP and PDGF being the most common. Nanofiber can be applied on the surface of the implant in several ways. First, a spiral micro-notching can be applied on the implant in the same direction as the threads with the nanofibers embedded into the notches. Second, the entire surface of the implant may be coated with a mesh of nanofibers. Third, it can be a combination of both embedding and notching. |
| FILED | Tuesday, July 13, 2021 |
| APPL NO | 17/374700 |
| CURRENT CPC | Dentistry; Apparatus or Methods for Oral or Dental Hygiene A61C 8/0006 (20130101) Original (OR) Class A61C 8/0013 (20130101) A61C 8/0016 (20130101) A61C 8/0022 (20130101) A61C 13/0018 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 6/891 (20200101) A61K 6/898 (20200101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338408 | MacEwan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington University (St. Louis, Missouri) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Matthew R. MacEwan (St. Louis, Missouri); Jingwei Xie (St. Louis, Missouri); Zack Ray (St. Louis, Missouri); Younan Xia (St. Louis, Missouri) |
| ABSTRACT | A multi-laminar electrospun nanofiber scaffold for use in repairing a defect in a tissue substrate is provided. The scaffold includes a first layer formed by a first plurality of electrospun polymeric fibers, and a second layer formed by a second plurality of electrospun polymeric fibers. The second layer is combined with the first layer. A first portion of the scaffold includes a higher density of fibers than a second portion of the scaffold, and the first portion has a higher tensile strength than the second portion. The scaffold is configured to degrade via hydrolysis after at least one of a predetermined time or an environmental condition. The scaffold is configured to be applied to the tissue substrate containing the defect, and is sufficiently flexible to facilitate application of the scaffold to uneven surfaces of the tissue substrate, and to enable movement of the scaffold by the tissue substrate. |
| FILED | Friday, June 25, 2021 |
| APPL NO | 17/358463 |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/02 (20130101) Original (OR) Class A61F 2/0063 (20130101) A61F 2/105 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 15/22 (20130101) A61L 15/42 (20130101) A61L 27/14 (20130101) A61L 27/50 (20130101) Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 48/05 (20190201) B29C 48/142 (20190201) Apparatus for Enzymology or Microbiology; C12M 25/14 (20130101) Mechanical Methods or Apparatus in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons D01D 5/0076 (20130101) D01D 5/0092 (20130101) Making Textile Fabrics, e.g From Fibres or Filamentary Material; Fabrics Made by Such Processes or Apparatus, e.g Felts, Non-woven Fabrics; Cotton-wool; Wadding D04H 1/728 (20130101) D04H 3/016 (20130101) D04H 3/073 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338569 | VARMA et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PHI THERAPEUTICS, INC. (San Francisco, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yug VARMA (San Francisco, California); Nancy VAN PROOYEN (San Francisco, California) |
| ABSTRACT | Provided herein are, inter alia, compositions, systems, and methods for preventing or treating acne. Included are compositions, combinations, systems, and methods comprising at least one Propionibacterium acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier. Also included are compositions, combinations, and systems comprising a Propionibacterium acnes bacteriophage and an enzyme. Methods for preventing or treating acne are also provided. |
| FILED | Friday, April 20, 2018 |
| APPL NO | 16/606158 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 8/22 (20130101) A61K 8/23 (20130101) A61K 8/062 (20130101) A61K 8/064 (20130101) A61K 8/66 (20130101) A61K 8/99 (20130101) Original (OR) Class A61K 8/347 (20130101) A61K 8/368 (20130101) A61K 8/671 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 17/10 (20180101) Specific Use of Cosmetics or Similar Toilet Preparations A61Q 19/00 (20130101) Enzymes C12Y 105/01001 (20130101) C12Y 111/01 (20130101) C12Y 304/21062 (20130101) C12Y 304/21064 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338577 | Freedman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Benjamin Ross Freedman (Brookline, Massachusetts); Oktay R. Uzun (Boston, Massachusetts); David J. Mooney (Sudbury, Massachusetts); Nadja M. Maldonado Luna (Cambridge, Massachusetts) |
| ABSTRACT | The present invention is directed to a biodegradable tough adhesive material comprising an interpenetrating networks (IPN) hydrogel comprising a first polymer network and a second polymer network, wherein the first polymer network comprises a first polymer covalently crosslinked with a biodegradable covalent crosslinker and the second polymer network comprises a second polymer crosslinked with ionic or physical crosslinks; a high density primary amine polymer; and a coupling agent. The present invention also provides methods preparing and using the biodegradable tough adhesive material. |
| FILED | Friday, October 11, 2019 |
| APPL NO | 17/283412 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/06 (20130101) Original (OR) Class A61K 47/32 (20130101) A61K 47/34 (20130101) A61K 47/36 (20130101) A61K 47/6903 (20170801) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 24/0031 (20130101) A61L 24/043 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338579 | GAO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Jinming GAO (Dallas, Texas); Tongyi HUANG (Dallas, Texas); Qiang FENG (Allen, Texas); Baran SUMER (Dallas, Texas) |
| ABSTRACT | Described herein are therapeutic pH responsive compositions comprising a block copolymer and a therapeutic agent useful for the treatment of cancer. |
| FILED | Monday, April 26, 2021 |
| APPL NO | 17/239742 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/1075 (20130101) Original (OR) Class A61K 31/519 (20130101) A61K 31/5025 (20130101) A61K 45/06 (20130101) A61K 47/32 (20130101) A61K 47/34 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338585 | Bloembergen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GreenMark Biomedical Inc. (East Lansing, Michigan) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Steven Bloembergen (Okemos, Michigan); Ian J. McLennan (Burlington, Canada); Nathan Jones (Hamilton, Canada); Ryan Wagner (Kitchener, Canada); Aareet Mahadevan (Waterloo, Canada); Abdel Rahman Elsayed (Waterloo, Canada); Juewen Liu (Kitchener, Canada) |
| ABSTRACT | A delivery device for an active agent comprises nanoparticles based on a biopolymer such as starch. The delivery device may also be in the form of an aptamer-biopolymer-active agent conjugate wherein the aptamer targets the device for the treatment of specific disorders. The nanoparticles may be made by applying a high shear force in the presence of a crosslinker. The particles may be predominantly in the range of 50-150 nm and form a colloidal dispersion of crosslinked hydrogel particles in water. The biopolymer may be functionalized. The aptamer may be conjugated directly to the cross-linked biopolymers. The active agent may be a drug useful for the treatment of cancer. The delivery device survives for a period of time in the body sufficient to allow for the sustained release of a drug and for the transportation and uptake of the conjugate into targeted cells. However, the biopolymer is biocompatible and resorbable. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376837 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/145 (20130101) Original (OR) Class A61K 9/1676 (20130101) A61K 9/5161 (20130101) A61K 31/704 (20130101) A61K 47/36 (20130101) A61K 47/549 (20170801) A61K 47/6939 (20170801) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Polysaccharides; Derivatives Thereof C08B 31/003 (20130101) C08B 31/185 (20130101) C08B 33/00 (20130101) C08B 35/00 (20130101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/773 (20130101) Y10S 977/906 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/2982 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338593 | Ferrari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| ASSIGNEE(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| INVENTOR(S) | Mauro Ferrari (Houston, Texas); Ennio Tasciotti (Houston, Texas); Jason Sakamoto (Houston, Texas) |
| ABSTRACT | Multistage delivery vehicles are disclosed which include a first stage particle and a second stage particle. The first stage particle is a micro or nanoparticle that contains the second stage particle. The second stage particle includes an active agent, such as a therapeutic agent or an imaging agent. The multistage delivery vehicle allows sequential overcoming or bypassing of biological barriers. The multistage delivery vehicle is administered as a part of a composition that includes a plurality of the vehicles. Methods of making the multistage delivery vehicles are also provided. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368401 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/50 (20130101) Original (OR) Class A61K 9/51 (20130101) A61K 9/127 (20130101) A61K 9/1271 (20130101) A61K 31/165 (20130101) A61K 31/704 (20130101) A61K 31/7088 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338615 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Memorial Sloan Kettering Cancer Center (New York, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ming Li (New York, New York); Min Peng (New York, New York); Na Yin (New York, New York) |
| ABSTRACT | Provided are methods for treating or preventing T cell-mediated diseases or disorders by administering an inhibitor of acetyl-CoA production, such as an inhibitor of lactate dehydrogenase A or an inhibitor of ATP-citrate lyase. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/372272 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/0053 (20130101) A61K 31/10 (20130101) A61K 31/192 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 37/06 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338624 | Vockley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Gerard Vockley (Pittsburgh, Pennsylvania); Al-Walid A. Mohsen (Pittsburgh, Pennsylvania) |
| ABSTRACT | Methods of treating propionic acidemia (PA), methylmalonic acidemia (MMA) and fatty acid oxidation disorders are described. The methods include administering an anaplerotic agent that can directly enter the tricarboxylic acid cycle, such as a succinate derivative or pro-drug, for example trisuccinylglycerol (TSG). Methods of restoring tricarboxylic acid (TCA) cycle function in a cell deficient for propionyl-CoA carboxylase (PCC) or methylmalonyl-CoA mutase (MUT) by contacting the cell with a succinate derivative or pro-drug, such as TSG, are also described. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369268 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/225 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 3/00 (20180101) Acyclic or Carbocyclic Compounds C07C 69/66 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338628 | Lopez-Mejias et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vilmali Lopez-Mejias (San Juan, Puerto Rico); Jeaninna P. Flores Bello (San Juan, Puerto Rico); Israel Rodriguez Rodriguez (San Juan, Puerto Rico); Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Vilmali Lopez-Mejias (San Juan, Puerto Rico); Jeaninna P. Flores Bello (San Juan, Puerto Rico); Israel Rodriguez Rodriguez (San Juan, Puerto Rico); Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico) |
| ABSTRACT | A series of pharmaceutical metal complexes (pMCs) were produced and characterized using the mast cell stabilizer, cromolyn, and bioactive metal ions (Zn+2, Mg+2, and Ca+2). Three novel pMCs, Cromolyn-Zn, Cromolyn-Mg, and Cromolyn-Ca were formed through reactions under controlled temperature and pH conditions. TGA demonstrated that these metal complexes showed an enhanced thermal stability due to the strong coordination with the ligand, cromolyn. PXRD data indicates a high degree of crystallinity as well as a unique packing arrangement for each pMCs. SEM analysis showed materials with well-defined morphologies while EDS presented elemental evidence for the unique composition of each pMCs. The crystal structure for these materials was elucidated through SCXRD, and a variety of binding modes and packing motifs were found within each respective metal complex. Only 2D structures were achieved under the conditions studied. Dissolution studies show high stability and slow degradation for the metal complexes, while a higher dissolution was observed for the drug compound in PBS. Neither CS nor the pMCs dissolved significantly in FaSSGF at 37° C. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307208 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/315 (20130101) Original (OR) Class A61K 31/352 (20130101) General Methods of Organic Chemistry; Apparatus Therefor C07B 2200/13 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338630 | Basile et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Trustees of Indiana University (Bloomington, Indiana) |
| ASSIGNEE(S) | The Trustees of Indiana University (Bloomington, Indiana) |
| INVENTOR(S) | David P. Basile (Indianapolis, Indiana); Purvi Mehrotra (Carmel, Indiana); Michael S. Sturek (Indianapolis, Indiana) |
| ABSTRACT | Disclosed are methods to treat a renal disorder in a mammal in need thereof by administering to the mammal in need of treatment an effective amount of a store operated calcium entry (SOCE) inhibitor or a pharmaceutically acceptable salt thereof. |
| FILED | Friday, October 04, 2019 |
| APPL NO | 17/282401 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/352 (20130101) Original (OR) Class A61K 31/433 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 13/12 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338632 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Rong Li (San Antonio, Texas); Bin Yuan (San Antonio, Texas); Tyler Curiel (San Antonio, Texas) |
| ABSTRACT | The present invention provides methods and compositions for treating or preventing breast cancer with S-equol. The method and compositions are particularly suited to treating triple-negative breast cancer. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/372352 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/353 (20130101) Original (OR) Class A61K 39/3955 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/2818 (20130101) C07K 16/2827 (20130101) C07K 2317/21 (20130101) C07K 2317/24 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338659 | CHEN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE CHILDREN'S MEDICAL CENTER CORPORATION (Boston, Massachusetts) |
| ASSIGNEE(S) | THE CHILDREN'S MEDICAL CENTER CORPORATION (Boston, Massachusetts) |
| INVENTOR(S) | Bing CHEN (Boston, Massachusetts); Gary FREY (Boston, Massachusetts); Tianshu XIAO (Boston, Massachusetts) |
| ABSTRACT | Described herein are compounds that inhibits the membrane proximal external region (MPER) of a viral envelope (Env), as well as and compositions thereof. Further provided herein are methods for treating or preventing a viral infection comprises administering to a subject in need thereof an agent or compound that inhibits the MPER of a viral Env. In certain embodiments, the viral infection is an HIV infection. |
| FILED | Friday, July 26, 2019 |
| APPL NO | 17/262540 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/4709 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338670 | Carlucci et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York University (New York, New York); Memorial Sloan Kettering Cancer Center (New York, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Giuseppe Carlucci (New York, New York); Thomas Reiner (New York, New York) |
| ABSTRACT | Disclosed are compounds having the following structure: CDK-L-(X)n, where CDK is a CDK4/6 inhibitor group, L is a linking group, X is a radiolabel or hydrogen, n is 1, 2, 3, 4, or 5, and when there are a plurality of X groups, at least one X is a radiolabel. Also described are methods of making and using the compounds. The compounds may be used in PET imaging to quantify CDK4/6 expression in cancers and to treat cancer patients exhibiting tumors which express CDK4/6. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/246291 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/506 (20130101) Original (OR) Class Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/57415 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338676 | Kwiek et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Duke University (Durham, North Carolina); Ohio State Innovation Foundation (Columbus, Ohio) |
| ASSIGNEE(S) | Duke University (Durham, North Carolina); Ohio State Innovation Foundation (Columbus, Ohio) |
| INVENTOR(S) | Jesse Kwiek (Worthington, Ohio); Timothy Haystead (Chapel Hill, North Carolina); Philip Hughes (Chapel Hill, North Carolina); Yazan Alwarawrah (Durham, North Carolina) |
| ABSTRACT | The present disclosure relates to a method for inhibiting Fatty Acid. Synthase (FASN) with, a FASN inhibitor, methods for treating cancer and viral infections with a FASN inhibitor, and compounds and compositions inhibiting FASN, |
| FILED | Friday, April 02, 2021 |
| APPL NO | 17/221649 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/519 (20130101) Original (OR) Class A61K 31/555 (20130101) A61K 33/243 (20190101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/18 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338680 | Martemyanov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Scripps Research Institute (La Jolla, California) |
| ASSIGNEE(S) | The Scripps Research Institute (La Jolla, California) |
| INVENTOR(S) | Kirill Martemyanov (Jupiter, Florida); Brock Grill (Lake Worth, Florida) |
| ABSTRACT | The present invention provides methods for modulating opioid receptor mediated analgesic effect, e.g., promoting or enhancing analgesia in subjects in need of pain relief. Also provided in the invention are methods for ameliorating or suppressing withdrawal symptoms in subjects with chronic opioid use. These methods of the invention entail administering to the subjects in need of treatment a therapeutically effective amount of a GPR139 antagonist compound. The invention further provides methods for identifying novel compounds that can be useful for modulating opioid receptor mediated analgesic effect. |
| FILED | Tuesday, October 15, 2019 |
| APPL NO | 17/286187 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/095 (20130101) A61K 31/166 (20130101) A61K 31/175 (20130101) A61K 31/397 (20130101) A61K 31/519 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 25/36 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338685 | JENNINGS et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Griffith University (Nathan, Queensland, Australia); Research Institute at Nationwide Children's Hospital (Columbus, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Michael P. JENNINGS (Nathan, Queensland, Australia); Jennifer L. EDWARDS (Columbus, Ohio); Christopher J. DAY (Nathan, Queensland, Australia); Johnson MAK (Nathan, Queensland, Australia) |
| ABSTRACT | The present disclosure relates to the use of ligands of complement receptor 3, including ligands of the I domain of the alpha subunit of this receptor, in methods, compositions and articles/devices for inhibiting the interaction of pathogens to a complement receptor 3-expressing cell and for treating or inhibiting the development of infections caused by such pathogens. |
| FILED | Monday, September 30, 2019 |
| APPL NO | 17/280603 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0014 (20130101) A61K 9/0039 (20130101) A61K 31/55 (20130101) Original (OR) Class A61K 31/196 (20130101) A61K 31/198 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/04 (20180101) A61P 31/18 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338705 | Adair et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE PENN STATE RESEARCH FOUNDATION (University Park, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | James H. Adair (State College, Pennsylvania); Gail L. Matters (Hummelstown, Pennsylvania); Welley S. Loc (University Park, Pennsylvania); Amra Tabakovic (State College, Pennsylvania); Mark Kester (Harrisburg, Pennsylvania); Sam Linton (Hershey, Pennsylvania); Christopher McGovern (Harrisburg, Pennsylvania); Xiaomeng Tang (University Park, Pennsylvania); Gary A. Clawson (Bethesda, Maryland); Jill P. Smith (Washington, District of Columbia); Tye Deering (Charlottesville, Virginia) |
| ABSTRACT | Method of producing nanoparticle of drug and imaging agents are provided. The phosphorylated encapsulated drugs and imaging agents could be encapsulated at therapeutic levels, were encapsulated at higher amounts. The CPSNPs were more effective in treating cancer, in reducing cancer proliferation, arresting cancer cell growth than when not in the form of a CPSNP, and showed efficacious treatment of cancer cells at far lower dosage than free molecules. Calcium phosphosilicate and phosphate nanoparticles are disclosed and their method of use. The methods and nanoparticles are particularly efficacious where CPSNPs were used to encapsulate 5-FU metabolites such as FdUMP and gemcitabine metabolites. |
| FILED | Wednesday, June 09, 2021 |
| APPL NO | 17/303878 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5115 (20130101) A61K 9/5146 (20130101) A61K 31/513 (20130101) A61K 31/7068 (20130101) A61K 31/7072 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/115 (20130101) C12N 2310/16 (20130101) C12N 2320/32 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338723 | Fehniger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington University (St. Louis, Missouri) |
| ASSIGNEE(S) | Washington University (St. Louis, Missouri) |
| INVENTOR(S) | Todd Fehniger (St. Louis, Missouri); Melissa Berrien-Elliott (St. Louis, Missouri) |
| ABSTRACT | Among the various aspects of the present disclosure are provisions for methods of, and compositions for, increasing NK cell anti-tumor response, screening donors, and predicting response to NK cell therapy. |
| FILED | Thursday, January 21, 2021 |
| APPL NO | 17/154889 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) Original (OR) Class A61K 38/19 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/30 (20130101) C07K 16/2815 (20130101) C07K 2319/02 (20130101) C07K 2319/03 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0646 (20130101) C12N 15/1138 (20130101) C12N 2310/11 (20130101) C12N 2310/14 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5005 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338731 | Riley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | James L. Riley (Downingtown, Pennsylvania); James A. Hoxie (Berwyn, Pennsylvania); George J. Leslie (Philadelphia, Pennsylvania); Max W. Richardson (Philadelphia, Pennsylvania) |
| ABSTRACT | The present invention relates to engineered cells expressing a fusion protein comprising a peptide fusion inhibitor and a CXCR4 protein that lacks signaling activity. Also provided are methods of suppressing, inhibiting, preventing or treating a HIV infection in a subject in need thereof using the engineered cells. |
| FILED | Monday, May 03, 2021 |
| APPL NO | 17/306613 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/18 (20180101) Peptides C07K 14/162 (20130101) C07K 14/7158 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/62 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338738 | KING et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | Michael R. KING (Nashville, Tennessee); Nidhi JYOTSANA (Nashville, Tennessee) |
| ABSTRACT | The present disclosure describes engineering of cells to co-express TNF-Related Apoptosis-Inducing Ligand (TRAIL) and Decoy Receptor 1 (DcR1). The expression of DcR1 results in competition for TRAIL binding to Death Receptors 4 and 5, thereby protecting the engineered cells from TRAIL-induced apoptosis. Such cells will exhibit longer survival such as when used in cell-based therapies for cancer. |
| FILED | Monday, May 03, 2021 |
| APPL NO | 17/306153 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0014 (20130101) A61K 9/0019 (20130101) A61K 35/28 (20130101) Original (OR) Class A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 14/70575 (20130101) C07K 14/70578 (20130101) C07K 2319/50 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0647 (20130101) C12N 2510/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338754 | THORNE |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Stephen H. THORNE (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Stephen H. THORNE (Pittsburgh, Pennsylvania) |
| ABSTRACT | This disclosure relates to modified viruses, e.g., oncolytic vaccinia viruses, which have been modified to contain an exogenous nucleic acid that codes for a variant HMGB1 protein. It provides, at least in part, that vaccinia viruses modified to contain nucleic acid encoding variant HMGB1 and that express a variant HMGB1 or a fragment thereof can achieve a synergistic effect in combination with chemotherapy. Further, this disclosure provides for oncolytic vaccinia viruses and methods of using them in the treatment of various cancers. |
| FILED | Tuesday, June 01, 2021 |
| APPL NO | 17/335430 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7088 (20130101) A61K 35/768 (20130101) Original (OR) Class A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 14/4702 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 2710/24132 (20130101) Technologies for Adaptation to Climate Change Y02A 50/30 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338772 | Kachlany et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rutgers, The State University of New Jersey (New Brunswick, New Jersey); Actinobac Biomed, Inc. (Princeton, New Jersey) |
| ASSIGNEE(S) | Rutgers, The State University of New Jersey (New Brunswick, New Jersey); Actinobac Biomed, Inc. (Princeton, New Jersey) |
| INVENTOR(S) | Scott C. Kachlany (Bridgewater, New Jersey); Benjamin A. Belinka, JR. (Newtown, Connecticut) |
| ABSTRACT | This invention concerns compositions and methods of treating or diagnosing inflammatory disorders and other disorders, as well as compositions and methods of treating HIV. |
| FILED | Thursday, April 01, 2021 |
| APPL NO | 17/220573 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/164 (20130101) Original (OR) Class A61K 39/3955 (20130101) A61K 45/06 (20130101) A61K 47/6849 (20170801) A61K 51/1093 (20130101) A61K 2039/55544 (20130101) Peptides C07K 16/2896 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5052 (20130101) G01N 33/56911 (20130101) G01N 33/56988 (20130101) G01N 2800/26 (20130101) G01N 2800/52 (20130101) G01N 2800/709 (20130101) G01N 2800/7095 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338776 | FIKRIG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | YALE UNIVERSITY (New Haven, Connecticut) |
| ASSIGNEE(S) | YALE UNIVERSITY (New Haven, Connecticut) |
| INVENTOR(S) | Erol FIKRIG (Guilford, Connecticut); Ryuta URAKI (New Haven, Connecticut); Andrew HASTINGS (Hamden, Connecticut) |
| ABSTRACT | The invention is directed to compositions comprising mosquito (e.g., Aedes aegypti) salivary polypeptides and related methods for preventing and/or treating mosquito-borne viral infections such as infections caused by flaviviruses and alphaviruses. The flavivirus that is prevented or treated includes Zika virus, West Nile virus, Dengue virus, tick-borne encephalitis virus, and yellow fever virus. |
| FILED | Thursday, September 05, 2019 |
| APPL NO | 17/274086 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/1767 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338783 | Goodman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio) |
| ASSIGNEE(S) | RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio) |
| INVENTOR(S) | Steven David Goodman (Columbus, Ohio); Lauren Opremcak Bakaletz (Columbus, Ohio) |
| ABSTRACT | Provided herein are methods to inhibit or disrupt a bio film comprising contacting the bio film with an agent that cleaves the Holliday junction (HJ) structure in the bio film. |
| FILED | Friday, October 04, 2019 |
| APPL NO | 17/282341 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/54 (20130101) A61K 38/465 (20130101) Original (OR) Class Enzymes C12Y 301/22004 (20130101) C12Y 306/04012 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338787 | Rothenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CHILDREN'S HOSPITAL MEDICAL CENTER (Cincinnati, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Marc E. Rothenberg (Cincinnati, Ohio); Nurit P. Azouz (Cincinnati, Ohio) |
| ABSTRACT | The present invention relates to methods for treating or preventing a coronavirus infection with serine protease inhibitors targeted against the host protease, transmembrane serine protease 2 (TMPRSS2), and related compositions and methods. |
| FILED | Wednesday, April 28, 2021 |
| APPL NO | 17/302247 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/245 (20130101) A61K 38/57 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/14 (20180101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/502 (20130101) G01N 33/573 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338789 | Khan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); Whitehead Institute for Biomedical Research (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Omar F. Khan (Cambridge, Massachusetts); Jasdave S. Chahal (Arlington, Massachusetts); Daniel G. Anderson (Cambridge, Massachusetts); Hidde Ploegh (Brookline, Massachusetts); Robert S. Langer (Cambridge, Massachusetts); Tyler E. Jacks (Cambridge, Massachusetts); David A. Canner (Cambridge, Massachusetts) |
| ABSTRACT | Compositions and methods for modified dendrimer nanoparticle (“MDNP”) delivery of therapeutic, prophylactic and/or diagnostic agent such as large repRNA molecules to the cells of a subject have been developed. MDNPs efficiently drive proliferation of antigen-specific T cells against intracellular antigen, and potentiate antigen-specific antibody responses. MDNPs can be multiplexed to deliver two or more different repRNAs to modify expression kinetics of encoded antigens and to simultaneous deliver repRNAs and mRNAs including the same UTR elements that promote expression of encoded antigens. |
| FILED | Wednesday, March 10, 2021 |
| APPL NO | 17/198037 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/5146 (20130101) A61K 31/713 (20130101) A61K 39/002 (20130101) A61K 39/0012 (20130101) Original (OR) Class A61K 39/12 (20130101) A61K 39/145 (20130101) A61K 48/00 (20130101) A61K 2039/53 (20130101) A61K 2039/70 (20130101) A61K 2039/645 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/87 (20130101) C12N 15/88 (20130101) C12N 2740/16234 (20130101) C12N 2760/14134 (20130101) C12N 2760/16034 (20130101) C12N 2770/24134 (20130101) C12N 2770/36143 (20130101) Technologies for Adaptation to Climate Change Y02A 50/30 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338790 | Okada |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Hideho Okada (Pittsburgh, Pennsylvania) |
| ABSTRACT | Provided herein are interleukin-13 receptor α2 peptide-based brain cancer vaccines and methods for treating and vaccinating against brain cancer comprising administering to patients in need thereof interleukin-13 receptor α2 peptide-based brain cancer vaccines. Also provided herein are regimens comprising interleukin-13 receptor α2 peptides and at least one additional peptide and/or immunostimulant. |
| FILED | Wednesday, December 02, 2020 |
| APPL NO | 17/109463 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 38/17 (20130101) A61K 38/177 (20130101) A61K 38/1709 (20130101) A61K 38/2086 (20130101) A61K 39/39 (20130101) A61K 39/00115 (20180801) A61K 39/001119 (20180801) Original (OR) Class A61K 39/001122 (20180801) A61K 39/001153 (20180801) A61K 39/001192 (20180801) A61K 2039/70 (20130101) A61K 2039/572 (20130101) A61K 2039/5154 (20130101) A61K 2039/55566 (20130101) A61K 2039/55583 (20130101) Peptides C07K 14/705 (20130101) C07K 14/4703 (20130101) C07K 14/4705 (20130101) C07K 14/7155 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338793 | Peabody et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNM RAINFOREST INNOVATIONS (Albuquerque, New Mexico) |
| ASSIGNEE(S) | |
| INVENTOR(S) | David S. Peabody (Albuquerque, New Mexico); Bryce Chackerian (Albuquerque, New Mexico) |
| ABSTRACT | The present invention relates to a system and method for controlling peptide display valency on virus-like particles (VLPs), especially including MS2 VLPs. In this method, large amounts of wild-type and low quantities of single-chain dimer coat proteins may be produced from a single RNA. Valency is controlled in immunogen (vaccine) production by providing a system that allows the production of large amounts of wild-type and low quantities of single-chain dimer coating proteins from a single RNA, allowing facile adjustment of display valency levels on VLPs, especially MS2 VLPS over a wide range, from few than one-on average- to as many as ninety per particle. This facilitates the production of immunogens and vaccines, including VLPs exhibiting low valency. Nucleic acid constructs useful in the expression of virus-like particles are disclosed, comprised of a coat polypeptide of MS2 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates MS2 niRNA. Nucleic acid constructs are also disclosed which are useful in the expression of virus-like particles comprised of a coat polypeptide of PP7 modified by insertion of a heterologous peptide, wherein the heterologous peptide is displayed on the virus-like particle and encapsidates PP7 mRNA. |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/244255 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/07 (20130101) A61K 39/12 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 15/1037 (20130101) Combinatorial Chemistry; Libraries, e.g Chemical Libraries C40B 40/02 (20130101) C40B 40/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338795 | Hinrichs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| ASSIGNEE(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| INVENTOR(S) | Christian S. Hinrichs (Bethesda, Maryland); Steven A. Rosenberg (Potomac, Maryland) |
| ABSTRACT | Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed. |
| FILED | Monday, July 12, 2021 |
| APPL NO | 17/372927 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) A61K 39/12 (20130101) Original (OR) Class A61K 2039/5158 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0636 (20130101) C12N 5/0638 (20130101) C12N 7/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338796 | Hinrichs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| ASSIGNEE(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| INVENTOR(S) | Christian S. Hinrichs (Bethesda, Maryland); Steven A. Rosenberg (Potomac, Maryland) |
| ABSTRACT | Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed. |
| FILED | Monday, July 12, 2021 |
| APPL NO | 17/373093 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) A61K 39/12 (20130101) Original (OR) Class A61K 2039/5158 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0636 (20130101) C12N 5/0638 (20130101) C12N 7/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338797 | Hinrichs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| ASSIGNEE(S) | The United States of America,as represented by the Secretary,Department of Health and Human Services (Bethesda, Maryland) |
| INVENTOR(S) | Christian S. Hinrichs (Bethesda, Maryland); Steven A. Rosenberg (Potomac, Maryland) |
| ABSTRACT | Disclosed are methods of preparing an isolated population of human papillomavirus (HPV)-specific T cells comprise dividing an HPV-positive tumor sample into multiple fragments; separately culturing the multiple fragments; obtaining T cells from the cultured multiple fragments; testing the T cells for specific autologous HPV-positive tumor recognition; selecting the T cells that exhibit specific autologous HPV-positive tumor recognition; and expanding the number of selected T cells to produce a population of HPV-specific T cells for adoptive cell therapy. Related methods of treating or preventing cancer using the T cells are also disclosed. |
| FILED | Monday, July 12, 2021 |
| APPL NO | 17/373130 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) A61K 39/12 (20130101) Original (OR) Class A61K 2039/5158 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0636 (20130101) C12N 5/0638 (20130101) C12N 7/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338800 | PICKER et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | OREGON HEALTH and SCIENCE UNIVERSITY (Portland, Oregon) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Louis J. PICKER (Portland, Oregon); Michael A. JARVIS (Portland, Oregon); Jay A. NELSON (Lake Oswego, Oregon) |
| ABSTRACT | Particular aspects provide for use of the β-herpesvirus Cytomegalovirus (CMV: e.g., RhCMV and HCMV) as a uniquely evolved “vector” for safely initiating and indefinitely maintaining high level cellular and humoral immune responses (against, e.g., HIV, SIV, TB, etc.). Particular aspects provide a method for treatment or prevention of, e.g., HIV, SIV or TB, comprising infection of a subject in need thereof with at least one recombinant CMV-based vector (e.g., HCMV or RhCMV) comprising an expressible HIV/SIV/TB antigen or a variant or fusion protein thereof. In particular embodiments of the method, infection is of an immunocompetent, HCMV or RhCMV seropositive subject. Additional aspects provide for RhCMV- and HCMV-based vaccine vectors, and versions thereof with suicide or safety means. Further aspects provide pharmaceutical compositions comprising the inventive CMV-based vaccine vectors. |
| FILED | Monday, November 09, 2020 |
| APPL NO | 17/092941 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/04 (20130101) A61K 39/12 (20130101) A61K 39/21 (20130101) Original (OR) Class A61K 2039/53 (20130101) Peptides C07K 14/005 (20130101) C07K 16/088 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 15/86 (20130101) C12N 2740/16034 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338804 | Parks et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International AIDS Vaccine Initiative Inc. (New York, New York); Merck Sharp and Dohme Corp. (Rahway, New Jersey) |
| ASSIGNEE(S) | International AIDS Vaccine Initiative Inc. (New York, New York); Merck Sharp and Dohme Corp. (Rahway, New Jersey) |
| INVENTOR(S) | Christopher Lee Parks (Boonton, New Jersey); Maoli Yuan (Brooklyn, New York); Mark Feinberg (New York, New York); Amy Espeseth (Chalfont, Pennsylvania); Andrew J. Bett (West Point, Pennsylvania) |
| ABSTRACT | The present disclosure provides Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) vaccines, recombinant vesicular stomatitis virus (VSV) vectors encoding the SARS-CoV-2 spike (S) protein or an immunogenic variant thereof, recombinant replicable VSV particles having a SARS-CoV-2 S protein or an immunogenic variant thereof on the surface of the particles, and immunogenic recombinant proteins comprising a SARS-CoV-2 S protein or a variant thereof. Immunogenic compositions comprising the SARS-CoV-2 vaccines, the recombinant VSV vectors, the recombinant replicable VSV particles and/or the immunogenic recombinant proteins may be used for inducing an immune response to the SARS-CoV-2, preventing infection by the SARS-CoV-2, vaccinating against the SARS-CoV-2 and/or producing adaptive mutants of the recombinant replicable VSV particles. |
| FILED | Friday, February 19, 2021 |
| APPL NO | 17/180147 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/215 (20130101) Original (OR) Class A61K 2039/542 (20130101) Peptides C07K 14/145 (20130101) C07K 14/165 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 15/86 (20130101) C12N 2760/20234 (20130101) C12N 2760/20243 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338811 | Bigner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Duke University (Durham, North Carolina); THE GOVERNMENT OF THE UNITED STATES AS REPRESENTED BY THE SECRETARY OF HEALTH AND HUMAN SERVICES (Rockville, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Darell Bigner (Mebane, North Carolina); Vidyalakshmi Chandramohan (Durham, North Carolina); Smita Nair (Durham, North Carolina); Matthias Gromeier (Durham, North Carolina); Xuhui Bao (Durham, North Carolina); Ira H. Pastan (Potomac, Maryland) |
| ABSTRACT | Regional, tumor-targeted, cytotoxic therapy, such as D2C7-immunotoxin (D2C7-IT), not only specifically target and destroy tumor cells, but in the process initiate immune events that promote an in situ vaccine effect. The antitumor effects are amplified by immune checkpoint blockade which engenders a long-term systemic immune response that effectively eliminates all tumor cells. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376319 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/164 (20130101) A61K 39/395 (20130101) Original (OR) Class A61K 39/3955 (20130101) A61K 47/6829 (20170801) A61K 47/6849 (20170801) A61K 47/6851 (20170801) A61K 2039/505 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/30 (20130101) C07K 16/2818 (20130101) C07K 16/2863 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338815 | Quijano et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Elias Quijano (Durham, Connecticut); Adele Ricciardi (New Haven, Connecticut); Raman Bahal (Glastonbury, Connecticut); Audrey Turchick (Chelmsford, Massachusetts); Nicholas Economos (New Haven, Connecticut); W. Mark Saltzman (New Haven, Connecticut); Peter Glazer (Guilford, Connecticut) |
| ABSTRACT | Compositions for improved gene editing and methods of use thereof are disclosed. In a preferred method, gene editing involves use of a cell-penetrating anti-DNA antibody, such as 3E10, as a potentiating agent to enhance gene editing by nucleases and triplex forming oligonucleotides. Genomic modification occurs at a higher frequency when cells are contacted with the potentiating agent and nuclease or triplex forming oligonucleotide, as compared to the absence of the potentiating agent. The methods are suitable for both ex vivo and in vivo approaches to gene editing and are useful for treating a subject with a genetic disease or disorder. Nanoparticle compositions for intracellular delivery of the gene editing compositions are provided and are particularly advantageous for use with in vivo applications. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/272151 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/5153 (20130101) A61K 31/7088 (20130101) A61K 35/28 (20130101) A61K 38/14 (20130101) A61K 38/465 (20130101) A61K 39/39533 (20130101) Original (OR) Class A61K 2039/545 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 7/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338816 | Vorp et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Pittsburgh - Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania); Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | |
| INVENTOR(S) | David A. Vorp (Pittsburgh, Pennsylvania); Aneesh Krishna Ramaswamy (Pittsburgh, Pennsylvania); Justin Sol Weinbaum (Allison Park, Pennsylvania); Kory James Blose (Pittsburgh, Pennsylvania); Timothy Kwang-Joon Chung (Pittsburgh, Pennsylvania); Trevor Kickliter (Allentown, Pennsylvania); Yogev Baruch (Pittsburgh, Pennsylvania); John A. Curci (Nashville, Tennessee) |
| ABSTRACT | A method of delivering cells to a target tissue is provided comprising depositing a hydrogel pre-gel comprising magnetic particle-loaded cells to the target tissue and, prior to or during gelation of the hydrogel, drawing the magnetic particle-loaded cells to the tissue with a magnetic field, followed by gelation of the hydrogel to lock the cells in place on the tissue. The cells may be mesenchymal stem cells, such as adipose-derived mesenchymal stem cells, and the target tissue may be adventitial tissue of an aneurysm in a blood vessel. Also provided are devices useful in the method. |
| FILED | Friday, October 18, 2019 |
| APPL NO | 17/286210 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/28 (20130101) A61K 41/00 (20130101) Original (OR) Class Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/1407 (20130101) A61M 25/0127 (20130101) A61M 25/09041 (20130101) A61M 2202/09 (20130101) A61M 2205/0288 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0667 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338821 | Abdullah et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Trustees of the University of Pennsylvania (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Kalil G Abdullah (Philadelphia, Pennsylvania); Leo L Wang (Philadelphia, Pennsylvania); Jason Alan Burdick (Philadelphia, Pennsylvania) |
| ABSTRACT | Provided are compositions comprising a hydrogel formed from a cyclodextrin-modified branched polyethyleneimine and an adamantane-modified, eight-arm polyethyelene glycol. The hydrogel may contain an active agent, and can provide sustained release the active agent. Beneficial delivery characteristics may result from electrostatic or lipophilic interactions between the active agent and the hydrogel. Delivery of valproic acid from the present compositions can provide treatment following surgical resection of glioblastoma brain tumors. |
| FILED | Monday, July 12, 2021 |
| APPL NO | 17/372773 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/06 (20130101) A61K 9/19 (20130101) A61K 9/0085 (20130101) A61K 31/19 (20130101) A61K 31/7105 (20130101) A61K 47/34 (20130101) Original (OR) Class A61K 47/40 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338823 | Lencer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Children's Medical Center Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | Children's Medical Center Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Wayne I. Lencer (Jamaica Plain, Massachusetts); Daniel JF Chinnapen (Quincy, Massachusetts); Richard I. Duclos (Quincy, Massachusetts) |
| ABSTRACT | Provided herein, in some aspects, are delivery vehicles comprising a ceramide and an agent to be delivered attached to the ceramide. In some embodiments, the ceramide does not comprise a fatty acid (i.e., is a sphingosine). In some embodiments, the ceramide comprises a fatty acid. In some embodiments, the ceramide is a glycoceramide. In some embodiments, the agent is attached to the ceramide covalently (e.g., via a linker). In some embodiments, the agent to be delivered is a therapeutic agent. The ceramide is able to deliver the agent to a cell or to a cellular compartment, as well as across the musical barrier. In some embodiments, agents delivered using the ceramide described herein exhibit longer half-life, compared to agents delivered alone. Methods of delivering a therapeutic agent to a subject for treating a disease using the ceramide delivery vehicle are also provided. |
| FILED | Friday, April 12, 2019 |
| APPL NO | 17/046753 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/1617 (20130101) A61K 31/7105 (20130101) A61K 47/65 (20170801) A61K 47/543 (20170801) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338825 | Gray et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts); PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| ASSIGNEE(S) | DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts); PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| INVENTOR(S) | Nathanael S. Gray (Boston, Massachusetts); Tinghu Zhang (Boston, Massachusetts); Priscilla Yang (Boston, Massachusetts); Melissanne De Wispelaere (Cambridge, Massachusetts); Guangyan Du (Jamaica Plain, Massachusetts) |
| ABSTRACT | Disclosed are bifunctional compounds (degraders) that target hepatitis C virus (HCV) NS3/4A for degradation. Also disclosed are pharmaceutical compositions containing the degraders and methods of using the compounds to treat HCV infection and HCV-associated diseases or disorders. |
| FILED | Thursday, September 26, 2019 |
| APPL NO | 17/280075 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/55 (20170801) Original (OR) Class A61K 47/545 (20170801) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338833 | IRVINE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Darrell J. IRVINE (Arlington, Massachusetts); Karl Dane WITTRUP (Boston, Massachusetts); Naveen MEHTA (Somerville, Massachusetts); Leyuan MA (Brookline, Massachusetts); Benjamin COSSETTE (Durham, North Carolina) |
| ABSTRACT | The disclosure features chimeric antigen receptor (CAR) ligands, methods for making the same, and immunomodulatory compositions comprising the CAR ligands. The disclosure also features compositions and methods of using the immunomodulatory compositions, for example, to stimulate activation of CAR expressing cells. |
| FILED | Monday, March 01, 2021 |
| APPL NO | 17/188813 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) A61K 39/001112 (20180801) A61K 47/543 (20170801) A61K 47/6889 (20170801) Original (OR) Class Peptides C07K 16/2803 (20130101) C07K 2317/92 (20130101) C07K 2317/622 (20130101) C07K 2319/74 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338835 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Cincinnati (Cincinnati, Ohio); The Board of Trustees of the University of Illinois (Chicago, Illinois); The University of Chicago (Chicago, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jianjun Chen (Cincinnati, Ohio); Seungpyo Hong (Naperville, Illinois); Xi Jiang (Cincinnati, Ohio); Zejuan Li (Chicago, Illinois) |
| ABSTRACT | A nanoparticle delivery system designed for sustained delivery of microRNA-150 (miR-150) to FLT3-overexpressing acute myeloid leukemia (AML) cells, the delivery system comprising poly(amidoamine) (PAMAM) dendrimers complexed with miR-150, wherein at least one dendrimer is surface-functionalized with a ligand specific for FLT3 receptor, and methods for treating AML characterized by FLT3-overexpression are provided. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375548 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/551 (20130101) A61K 31/7105 (20130101) A61K 38/19 (20130101) A61K 45/06 (20130101) A61K 47/62 (20170801) A61K 47/595 (20170801) A61K 47/6935 (20170801) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/02 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1138 (20130101) C12N 2310/141 (20130101) C12N 2310/321 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338840 | GAO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Jinming GAO (Plano, Texas); Gang HUANG (Plano, Texas); Tian ZHAO (Irving, Texas); Xinpeng MA (Dallas, Texas); Yiguang WANG (Dallas, Texas); Yang LI (Dallas, Texas); Baran D. SUMER (Dallas, Texas) |
| ABSTRACT | The present disclosure relates to polymers which contain a hydrophobic and hydrophilic segment which is sensitive to pH. In some aspects, the polymers form a micelle which is sensitive to pH and results in a change in fluorescence based upon the particular pH. In some aspects, the disclosure also provides methods of using the polymers for the imaging of cellular or extracellular environment or delivering a drug. |
| FILED | Thursday, April 15, 2021 |
| APPL NO | 17/231922 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 49/0021 (20130101) A61K 49/0032 (20130101) A61K 49/0041 (20130101) A61K 49/0054 (20130101) Original (OR) Class Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 8/30 (20130101) C08F 8/32 (20130101) C08F 8/34 (20130101) C08F 8/42 (20130101) Organic Dyes or Closely-related Compounds for Producing Dyes; Mordants; Lakes C09B 69/103 (20130101) C09B 69/105 (20130101) C09B 69/106 (20130101) C09B 69/109 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/643 (20130101) G01N 21/6428 (20130101) G01N 21/6456 (20130101) G01N 33/84 (20130101) G01N 33/582 (20130101) G01N 2021/6432 (20130101) G01N 2021/6439 (20130101) G01N 2021/6441 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338846 | Pomper et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Johns Hopkins University (Baltimore, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Martin G. Pomper (Baltimore, Maryland); Ronnie C. Mease (Fairfax, Virginia); Sangeeta Ray (Ellicott City, Maryland); IL Minn (Ellicott City, Maryland) |
| ABSTRACT | Methods for co-injection of a non-radioactive PSMA inhibitor, referred to herein as a competing inhibitor (CI), with a radiolabeled PSMA inhibitor are disclosed. This combination reduces the uptake of the radiotracer in non-target organs, including the kidneys and lacrimal glands, with only a modest reduction in tumor uptake. |
| FILED | Tuesday, July 30, 2019 |
| APPL NO | 17/264222 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/27 (20130101) A61K 31/198 (20130101) A61K 31/455 (20130101) A61K 51/0402 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339011 | ALBECK et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel); NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel); NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| INVENTOR(S) | Dan David ALBECK (Givat Shmuel, Israel); Claus Peter RICHTER (Skokie, Illinois) |
| ABSTRACT | Disclosed is a method of selecting stimulations for a cochlear implant or an auditory implant. The method may include: capturing an acoustical signal; dividing the acoustical signal into a plurality of frequency bands; determining a mean acoustical energy for each frequency band; for each frequency band: comparing the mean acoustical energy with the mean acoustical energy determined for neighboring frequency bands; merging neighboring frequency bands having a difference between the mean acoustical energies that is less than an acoustical energy threshold value; selecting one or more types of stimulation to be applied to one or more locations in a cochlea or along an auditory nerve based on bandwidths of each frequency band. The one or more types of stimulation may be selected from: electrical stimulation, optical stimulation and opto-electrical stimulation, and the one or more locations in cochlea or along the auditory nerve may correspond to specific frequencies of the acoustical signal. |
| FILED | Wednesday, August 14, 2019 |
| APPL NO | 17/268400 |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/0541 (20130101) Original (OR) Class A61N 1/36038 (20170801) A61N 1/36171 (20130101) A61N 1/36175 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339035 | Carter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Iowa Research Foundation (Iowa City, Iowa) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Calvin S. Carter (Iowa City, Iowa); Sunny C. Huang (Iowa City, Iowa); Michael J. Miller (Iowa City, Iowa); Charles C. Searby (Iowa City, Iowa); Val C. Sheffield (Iowa City, Iowa) |
| ABSTRACT | An example of subject may deliver a therapy by delivering energy to tissue. The system may comprise a magnetic field system and an electric field system. The magnetic field system may be configured to provide a magnetic field in a first direction to the tissue. The magnetic field system may include at least one magnetic field source to produce the magnetic field. The magnetic field produced by the at least one magnetic field source may include a magnetic field produced by at least one of a permanent magnet, a temporary magnet or electric current flow through a conductor. The electric field system may be configured to provide an electric field in a second direction to the tissue. The electric field system may include at least one electric field source to provide the electric field and the second direction is non-parallel to the first direction. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369784 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/14532 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/10 (20130101) A61N 1/40 (20130101) A61N 1/0484 (20130101) A61N 1/36002 (20170801) A61N 1/36034 (20170801) A61N 2/00 (20130101) A61N 2/002 (20130101) Original (OR) Class A61N 2/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339242 | Yang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (FARMINGTON, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ruiguo Yang (Lincoln, Nebraska); Arian Jaberi (Lincoln, Nebraska); Amir Monemian Esfahani (Lincoln, Nebraska); Ali Tamayol (Providence, Rhode Island) |
| ABSTRACT | Microfluidic gradient generators that can create robust platforms that can not only be used for creating co-cultures of cells with various ratios, but also can simultaneously generate gradients of mechanical and chemical stresses. A chip utilizes microchambers embedded within channels to provide space for 3D cell culture and exposes these cells to gradients of mechanical shear stress and a chemical treatment. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245381 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5025 (20130101) Original (OR) Class B01L 2300/087 (20130101) B01L 2300/0877 (20130101) B01L 2300/0883 (20130101) Apparatus for Enzymology or Microbiology; C12M 41/46 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/34 (20130101) C12N 2513/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339244 | GANGULI et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois); Mayo Foundation for Medical Education and Research (Rochester, Minnesota) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Anurup GANGULI (Urbana, Illinois); Rashid BASHIR (Champaign, Illinois); Panagiotis Z. ANASTASIADIS (Jacksonville, Florida); George VASMATZIS (Oronoco, Minnesota) |
| ABSTRACT | Provided are methods and related devices for preparing a cell and tissue culture, including a hanging drop culture. Microwells are specially loaded with cell mixtures using a removable reservoir and forcing cells into the underlying microwells. The removable reservoir is removed and the cells partitioned into the individual microwells and covered by an immiscible layer of fluid. The microwells and immiscible layer is inverted and the cells in the microwells cultured. The microwells may have shape-controlling elements to control the three-dimensional shape of the culture. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307150 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/0262 (20130101) B01L 3/5088 (20130101) Original (OR) Class B01L 9/523 (20130101) B01L 2400/024 (20130101) Apparatus for Enzymology or Microbiology; C12M 21/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339316 | Xia et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington (Seattle, Washington) |
| ASSIGNEE(S) | University of Washington (Seattle, Washington) |
| INVENTOR(S) | Younan Xia (St. Louis, Missouri); Sang-Hyuk Im (Pohang-Shi, South Korea); Yugang Sun (Naperville, Illinois); Yun Tack Lee (Seattle, Washington); Benjamin Wiley (Boston, Massachusetts) |
| ABSTRACT | Methods for producing silver nanostructures with improved dimensional control, yield, purity, monodispersed, and scale of synthesis. |
| FILED | Wednesday, March 17, 2021 |
| APPL NO | 17/249885 |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 1/0025 (20130101) B22F 9/24 (20130101) Original (OR) Class B22F 2001/0037 (20130101) B22F 2009/245 (20130101) B22F 2301/255 (20130101) B22F 2304/05 (20130101) B22F 2998/10 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Production and Refining of Metals; Pretreatment of Raw Materials C22B 11/04 (20130101) Alloys C22C 5/02 (20130101) C22C 5/06 (20130101) Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 7/00 (20130101) C30B 29/02 (20130101) C30B 29/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340100 | SHAPIRO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | David J. SHAPIRO (Urbana, Illinois); Paul J. HERGENROTHER (Champaign, Illinois); Matthew W. BOUDREAU (Urbana, Illinois) |
| ABSTRACT | A set of small molecules ERα biomodulators that kill therapy-resistant ERα positive breast, ovarian, and endometrial cancer cells. These small molecules have increased therapeutic potential because of an increased ability to kill therapy-resistant breast cancer cells compared to BHPI and other conventional therapies (endocrine therapies, tamoxifen and fulvestrant/ICI). The new compounds do not only inhibit proliferation of the cancer cells but actually kills them, which prevents reactivation of tumors years later. |
| FILED | Thursday, May 13, 2021 |
| APPL NO | 17/319447 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Heterocyclic Compounds C07D 209/34 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340102 | Hatcher et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts) |
| ASSIGNEE(S) | DANA-FARBER CANCER INSTITUTE, INC. (Boston, Massachusetts) |
| INVENTOR(S) | John Hatcher (Marlborough, Massachusetts); Nathanael S. Gray (Boston, Massachusetts); Hwangeun Choi (Seoul, South Korea); Pasi Janne (Needham, Massachusetts); Tinghu Zhang (Brookline, Massachusetts) |
| ABSTRACT | The application relates to a compound of Formula (I): which modulates the activity of ALK or SRPK, a pharmaceutical composition comprising the compound, and a method of treating or preventing a disease in which ALK or SRPK plays a role. |
| FILED | Tuesday, June 15, 2021 |
| APPL NO | 17/348394 |
| CURRENT CPC | Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Heterocyclic Compounds C07D 209/80 (20130101) Original (OR) Class C07D 401/04 (20130101) C07D 401/14 (20130101) C07D 403/04 (20130101) C07D 405/04 (20130101) C07D 405/14 (20130101) C07D 409/04 (20130101) C07D 413/04 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/12 (20130101) C12N 9/96 (20130101) Enzymes C12Y 207/11001 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340116 | CHANG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Notre Dame du Lac (South Bend, Indiana) |
| ASSIGNEE(S) | University of Notre Dame du Lac (South Bend, Indiana) |
| INVENTOR(S) | Mayland CHANG (Granger, Indiana); Shahriar MOBASHERY (Granger, Indiana); Derong DING (South Bend, Indiana) |
| ABSTRACT | Clostridium difficile infection (CDI) is a public health threat that results in 14,000 annual deaths in the United States. Challenges involve the production of CDI spores that can remain dormant for years and the production of toxins that damage the gut. Current therapies for CDI include vancomycin and metronidazole, but neither inhibits spore or toxin production. Thus, recurrence of infection occurs in 25% of patients and there are no antibiotics that are effective for multiple recurrences. We describe oxadiazoles with activity against C. difficile, including the highly virulent NAP1/027 strain with increased production of toxins A and B, as well as the additional binary toxin. Oxadiazole 2 is poorly absorbed, thus advantageously achieving high concentrations in the gut. The compound targets peptidoglycan synthesis and inhibits vegetative cells, spores, and toxin production. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376522 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/12 (20130101) A61K 9/0014 (20130101) A61K 9/0019 (20130101) A61K 9/2027 (20130101) A61K 9/2059 (20130101) A61K 9/4866 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/04 (20180101) Heterocyclic Compounds C07D 271/06 (20130101) Original (OR) Class C07D 413/04 (20130101) C07D 413/10 (20130101) C07D 413/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340117 | CHANG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Notre Dame du Lac (South Bend, Indiana) |
| ASSIGNEE(S) | University of Notre Dame du Lac (South Bend, Indiana) |
| INVENTOR(S) | Mayland CHANG (Granger, Indiana); Shahriar MOBASHERY (Granger, Indiana); Derong DING (South Bend, Indiana) |
| ABSTRACT | Clostridium difficile infection (CDI) is a public health threat that results in 14,000 annual deaths in the United States. Challenges involve the production of CDI spores that can remain dormant for years and the production of toxins that damage the gut. Current therapies for CDI include vancomycin and metronidazole, but neither inhibits spore or toxin production. Thus, recurrence of infection occurs in 25% of patients and there are no antibiotics that are effective for multiple recurrences. We describe oxadiazoles with activity against C. difficile, including the highly virulent NAP1/027 strain with increased production of toxins A and B, as well as the additional binary toxin. Oxadiazole 2 is poorly absorbed, thus advantageously achieving high concentrations in the gut. The compound targets peptidoglycan synthesis and inhibits vegetative cells, spores, and toxin production. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376558 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/12 (20130101) A61K 9/0014 (20130101) A61K 9/0019 (20130101) A61K 9/2027 (20130101) A61K 9/2059 (20130101) A61K 9/4866 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/04 (20180101) Heterocyclic Compounds C07D 271/06 (20130101) Original (OR) Class C07D 413/04 (20130101) C07D 413/10 (20130101) C07D 413/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340126 | Debnath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York Blood Center, Inc. (New York, New York); The United States of America, As Represented By The Secretary, Department of Health and Human Servic (Bethesda, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Asim Kumar Debnath (New York, New York); Francesca Curreli (New, New York); Peter D. Kwong (Bethesda, Maryland); Young Do Kwon (Bethesda, Maryland) |
| ABSTRACT | Substituted phenylpyrrolecarboxamide compounds such as those represented by Formula A can be used in the treatment of HIV infection and related conditions. |
| FILED | Friday, July 02, 2021 |
| APPL NO | 17/366920 |
| CURRENT CPC | Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/18 (20180101) Heterocyclic Compounds C07D 207/34 (20130101) C07D 241/04 (20130101) C07D 401/14 (20130101) C07D 403/12 (20130101) Original (OR) Class C07D 405/14 (20130101) C07D 413/12 (20130101) C07D 417/12 (20130101) C07D 417/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340140 | GRAY et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DANA-FARBER CANCER INSTITUTE, INC. (BOSTON, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | NATHANAEL S. GRAY (BOSTON, Massachusetts); BAISHAN JIANG (WATERTOWN, Massachusetts); TINGHU ZHANG (BROOKLINE, Massachusetts); ERIC WANG (JAMAICA PLAIN, Massachusetts); NICHOLAS KWIATKOWSKI (AUBURN, Massachusetts); YANKE LIANG (BROOKLINE, Massachusetts); CALLA M. OLSON (BROOKLINE, Massachusetts) |
| ABSTRACT | The present application provides bifunctional compounds, or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, which act as protein degradation inducing moieties for cyclin-dependent kinase 4 (CDK4) and/or cyclin-dependent kinase 6 (CDK6). The present application also relates to methods for the targeted degradation of CDK4 and/or CDK6 through the use of the bifunctional compounds that link a ubiquitin ligase-binding moiety to a ligand that is capable of binding to CDK4 and/or |
| FILED | Tuesday, July 23, 2019 |
| APPL NO | 17/262032 |
| CURRENT CPC | Heterocyclic Compounds C07D 401/14 (20130101) C07D 471/04 (20130101) Original (OR) Class C07D 487/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340155 | Donaldson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Marquette University (Milwaukee, Wisconsin); Concordia University, Inc. (Mequon, Wisconsin); UWM Research Foundation, Inc. (Milwaukee, Wisconsin) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William A. Donaldson (Milwaukee, Wisconsin); Daniel S. Sem (New Berlin, Wisconsin); Karyn M. Frick (Milwaukee, Wisconsin) |
| ABSTRACT | Disclosed are substituted (4′-hydroxylphenyl)cycloalkane compounds and substituted (4′-hydroxylphenyl)cycloalkene compounds and there use as selective agonists of the estrogen receptor beta isoform (ERβ). The disclosed compounds may be formulated as pharmaceutical compositions and administered for treating diseases associated with ER activity, such as neurological, psychiatric, and/or cell proliferative diseases and disorders as well as for enhancing memory consolidation in subjects in need thereof. |
| FILED | Friday, March 30, 2018 |
| APPL NO | 16/498122 |
| CURRENT CPC | Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 25/28 (20180101) Acyclic or Carbocyclic Compounds C07C 35/21 (20130101) Heterocyclic Compounds C07D 493/08 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340181 | Tang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Yng Tang (Davis, California); Julie L. Sutcliffe (Davis, California) |
| ABSTRACT | The present invention provides peptides and peptide-conjugates that bind to αvβ6 integrin. The peptide-conjugates can be used for a variety of imaging and therapeutic applications. Methods of use and peptide optimization are also provided herein. |
| FILED | Wednesday, March 03, 2021 |
| APPL NO | 17/191223 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 45/06 (20130101) A61K 47/60 (20170801) A61K 51/082 (20130101) Peptides C07K 7/08 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340188 | Franchini et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Department of Health and Human Servic (Bethesda, Maryland); New York University (New York, New York) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary, Department of Health and Human Servic (Bethesda, Maryland); New York University (New York, New York) |
| INVENTOR(S) | Genoveffa Franchini (Washington, District of Columbia); Timothy Cardozo (New York, New York); Manuel Becerra-Flores (Brooklyn, New York); Isabela Silva de Castro (Bethesda, Maryland); Giacomo Gorini (Bethesda, Maryland); Massimiliano Bissa (Bethesda, Maryland) |
| ABSTRACT | Embodiments of recombinant HIV-1 gp120 proteins that contain a V1 deletion are disclosed. Also provided are gp140, gp145, and gp160 proteins containing the V1 deletion, as well as HIV-1 Env ectodomain trimers containing protomers containing the V1 deletion. Nucleic acid molecules encoding these proteins are also provided. In several embodiments, the disclosed recombinant HIV-1 proteins and/or nucleic acid molecules can be used to generate an immune response to HIV-1 in a subject, for example, to treat or prevent an HIV-1 infection in the subject. |
| FILED | Monday, October 21, 2019 |
| APPL NO | 17/285453 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 39/21 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/18 (20180101) Peptides C07K 14/162 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/86 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56988 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340191 | BEERNINK |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Children's Hospital and Research Center at Oakland (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Peter T. BEERNINK (Walnut Creek, California) |
| ABSTRACT | Variant factor H binding proteins that can elicit antibodies that are bactericidal for at least one strain of Neisseria meningitidis, compositions comprising such proteins, and methods of use of such proteins, are provided. |
| FILED | Friday, April 02, 2021 |
| APPL NO | 17/221646 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/095 (20130101) A61K 2039/55505 (20130101) Peptides C07K 14/22 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340197 | Yeo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (La Jolla, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Eugene Yeo (La Jolla, California); Kristopher Brannan (La Jolla, California) |
| ABSTRACT | Described herein are compositions, systems, methods, and kits utilizing CRISPR-Cas protein fusions comprising a guide nucleotide sequence-programmable RNA binding protein and a RNA pseudouridylation modification protein. The compositions, systems, methods, and kits described herein are useful to modulate RNA pseudouridylation. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/272018 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 48/00 (20130101) Peptides C07K 14/47 (20130101) Original (OR) Class C07K 2319/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/11 (20130101) C12N 2800/80 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340198 | Goodman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio) |
| ASSIGNEE(S) | RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL (Columbus, Ohio) |
| INVENTOR(S) | Steven David Goodman (Columbus, Ohio); Lauren Opremcak Bakaletz (Columbus, Ohio) |
| ABSTRACT | Provided herein are derivatives of HMGB1 that have been engineered to possess the same efficacious anti-bio film activity but are smaller and do not induce inflammation. |
| FILED | Friday, October 04, 2019 |
| APPL NO | 17/282354 |
| CURRENT CPC | Peptides C07K 14/47 (20130101) Original (OR) Class C07K 16/1232 (20130101) C07K 2317/76 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340218 | HEDRICK et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | La Jolla Institute for Allergy and Immunology (La Jolla, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Catherine C. HEDRICK (La Jolla, California); Richard HANNA (San Diego, California) |
| ABSTRACT | Disclosed herein are methods of increasing numbers of monocytes to a tumor or cancer metastasis site in a subject. Non-limiting embodiments include administering or using a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist. Also disclosed herein are methods of increasing, stimulating, activating or promoting monocyte migration to or mobilization against a tumor or cancer metastasis in a subject. Non-limiting embodiments include administering a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes; or CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD111b+GR1− (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368706 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/704 (20130101) A61K 35/15 (20130101) A61K 38/195 (20130101) A61K 38/1783 (20130101) A61K 39/3955 (20130101) A61K 45/06 (20130101) A61K 47/02 (20130101) A61K 47/6849 (20170801) A61K 2039/545 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) A61P 35/04 (20180101) Peptides C07K 14/70567 (20130101) Original (OR) Class C07K 16/24 (20130101) C07K 16/2857 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340227 | Hunsperger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Department of Health and Human Service (Rockville, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Elizabeth Anne Hunsperger (Guaynabo, Puerto Rico); Tesfaye Gelanew Taye (San Juan, Puerto Rico) |
| ABSTRACT | The present disclosure relates to polypeptides that specifically bind to Dengue virus non¬structural protein 1, including antibodies and fragments thereof. The antibody or antigen-binding fragment thereof may specifically bind Dengue virus (DENV) serotype 4 and include: a heavy chain variable region that comprises at least one CDR amino acid sequence selected from the group consisting of: SGYNWH, YIH YS GGTN YNPS LKS, RTGTVPFAY, SYVMH, YLNPYNDDTKYNEKFKG, and GPPYALDY. The present disclosure further relates to methods of producing the polypeptides of the present disclosure, methods of diagnosing DENV, and methods of treating a DENV infection. |
| FILED | Thursday, June 22, 2017 |
| APPL NO | 16/310964 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/167 (20130101) Peptides C07K 16/1081 (20130101) Original (OR) Class C07K 2317/14 (20130101) C07K 2317/24 (20130101) C07K 2317/565 (20130101) C07K 2319/02 (20130101) C07K 2319/30 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 15/62 (20130101) C12N 15/79 (20130101) C12N 2710/14041 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/56983 (20130101) G01N 2333/185 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340232 | HWANG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| INVENTOR(S) | Rosa HWANG (Houston, Texas); Liran ZHOU (Houston, Texas); Mason LU (Houston, Texas); Hongmei HUSTER (Houston, Texas); Craig LOGSDON (Houston, Texas); Jeffrey E. LEE (Houston, Texas) |
| ABSTRACT | Provided herein are methods and reagents for increasing chemosensitivity to chemotherapy and immunotherapy in cancer patients. Methods of treating cancer are provided, comprising administering to a patient in need thereof an effective amount of an DKK3-neutralizing agent, such as a DKK3-neutralizing antibody provided herein. The methods can further include administering an effective amount of chemotherapy or immunotherapy to said patient. |
| FILED | Tuesday, October 15, 2019 |
| APPL NO | 17/285470 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7068 (20130101) A61K 39/3955 (20130101) A61K 45/06 (20130101) A61K 47/6843 (20170801) A61K 2039/505 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/18 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340257 | Abou-Elkacem et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lotfi Abou-Elkacem (Houston, Texas); Juergen Karl Willmann (Stanford, California); Benjamin J. Hackel (Edina, Minnesota); Lawrence Arthur Stern (Monrovia, California); Patrick Samuel Lown (Minneapolis, Minnesota); Amelie Margarete Marianne Lutz (Stanford, California); Rakesh Kumar Bam (Menlo Park, California); THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California); REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Lotfi Abou-Elkacem (Houston, Texas); Juergen Karl Willmann (Stanford, California); Benjamin J. Hackel (Edina, Minnesota); Lawrence Arthur Stern (Monrovia, California); Patrick Samuel Lown (Minneapolis, Minnesota); Amelie Margarete Marianne Lutz (Stanford, California); Rakesh Kumar Bam (Menlo Park, California) |
| ABSTRACT | Affibody polypeptides that specifically bind to B7-H3 are provided. Exemplary anti-B7-H3 affibodies are provided. The affibody polypeptides specifically recognize and bind to B7-H3 with high affinity. The affibodies can be conjugated to contrast agents, including without limitation microbubbles for contrast-enhanced ultrasound imaging |
| FILED | Thursday, August 22, 2019 |
| APPL NO | 17/267733 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 47/6803 (20170801) A61K 47/6849 (20170801) A61K 49/221 (20130101) A61K 49/223 (20130101) A61K 2039/505 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/2827 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340258 | Ackerman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | TRUSTEES OF DARTMOUTH COLLEGE (Hanover, New Hampshire) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Margaret Ackerman (Lebanon, New Hampshire); Casey Hua (Hanover, New Hampshire); Charles Sentman (Hanover, New Hampshire) |
| ABSTRACT | Provided herein, in some embodiments, are antibodies, antigen-binding antibody fragments, chimeric antigen receptors (CARs) and bispecific T cell engagers (BiTEs) that bind specifically to 137 homolog 6. Also provided herein are methods of using the same and cells comprising the same. |
| FILED | Wednesday, May 12, 2021 |
| APPL NO | 17/318310 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/6803 (20170801) A61K 47/6849 (20170801) A61K 51/1027 (20130101) A61K 51/1093 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 14/7051 (20130101) C07K 14/70517 (20130101) C07K 14/70521 (20130101) C07K 16/468 (20130101) C07K 16/2809 (20130101) C07K 16/2827 (20130101) Original (OR) Class C07K 2317/21 (20130101) C07K 2317/31 (20130101) C07K 2317/56 (20130101) C07K 2317/73 (20130101) C07K 2317/92 (20130101) C07K 2317/622 (20130101) C07K 2319/02 (20130101) C07K 2319/03 (20130101) C07K 2319/033 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340265 | Westlund High et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Karin WESTLUND HIGH (Albuquerque, New Mexico); Ravi VENKATA DURVASULA (Albuquerque, New Mexico); Adinarayana KUNAMNENI (Albuquerque, New Mexico); UNM RAINFOREST INNOVATIONS (Albuquerque, New Mexico) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Karin Westlund High (Albuquerque, New Mexico); Ravi Venkata Durvasula (Albuquerque, New Mexico); Adinarayana Kunamneni (Albuquerque, New Mexico) |
| ABSTRACT | A pharmaceutical composition generally includes a therapeutic antibody, or fragment thereof, and a pharmaceutically acceptable carrier. The therapeutic antibody specifically binds to a target peptide that mediates pain in a subject. The composition may be administered to a subject experiencing pain to at least partially alleviate the pain. |
| FILED | Friday, November 01, 2019 |
| APPL NO | 17/284208 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 2039/505 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 25/02 (20180101) A61P 29/02 (20180101) Peptides C07K 16/2869 (20130101) Original (OR) Class C07K 2317/622 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340279 | Glazer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Peter Glazer (Guilford, Connecticut); Audrey Turchick (Chelmsford, Massachusetts) |
| ABSTRACT | Combination therapies including administering a subject in need thereof a cell-penetrating binding protein, such as an antibody, and an immune checkpoint modulator are provided. Typically, the cell-penetrating binding protein can induce DNA damage or reduce DNA damage repair in an effective amount to activate the innate immunity inflammatory pathway in target cells such as cancer cells or infected cells. For example, in some embodiments, the cell-penetrating binding protein increases induced p21 and/or p27 protein expression, increases accumulation of single-strand DNA in the cytosol, increases phosphorylation of STAT1, or a combination thereof in target cells. The subject can have cancer or an infection and the combination of the cell-penetrating binding protein and the immune checkpoint modulator reduce one or more symptoms of cancer or infection, preferably to a greater degree than administering the subject the same amount of cell-penetrating binding protein alone or the same amount of immune checkpoint modulator alone. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/272124 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 45/06 (20130101) Peptides C07K 16/44 (20130101) Original (OR) Class C07K 16/2818 (20130101) C07K 2317/10 (20130101) C07K 2317/24 (20130101) C07K 2317/33 (20130101) C07K 2317/565 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340280 | Quijano et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Yale University (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Elias Quijano (Durham, Connecticut); Audrey Turchick (Chelmsford, Massachusetts); Peter Glazer (Guilford, Connecticut) |
| ABSTRACT | Compositions for enhanced gene editing and methods of use thereof are. The composition contains a cell-penetrating antibody and a donor oligonucleotide containing a sequence that can correct a mutation in a cell's genome. Preferably, the composition does not contain a nuclease, PNA, or nanoparticle. The compositions are used to modify the genome of a cell by contacting the cell with an effective amount of the composition. Genomic modification occurs at a higher frequency both ex vivo and in vivo, when cells are contacted with the cell-penetrating antibody and donor oligonucleotide as compared to the absence of the cell-penetrating antibody. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/272136 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7088 (20130101) A61K 35/14 (20130101) A61K 47/6937 (20170801) A61K 48/0008 (20130101) A61K 2039/505 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 43/00 (20180101) Peptides C07K 16/44 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/102 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340334 | PORTELA et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Carlos M. PORTELA (Pasadena, California); Daryl Wei Liang YEE (Pasadena, California); Dennis M. KOCHMANN (Pasadena, California); Julia R. GREER (Pasadena, California) |
| ABSTRACT | In an aspect, provided herein are low density materials, including shell-based materials, with three-dimensional architectures formed, in part, via self-assembly processes. Shell-based materials of some embodiments exhibit a combination of ultralow density (e.g., ≤100 mg cm−3 and optionally ≤10 100 mg cm−3) and non-periodic architectures characterized by low defect densities and geometries avoiding stress concentrations. Low density shell based materials of some embodiments have architectures characterized by small curvatures and lack of straight edges providing enhance mechanical response. In some embodiments, for example, the present low density materials, including shell-based materials, providing a combination target mechanical properties including high stiffness-to-density ratios, mechanical resilience and tolerance for deformation. |
| FILED | Friday, September 25, 2020 |
| APPL NO | 17/032539 |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 40/00 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 3/02 (20130101) Original (OR) Class C08J 9/26 (20130101) Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/403 (20130101) C23C 16/45525 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340493 | Easley,, IV et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Georgia Research Foundation, Inc. (Athens, Georgia); Emory University (Atlanta, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Charles A. Easley,, IV (Athens, Georgia); Anthony W.S. Chan (Atlanta, Georgia) |
| ABSTRACT | Compositions and methods for improving embryo development, treating idiopathic male factor infertility, and enabling infertile/sub-fertile/sterile men to father their own genetic offspring are provided. Typically, the methods include administering into a male or female gamete or fertilized embryo an effective amount of a compound that increases bioavailability of a TET protein to improve development of an embryo resulting from fertilization of the female gamete by a male gamete. The compound can be administered into the gamete or embryo before, during, or after fertilization. The compound can be administered by an injection such as intracytoplasmic injection. The compound and the male gamete can be administered in combination by intracytoplasmic sperm injection. Methods of making male gametes, and methods of modifying the genome of a male gamete or embryo using an effective amount of a gene editing composition to correct a gene mutation or anomaly in the genome thereof are also provided. |
| FILED | Thursday, August 01, 2019 |
| APPL NO | 17/265157 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/061 (20130101) C12N 5/0604 (20130101) Original (OR) Class C12N 15/90 (20130101) C12N 2506/02 (20130101) C12N 2506/45 (20130101) C12N 2510/00 (20130101) C12N 2517/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340501 | Lewis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California); The Food and Drug Administration (Silver Spring, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Nathan Lewis (La Jolla, California); Wan-Tien Chiang (La Jolla, California); Montserrat Puig (Silver Spring, Maryland); Yaqin Zhang (Silver Spring, Maryland); Amy Rosenberg (Silver Spring, Maryland) |
| ABSTRACT | A significant interferon (IFN) response is induced following treatment of CHO cells with exogenously-added type I IFN or poly I:C. Treatment of the CHO cells with poly I:C prior to infection limited the cytopathic effect from Vesicular stomatitis virus (VSV), Encephalomyocarditis vims (EMCV), and Reovirus-3 vims (Reo) in a STAT1-dependent manner By knocking out two upstream repressors of STAT1: Gfi1 and Trim 24, the engineered CHO cells exhibited increased resistance to virus contaminations. Thus, omics-guided engineering of mammalian cell culture can be deployed to increase safety in biotherapeutic protein production. |
| FILED | Tuesday, August 27, 2019 |
| APPL NO | 17/270501 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0682 (20130101) Original (OR) Class C12N 2501/24 (20130101) C12N 2501/50 (20130101) C12N 2501/90 (20130101) C12N 2501/998 (20130101) C12N 2501/999 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340516 | CALDWELL |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Augusta University Research Institute, Inc. (Augusta, Georgia); The US Government as Represented by the Department of Veterans Affairs (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ruth CALDWELL (Augusta, Georgia) |
| ABSTRACT | Pathological retinal neovascularization is a common micro-vascular complication in several retinal diseases including retinopathy of prematurity (ROP), diabetic retinopathy, age-related macular degeneration and central vein occlusion. Disclosed herein are compositions and methods useful for the treatment or prevention of retinal neovascularization and related diseases in a subject in need thereof. Exemplary methods include administering a composition including PEGylated arginase 1 to a subject in need thereof to promote reparative angiogenesis and decrease retinal neovascularization in the eye. |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/244385 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 47/60 (20170801) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 27/02 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/78 (20130101) Original (OR) Class Enzymes C12Y 305/03001 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340519 | KING et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF WASHINGTON (Seattle, Washington); UNIVERSITY OF UTAH (Salt Lake City, Utah) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Neil KING (Seattle, Washington); Wesley SUNDQUIST (Salt Lake City, Utah); Joerg VOTTELER (Salt Lake City, Utah); Yang HSIA (Seattle, Washington); David BAKER (Seattle, Washington); Jacob BALE (Seattle, Washington); Marc LAJOIE (Seattle, Washington); Gabriel BUTTERFIELD (Seattle, Washington); Elizabeth GRAY (Seattle, Washington); Daniel STETSON (Seattle, Washington) |
| ABSTRACT | The application discloses multimeric assemblies including multiple oligomeric substructures, where each oligomeric substructure includes multiple proteins that self-interact around at least one axis of rotational symmetry, where each protein includes one or more polypeptide-polypeptide interface (“O interface”); and one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding to one or more proteins in the eukaryotic ESCRT complex (“L domain”); and where the multimeric assembly includes one or more subunits comprising one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), as well as membrane-enveloped versions of the multimeric assemblies. |
| FILED | Wednesday, June 02, 2021 |
| APPL NO | 17/336889 |
| CURRENT CPC | Peptides C07K 14/00 (20130101) C07K 14/435 (20130101) C07K 2319/03 (20130101) C07K 2319/06 (20130101) C07K 2319/735 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/88 (20130101) Original (OR) Class Enzymes C12Y 401/02014 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340524 | IRVINE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Darrell J. IRVINE (Arlington, Massachusetts); Karl Dane WITTRUP (Boston, Massachusetts); Naveen MEHTA (Somerville, Massachusetts); Leyuan MA (Brookline, Massachusetts); Benjamin COSSETTE (Durham, North Carolina) |
| ABSTRACT | The disclosure features chimeric antigen receptor (CAR) ligands, methods for making the same, and immunomodulatory compositions comprising the CAR ligands. The disclosure also features compositions and methods of using the immunomodulatory compositions, for example, to stimulate activation of CAR expressing cells. |
| FILED | Monday, March 01, 2021 |
| APPL NO | 17/188861 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/001112 (20180801) A61K 2039/57 (20130101) A61K 2039/6018 (20130101) A61K 2039/6093 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) A61P 37/04 (20180101) Peptides C07K 7/06 (20130101) C07K 14/7051 (20130101) C07K 14/70521 (20130101) C07K 16/2803 (20130101) C07K 2317/622 (20130101) C07K 2319/03 (20130101) C07K 2319/33 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1037 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340531 | Bunick et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | YALE UNIVERSITY (New Haven, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Christopher Bunick (Cheshire, Connecticut); Sherif Eldirany (Glastonbury, Connecticut); Minh Ho (New Haven, Connecticut) |
| ABSTRACT | The present invention provides compositions and methods for inhibiting intermediate filament tetramerization and formation. |
| FILED | Tuesday, October 08, 2019 |
| APPL NO | 17/283405 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 14/4702 (20130101) C07K 14/4741 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/111 (20130101) Original (OR) Class C12N 15/1093 (20130101) C12N 2310/20 (20170501) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340535 | Khvorova et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF MASSACHUSETTS (Boston, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Anastasia Khvorova (Westborough, Massachusetts); Bruno Miguel da Cruz Godinho (Worcester, Massachusetts); James W. Gilbert (Worcester, Massachusetts) |
| ABSTRACT | This disclosure relates to novel C9ORF72 targeting sequences. Novel sense and antisense dual-targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided. |
| FILED | Friday, March 26, 2021 |
| APPL NO | 17/213887 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/11 (20130101) C12N 2310/314 (20130101) C12N 2310/315 (20130101) C12N 2310/321 (20130101) C12N 2310/322 (20130101) C12N 2310/332 (20130101) C12N 2310/351 (20130101) C12N 2310/3233 (20130101) C12N 2320/30 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340536 | Aishwarya et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | AUM Lifetech, Inc. (Philadelphia, Pennsylvania); The Children's Hospital of Philadelphia (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Veenu Aishwarya (Philadelphia, Pennsylvania); Wayne W. Hancock (Philadelphia, Pennsylvania) |
| ABSTRACT | The present invention is directed to hybrid chimera antisense oligonucleotides including deoxyribonucleotide and 2′-deoxy-2′-fluoro-β-D-arabinonucleotide which binds to a Foxp3 mRNA, and to methods of use thereof. The methods include the use for reducing expression level of Foxp3 gene, increasing anti-tumor activity, and treating cancer in a subject. |
| FILED | Wednesday, September 25, 2019 |
| APPL NO | 17/279542 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7088 (20130101) A61K 45/06 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 5/10 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/11 (20130101) C12N 2310/322 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340537 | Mihailescu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DUQUESNE UNIVERSITY OF THE HOLY SPIRIT (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Mihaela Rita Mihailescu (Pittsburgh, Pennsylvania); Joshua A. Imperatore (Canonsburg, Pennsylvania) |
| ABSTRACT | Provided is an agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229. In some embodiments, the variant is rs2291418. Provided is a method of treating a disease in a subject, comprising: administering a therapeutically effective amount of the agent to the subject. In some embodiments, the disease is Alzheimer's disease, cancer or coronary artery calcification. |
| FILED | Thursday, April 15, 2021 |
| APPL NO | 17/301835 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/322 (20130101) C12N 2310/3181 (20130101) C12N 2320/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340538 | Hou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Jianghui Hou (St. Louis, Missouri); Dale Bjorling (Madison, Wisconsin); Zun-Yi Wang (Madison, Wisconsin) |
| ASSIGNEE(S) | Washington University (St. Louis, Missouri); Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Jianghui Hou (St. Louis, Missouri); Dale Bjorling (Madison, Wisconsin); Zun-Yi Wang (Madison, Wisconsin) |
| ABSTRACT | A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule. |
| FILED | Monday, May 03, 2021 |
| APPL NO | 17/306929 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/59 (20170801) A61K 47/549 (20170801) A61K 47/554 (20170801) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/141 (20130101) C12N 2310/321 (20130101) C12N 2310/3515 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340542 | JAFFREY et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CORNELL UNIVERSITY (Ithaca, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Samie R. JAFFREY (New York, New York); Jacob L. LITKE (New York, New York) |
| ABSTRACT | The present invention relates to a RNA molecule comprising a first ribozyme, a first ligation sequence, an effector molecule, a second ligation sequence, and a second ribozyme. Methods of producing circular RNA molecules and treatment methods are also disclosed. |
| FILED | Saturday, June 23, 2018 |
| APPL NO | 16/625562 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7115 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/63 (20130101) C12N 15/115 (20130101) Original (OR) Class C12N 2310/16 (20130101) C12N 2310/51 (20130101) C12N 2310/128 (20130101) C12N 2310/532 (20130101) C12N 2310/3519 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340552 | Deng et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Changhui Deng (San Francisco, California); Hao Li (San Francisco, California) |
| ABSTRACT | Compositions, devices, and systems for use in a high-throughput screening platform for identifying anti-aging compounds and/or mutations that extend replicative life span (RLS). Specifically, herein disclosed is a yeast cell daughter-arresting-program (DAP), as well as compositions used in devices and systems that allow measurement of replicative lifespan and identification of agents or mutations that modulate the lifespan. |
| FILED | Thursday, September 05, 2019 |
| APPL NO | 17/273065 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/81 (20130101) Original (OR) Class C12N 2800/102 (20130101) C12N 2810/70 (20130101) C12N 2830/702 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/025 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340566 | PEDERSON et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Massachusetts (Boston, Massachusetts); University of Central Florida Research Foundation, Inc. (Orlando, Florida) |
| ASSIGNEE(S) | |
| INVENTOR(S) | THORU PEDERSON (WORCESTER, Massachusetts); SCOT ANDREW WOLFE (WINCHESTER, Massachusetts); HANHUI MA (SHREWSBURY, Massachusetts); Metewo Selase Kosi Enuameh (Gaithersburg, Maryland); Nicola Anne Kearns (Somerville, Massachusetts); Ryan Michael Jude Genga (Farmingham, Massachusetts); Rene Maehr (Newton, Massachusetts); Shaojie Zhang (Oviedo, Florida); Ardalan Naseri (Orlando, Florida); Manuel Garber (Winchester, Massachusetts) |
| ABSTRACT | The present disclosure relates to methods of and systems for modifying the transcriptional regulation of stem or progenitor cells to promote their differentiation or reprogramming of somatic cells. Further, the labeling and editing of human genomic loci in live cells with three orthogonal CRISPR/Cas9 components allow multicolor detection of genomic loci with high spatial resolution, which provides an avenue for barcoding elements of the human genome in the living state. |
| FILED | Friday, March 12, 2021 |
| APPL NO | 17/200398 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0606 (20130101) C12N 5/0696 (20130101) C12N 9/22 (20130101) C12N 15/63 (20130101) C12N 15/86 (20130101) Original (OR) Class C12N 15/907 (20130101) C12N 2501/65 (20130101) C12N 2501/70 (20130101) C12N 2510/00 (20130101) C12N 2740/15043 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6841 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340575 | Doudna et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Emmanuelle Charpentier (Berlin, Germany); The Regents of the University of California (Oakland, California); University of Vienna (Vienna, Austria) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jennifer A. Doudna (Berkeley, California); Martin Jinek (Berkeley, California); Krzysztof Chylinski (Vienna, Austria); Emmanuelle Charpentier (Berlin, Germany) |
| ABSTRACT | The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms. |
| FILED | Friday, May 21, 2021 |
| APPL NO | 17/326805 |
| CURRENT CPC | New Plants or Processes for Obtaining Them; Plant Reproduction by Tissue Culture Techniques A01H 6/4684 (20180501) Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 67/027 (20130101) Preparations for Medical, Dental, or Toilet Purposes A61K 38/465 (20130101) A61K 48/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/63 (20130101) C12N 15/70 (20130101) C12N 15/90 (20130101) C12N 15/102 (20130101) C12N 15/111 (20130101) C12N 15/113 (20130101) C12N 15/746 (20130101) C12N 15/902 (20130101) C12N 15/907 (20130101) Original (OR) Class C12N 2310/11 (20130101) C12N 2310/13 (20130101) C12N 2310/14 (20130101) C12N 2310/20 (20170501) C12N 2310/31 (20130101) C12N 2310/32 (20130101) C12N 2310/33 (20130101) C12N 2310/531 (20130101) C12N 2310/3519 (20130101) C12N 2800/80 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/686 (20130101) Enzymes C12Y 301/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340577 | Ajikumar et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); National University of Singapore (Singapore, Singapore) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); National University of Singapore (Singapore, Singapore) |
| INVENTOR(S) | Parayil K. Ajikumar (Cambridge, Massachusetts); Gregory Stephanopoulos (Winchester, Massachusetts); Heng Phon Too (Singapore, Singapore) |
| ABSTRACT | The invention relates to the production of one or more terpenoids through microbial engineering, and relates to the manufacture of products comprising terpenoids. |
| FILED | Friday, May 07, 2021 |
| APPL NO | 17/314561 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/70 (20130101) Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 5/007 (20130101) Original (OR) Class C12P 7/42 (20130101) C12P 9/00 (20130101) C12P 15/00 (20130101) C12P 17/02 (20130101) C12P 19/56 (20130101) C12P 23/00 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/689 (20130101) C12Q 2600/158 (20130101) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 999/99 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340594 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Johns Hopkins University (Baltimore, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Marc Greenberg (US, Maryland); Daniel Laverty (Baltimore, Maryland) |
| ABSTRACT | Methods for identifying one or more Pol θ inhibitors and methods of use thereof are disclosed. |
| FILED | Wednesday, July 10, 2019 |
| APPL NO | 17/259032 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7048 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/48 (20130101) Original (OR) Class Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 2333/9126 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340603 | Giese et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northeastern University (Boston, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Roger W. Giese (Hanover, Massachusetts); Poguang Wang (Westborough, Massachusetts) |
| ABSTRACT | Disclosed is a method for detecting the presence of a DNA adduct in DNA. The method involves the pre-labeling of an adducted nucleotide in the DNA with a quaternary ammonium compound. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307607 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6827 (20130101) Original (OR) Class C12Q 1/6834 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340614 | Lindsay |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Stuart Lindsay (SCOTTSDALE, Arizona) |
| ABSTRACT | The present disclosure provides devices, systems, and methods related to sequencing a biopolymer. In particular, the present disclosure relates to methods for sequencing a polynucleotide using a bioelectronic device that obtains a bioelectronic signature (e.g., current amplitude levels) of polymerase activity based on current fluctuations as complementary nucleotidepolyphosphate monomers (e.g., having distinct charges) are incorporated into the template polynucleotide. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/246123 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6869 (20130101) Original (OR) Class Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/04 (20130101) G01N 33/4833 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340633 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland); Pioneer Hi-Bred International, Inc. (Johnston, Iowa) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Tza-Huei Jeff Wang (Timonium, Maryland); Alexander Y. Trick (Baltimore, Maryland); Xiaoyi Sopko (Wilmington, Delaware) |
| ABSTRACT | Provided herein are methods of processing grain samples to detect the fractional abundance of transgenic traits. Related systems and computer program products are also provided. |
| FILED | Friday, April 23, 2021 |
| APPL NO | 17/239211 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6851 (20130101) C12Q 1/6895 (20130101) Original (OR) Class C12Q 2600/13 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 40/00 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341065 | Payne et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SFC Fluidics, Inc. (Fayetteville, Arkansas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Forrest W. Payne (Fayetteville, Arkansas); Bradley Ledden (Fayetteville, Arkansas); Gil Kan (Alpharetta, Georgia); Greg Lamps (Smyrna, Georgia) |
| ABSTRACT | A dual latching microvalve is capable of a metastable state, wherein a one or more complete flow paths are open, before switching to another state that allows only an inlet or outlet valve to be open at any time on any fluid path. One valve mechanism uses a cam to alternately open and close two valves, with an external force applying pressure to move one valve arm onto a resting position on the cam, thereby opening the closed valve and provided an uninterrupted flow path through the dual latching microvalve. The metastable state provides, for example, a means to prime the pump before operation, such as pumping of insulin into a patient. When released from the metastable state, the dual latching microvalve operates in a fashion whereby opening of both valves simultaneously is prevented, thereby protecting the patient from injury. |
| FILED | Thursday, August 29, 2019 |
| APPL NO | 17/271247 |
| CURRENT CPC | Valves; Taps; Cocks; Actuating-floats; Devices for Venting or Aerating F16K 7/045 (20130101) F16K 7/065 (20130101) Original (OR) Class F16K 11/027 (20130101) F16K 99/0026 (20130101) F16K 99/0038 (20130101) F16K 2099/0069 (20130101) F16K 2099/0071 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341374 | Vacca et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Kinetic River Corp. (Mountain View, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Giacomo Vacca (Campbell, California); Ralph Jimenez (Boulder, Colorado) |
| ABSTRACT | Described herein are apparatuses for analyzing an optical signal decay. In some embodiments, an apparatus includes: a source of a beam of pulsed optical energy; a sample holder configured to expose a sample to the beam; a detector comprising a number of spectral detection channels configured to convert the optical signals into respective electrical signals; and a signal processing module configured to perform a method. In some embodiments, the method includes: receiving the electrical signals from the detector; mathematically combining individual decay curves in the electrical signals into a decay supercurve, the supercurve comprising a number of components, each component having a time constant and a relative contribution to the supercurve; and numerically fitting a model to the supercurve. |
| FILED | Monday, May 24, 2021 |
| APPL NO | 17/328331 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/14 (20130101) Original (OR) Class G01N 15/147 (20130101) G01N 15/1429 (20130101) G01N 15/1434 (20130101) G01N 2015/1006 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341401 | Aspinwall et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF THE UNIVERSITY OF ARIZONA (Tucson, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Craig A. Aspinwall (Tucson, Arizona); Colleen M. Janczak (Tucson, Arizona); Zeinab Mokhtari (Tucson, Arizona); Isen Andrew C. Calderon (Tucson, Arizona) |
| ABSTRACT | Scintillant-doped polystyrene core nanoparticles surrounded by a silica shell can be used to quantify low-energy radionuclides. The nanoparticles are recoverable and re-useable, which may reduce waste and allow for sample recovery. Unlike traditional liquid scintillation cocktail (LSC) formulations, the nanoparticles are made from non-toxic and non-volatile components, and can be used without the aid of surfactants, making them a possible alternative to LSC for reducing the environmental impact of studies that employ radioactive tracers. Recognition elements attached to the functionalized silica surfaces of the nanoparticles allow for separation-free scintillation proximity assay (SPA) applications in aqueous samples. Lipid membrane coatings deposited on the nanoparticle surface can significantly reduce the non-specific adsorption of proteins and other biomolecules, and allow for the incorporation of membrane proteins or other membrane associated binding molecules. |
| FILED | Tuesday, June 15, 2021 |
| APPL NO | 17/347938 |
| CURRENT CPC | Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/02 (20130101) C09K 11/06 (20130101) C09K 11/025 (20130101) C09K 2211/1007 (20130101) C09K 2211/1018 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 23/2202 (20130101) Original (OR) Class G01N 33/573 (20130101) G01N 2223/07 (20130101) G01N 2223/507 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341412 | Jang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Mayo Foundation for Medical Education and Research (Rochester, Minnesota); INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY (Seoul, South Korea) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Dong-Pyo Jang (Sungnam City, South Korea); Kendall H. Lee (Rochester, Minnesota); Yoonbae Oh (Rochester, Minnesota); Christopher J. Kimble (Pine Island, Minnesota) |
| ABSTRACT | Systems, methods, and devices for generating multiple cyclic square-waveforms and sloped-edge square waveforms. Aspects of the techniques disclosed herein include applying the generated waveforms to an electrode used in voltammetry, e.g., to measure a level of a neurochemical in neural tissue. An electrode can be located in a solution, and an electrical stimulus applied to the solution through the electrode using a multiple cyclic square waveform. An electrical current response to the stimulus is measured, and a level of an analyte (e.g., dopamine or other neurochemical(s)) determined based on the electrical current response. |
| FILED | Tuesday, August 20, 2019 |
| APPL NO | 17/270671 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/3277 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341429 | Kijanka et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Mayo Foundation for Medical Education and Research (Rochester, Minnesota) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Piotr Kijanka (Rochester, Minnesota); Matthew W. Urban (Rochester, Minnesota) |
| ABSTRACT | Described here are systems and methods for phase velocity imaging using an imaging system, such as an ultrasound system, an optical imaging system (e.g., an optical coherence tomography system), or a magnetic resonance imaging system. In general, systems and methods for constructing phase velocity images (e.g., 2D images, 3D images) from propagating mechanical wave motion data are described. The systems and methods described in the present disclosure operate in the frequency domain and can be implemented using a single frequency or a band of selected frequencies. If there are multiple mechanical wave sources within the field-of-view, directional filtering may be performed to separate mechanical waves propagating in different directions. The reconstructions described below can be performed for each of these directionally filtered components. |
| FILED | Wednesday, August 28, 2019 |
| APPL NO | 17/282569 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/7257 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 29/46 (20130101) G01N 29/075 (20130101) Original (OR) Class G01N 29/0672 (20130101) Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/53 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341462 | Huh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Dongeun HUH (Villanova, Pennsylvania); Andrei GEORGESCU (Philadelphia, Pennsylvania); THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA (Philadelphia, Pennsylvania) |
| INVENTOR(S) | Dongeun Huh (Villanova, Pennsylvania); Andrei Georgescu (Philadelphia, Pennsylvania) |
| ABSTRACT | The presently disclosed subject matter provides a microfluidic device that can simulate the cross section of the large and small human airways, including the air-exposed epithelial layer, the adjacent surrounding stromal layer, and the blood-facing endothelial layer of near-by vessels in the circulatory system. The microfluidic device can reconstitute the air-liquid interface in the lung and molecular transport characteristics of bronchi and bronchioles in the human pulmonary airways, and provide a more realistic alternative to current in vitro models of airway structures. Additionally, the model can reconstitute the native response of airway tissues to infection by bacterial and viral agents, and also the extravasation of immune cells from the bloodstream and into the stromal and epithelial compartments of the lung in response to an infection. The presently disclosed subject matter also provides microfluidic devices that include multiple chambers assembled by layered stacking or bonding of a basal chamber, a first membrane, an interstitial chamber, a second membrane and an apical chamber. |
| FILED | Monday, October 07, 2019 |
| APPL NO | 17/282667 |
| CURRENT CPC | Apparatus for Enzymology or Microbiology; C12M 23/16 (20130101) C12M 23/34 (20130101) C12M 25/14 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0062 (20130101) C12N 5/0688 (20130101) C12N 5/0697 (20130101) C12N 2513/00 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5005 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341489 | ULRICH et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE GOVERNMENT OF THE UNITED STATES, AS REPRESENTED BY THE SECRETARY OF THE ARMY (Fort Detrick, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Robert G. ULRICH (Frederick, Maryland); Teddy KAMATA (Frederick, Maryland) |
| ABSTRACT | The disclosure relates to compositions, assays, methods and kits comprising one or more amino acid sequences of a filovirus protein, or a fragment thereof, which find use in the detection of a filovirus infection and/or the presence of antibodies specific for a filovirus in a biological sample. |
| FILED | Wednesday, June 03, 2015 |
| APPL NO | 15/316020 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6854 (20130101) Original (OR) Class G01N 2333/08 (20130101) G01N 2469/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341492 | Hahn et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Seattle Children's Hospital d/b/a Seattle Children's Research Institute (Seattie, Washington); Fred Hutchinson Cancer Research Center (Seattie, Washington) |
| ASSIGNEE(S) | Seattle Children's Hospital d/b/a Seattle Children's Research Institute (Seattle, Washington); Fred Hutchinson Cancer Research Center (Seattle, Washington) |
| INVENTOR(S) | Sihoun Hahn (Clyde Hill, Washington); Sunhee Jung (Seattle, Washington); Jeffrey Whiteaker (Seattle, Washington); Troy Torgerson (Seattle, Washington); Amanda Paulovich (Seattle, Washington); Christopher Collins (Seattle, Washington); Remwilyn Dayuha (Lynnwood, Washington) |
| ABSTRACT | Newborn screening for primary immunodeficiencies, cystinosis, and Wilson disease is described. The newborn screening can detect these disorders from dried blood spots already routinely collected at the time of birth. Early detection of these disorders will greatly improve patient outcome as each of them can be fatal once symptoms emerge. |
| FILED | Friday, October 04, 2019 |
| APPL NO | 17/282989 |
| CURRENT CPC | Peptides C07K 16/2809 (20130101) C07K 2317/34 (20130101) C07K 2317/565 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6848 (20130101) G01N 33/6893 (20130101) Original (OR) Class G01N 2800/24 (20130101) G01N 2800/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341494 | O'Bryant et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of North Texas Health Science Center at Fort Worth (Fort Worth, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Sid E. O'Bryant (Aledo, Texas); Leigh A. Johnson (Aledo, Texas) |
| ABSTRACT | The present invention includes methods for selecting a therapy for improved cognition as well as prevention of cognitive loss/dysfunction using one or more endophenotypes comprising: obtaining a sample from a subject; measuring biomarkers that differentiate between an inflammatory, a metabolic, a neurotrophic, and a depressive endophenotype; and selecting a course of treatment for the subject based on whether the subject is scored as having a high or a low endophenotype for one or more of the inflammatory, a metabolic, a neurotrophic, and a depressive endophenotypes. |
| FILED | Tuesday, June 29, 2021 |
| APPL NO | 17/361763 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6883 (20130101) C12Q 2600/106 (20130101) C12Q 2600/158 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) Original (OR) Class G01N 2800/52 (20130101) G01N 2800/60 (20130101) G01N 2800/2814 (20130101) G01N 2800/7095 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 40/00 (20190201) G16B 40/20 (20190201) G16B 40/30 (20190201) Healthcare Informatics, i.e Information and Communication Technology [ICT] Specially Adapted for the Handling or Processing of Medical or Healthcare Data G16H 50/20 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341495 | Barthelemy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington University (ST. LOUIS, Missouri) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Nicolas Barthelemy (St. Louis, Missouri); Randall Bateman (St. Louis, Missouri); Eric McDade (ST. LOUIS, Missouri) |
| ABSTRACT | The present disclosure provides methods to quantify tau phosphorylation at specific amino acid residues to predict time to onset of mild cognitive impairment due to Alzheimer's disease, stage Alzheimer's disease, guide treatment decisions, select subjects for clinical trials, and evaluate the clinical efficacy of certain therapeutic interventions. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368403 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341496 | Roper et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Florida State University Research Foundation, Inc. (Tallahassee, Florida) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Michael G. Roper (Tallahassee, Florida); Joel E. Adablah (Tallahassee, Florida); Matthew Donohue (Tallahassee, Florida) |
| ABSTRACT | Methods and systems for insulin detection. The methods may include contacting one or more islets with glucose to produce a first stream that is then contacted with an anti-insulin antibody and a labeled insulin to produce a second stream. The second stream may be analyzed to determine a ratio of antibody-bound (B) labeled insulin to free (F) labeled insulin in the second stream, wherein the ratio of B:F is inversely related to a concentration of target insulin. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/246546 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5027 (20130101) B01L 2200/027 (20130101) Peptides C07K 16/26 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/6445 (20130101) G01N 33/74 (20130101) Original (OR) Class G01N 33/84 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341557 | Zhao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE GENERAL HOSPITAL CORPORATION (Boston, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Bo Zhao (Malden, Massachusetts); Lawrence Wald (Cambridge, Massachusetts) |
| ABSTRACT | Systems and methods for reconstructing MR parameter maps of a subject from magnetic resonance fingerprinting (MRF) data acquired using a magnetic resonance imaging (MRI) system. The method includes providing MRF data acquired from a subject using an MRI system and reconstructing the MRF data by solving a constrained optimization problem using a low-rank model, for which an input to the optimization problem is the MRF data and an output from the optimization problem is the MRF time-series images. |
| FILED | Tuesday, July 13, 2021 |
| APPL NO | 17/374693 |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 33/50 (20130101) G01R 33/561 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342646 | Feng et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ruibin Feng (Scottsdale, Arizona); Zongwei Zhou (Tempe, Arizona); Jianming Liang (Scottsdale, Arizona) |
| ABSTRACT | Described herein are means for training a deep model to learn contrastive representations embedded within part-whole semantics via a self-supervised learning framework, in which the trained deep models are then utilized for the processing of medical imaging. For instance, an exemplary system is specifically configured for performing a random cropping operation to crop a 3D cube from each of a plurality of medical images received at the system as input, performing a resize operation of the cropped 3D cubes, performing an image reconstruction operation of the resized and cropped 3D cubes to predict the resized whole image represented by the original medical images received; and generating a reconstructed image which is analyzed for reconstruction loss against the original image representing a known ground truth image to the reconstruction loss function. Other related embodiments are disclosed. |
| FILED | Monday, April 26, 2021 |
| APPL NO | 17/240271 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/6259 (20130101) Original (OR) Class G06K 2209/051 (20130101) Image Data Processing or Generation, in General G06T 7/0012 (20130101) G06T 7/174 (20170101) G06T 15/08 (20130101) G06T 17/10 (20130101) G06T 2207/20081 (20130101) G06T 2207/20084 (20130101) G06T 2207/20132 (20130101) G06T 2207/30016 (20130101) G06T 2207/30056 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343014 | Haghighi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Fatemeh Haghighi (Tempe, Arizona); Mohammad Reza Hosseinzadeh Taher (Tempe, Arizona); Zongwei Zhou (Tempe, Arizona); Jianming Liang (Tempe, Arizona) |
| ABSTRACT | Described herein are means for the generation of semantic genesis models through self-supervised learning in the absence of manual labeling, in which the trained semantic genesis models are then utilized for the processing of medical imaging. For instance, an exemplary system is specially configured with means for performing a self-discovery operation which crops 2D patches or crops 3D cubes from similar patient scans received at the system as input; means for transforming each anatomical pattern represented within the cropped 2D patches or the cropped 3D cubes to generate transformed 2D anatomical patterns or transformed 3D anatomical patterns; means for performing a self-classification operation of the transformed anatomical patterns by formulating a C-way multi-class classification task for representation learning; means for performing a self-restoration operation by recovering original anatomical patterns from the transformed 2D patches or transformed 3D cubes having transformed anatomical patterns embedded therein to learn different sets of visual representation; and means for providing a semantics-enriched pre-trained AI model having a trained encoder-decoder structure with skip connections in between based on the performance of the self-discovery operation, the self-classification operation, and the self-restoration operation. Other related embodiments are disclosed. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/246032 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/3233 (20130101) G06K 9/4638 (20130101) G06K 9/6204 (20130101) Image Data Processing or Generation, in General G06T 3/0012 (20130101) G06T 7/0014 (20130101) Original (OR) Class G06T 2207/20081 (20130101) G06T 2207/20084 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343015 | MOUTON et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF SOUTH FLORIDA (Tampa, Florida); STEREOLOGY RESOURCE CENTER, INC. (Saint Petersburg, Florida) |
| ASSIGNEE(S) | |
| INVENTOR(S) | PETER RANDOLPH MOUTON (St. Petersburg, Florida); HADY AHMADY PHOULADY (Portland, Maine); DMITRY GOLDGOF (Lutz, Florida); LAWRENCE O. HALL (Tampa, Florida) |
| ABSTRACT | Systems and methods for automated stereology are provided. A method can include providing an imager for capturing a Z-stack of images of a three-dimensional (3D) object; constructing extended depth of field (EDF) images from the Z-stack of images; performing a segmentation method on the EDF images including estimating a Gaussian Mixture Model (GMM), performing morphological operations, performing watershed segmentation, constructing Voronoi diagrams and performing boundary smoothing; and determining one or more stereology parameters such as number of cells in a region. |
| FILED | Wednesday, May 05, 2021 |
| APPL NO | 17/308592 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/0014 (20130101) G06K 9/00147 (20130101) Computer Systems Based on Specific Computational Models G06N 3/08 (20130101) G06N 20/00 (20190101) Image Data Processing or Generation, in General G06T 5/002 (20130101) G06T 5/20 (20130101) G06T 7/11 (20170101) G06T 7/0014 (20130101) Original (OR) Class G06T 7/97 (20170101) G06T 7/174 (20170101) G06T 17/205 (20130101) G06T 2207/20081 (20130101) G06T 2207/20084 (20130101) G06T 2207/20152 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343364 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE JOHNS HOPKINS UNIVERSITY (Baltimore, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Tza-Huei Jeff Wang (Timonium, Maryland); Alexander Y. Trick (Baltimore, Maryland) |
| ABSTRACT | Provided herein are methods of performing multiplexed real-time quantitative ratiometric regression PCR (qRR-PCR) to determine the fractional abundance of target variants in a population. Related systems and computer program products are also provided. |
| FILED | Friday, April 23, 2021 |
| APPL NO | 17/238872 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/686 (20130101) C12Q 2600/156 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 5/00 (20190201) G16B 20/20 (20190201) Original (OR) Class G16B 25/20 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343422 | Wood et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Levi Wood (Atlanta, Georgia); James E. Forsmo (Atlanta, Georgia); Laura D. Weinstock (Atlanta, Georgia); Alexis F. Wilkinson (Atlanta, Georgia) |
| ABSTRACT | The disclosure is directed to technologies for restoring proper regulation of the immune response and novel methods and systems for exogenously controlling immune cells in order to dynamically and predictively drive the immune response through pro-inflammatory activity to anti-inflammatory activity, mimicking the immune system's natural progression through these states. Embodiments of the present disclosure relate generally to methods and systems for dynamic predictive modeling and control of inflammation and the immune response, and more specifically to methods and systems for predictive modeling and control of the inflammatory state of immune cells via temporally regulated immune-modulating stimuli. |
| FILED | Friday, October 11, 2019 |
| APPL NO | 17/284216 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5047 (20130101) Healthcare Informatics, i.e Information and Communication Technology [ICT] Specially Adapted for the Handling or Processing of Medical or Healthcare Data G16H 50/50 (20180101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343515 | EBERLIN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Livia Schiavinato EBERLIN (Austin, Texas); Marta Sans ESCOFET (Austin, Texas); Bryan R. WYGANT (Austin, Texas); Jialing ZHANG (Austin, Texas); C. Buddie MULLINS (Austin, Texas) |
| ABSTRACT | Method and devices are provided for imaging a surface, such as a biological tissue sample, by mass spectrometry. In certain aspects, devices of the embodiments allow for the placement and collection of a plurality of spatially separated liquid droplets on a sample and delivery of the droplets with extracted sample analytes for mass spectrometry analysis. |
| FILED | Friday, June 08, 2018 |
| APPL NO | 16/620298 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6848 (20130101) Electric Discharge Tubes or Discharge Lamps H01J 49/0004 (20130101) Original (OR) Class H01J 49/0431 (20130101) H01J 49/0477 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344626 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352551 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344627 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352564 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344628 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352579 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344629 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352590 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344630 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352611 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344631 | Hsu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Salk Institute for Biological Studies (La Jolla, California) |
| ASSIGNEE(S) | Salk Institute for Biological Studies (La Jolla, California) |
| INVENTOR(S) | Patrick D. Hsu (San Francisco, California); Silvana Konermann (Menlo Park, California) |
| ABSTRACT | Provided herein are CRISPR/Cas methods and compositions for targeting RNA molecules, which can be used to detect, edit, or modify a target RNA. |
| FILED | Monday, June 21, 2021 |
| APPL NO | 17/352725 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/113 (20130101) C12N 15/8201 (20130101) C12N 15/8213 (20130101) C12N 2310/16 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/08 (20130101) H04L 9/30 (20130101) H04L 45/745 (20130101) H04L 51/08 (20130101) H04L 51/12 (20130101) Original (OR) Class H04L 51/14 (20130101) H04L 51/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Defense (DOD)
| US 20210338171 | Derksen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Michigan (Ann Arbor, Michigan) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Hendrikus Derksen (Dexter, Michigan); Neriman Tokcan (Somerville, Massachusetts); Kayvan Najarian (Northville, Michigan); Jonathan Gryak (Ann Arbor, Michigan) |
| ABSTRACT | A method of generating an assessment of medical condition for a patient includes obtaining a patient data tensor indicative of a plurality of tests conducted on the patient, obtaining a set of tensor factors, each tensor factor of the set of tensor factors being indicative of a decomposition of training tensor data for the plurality of tests, the decomposition amplifying low rank structure of the training tensor data, determining a patient tensor factor for the patient based on the obtained patient data tensor and the obtained set of tensor factors, applying the determined patient tensor factor to a classifier such that the determined further tensor factor establishes a feature vector for the patient, the classifier being configured to process the feature vector to generate the assessment, and providing output data indicative of the assessment. |
| FILED | Thursday, February 04, 2021 |
| APPL NO | 17/167140 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/7264 (20130101) Original (OR) Class Electric Digital Data Processing G06F 17/40 (20130101) Computer Systems Based on Specific Computational Models G06N 20/00 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338173 | Palmer et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); U.S. Army Research Institute of Environmental Medicine (Natick, Massachusetts) |
| INVENTOR(S) | Jeffrey Palmer (Westford, Massachusetts); Brian Telfer (Lincoln, Massachusetts); James Williamson (Arlington, Massachusetts); Lara Weed (East Kingston, New Hampshire); Mark Buller (Douglas, Massachusetts); Rebecca Fellin (Natick, Massachusetts); Joseph Seay (Marlborough, Massachusetts) |
| ABSTRACT | A heat response monitor, comprises an accelerometer, a core temperature sensor, an estimation device, and an enabler. The estimation device uses accelerometry-based functionality to provide a gait-based heat stroke risk score, and the estimation device uses an estimated core temperature of a wearer of the core temperature sensor, to provide an estimated core temperature-based heat stroke risk score. The gait-based heat stroke risk score and the estimated core temperature-based heat stroke risk score are used to determine if a wearer of the heat response monitor is in risk of heat injury. |
| FILED | Wednesday, June 24, 2020 |
| APPL NO | 16/910614 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/1123 (20130101) A61B 5/02055 (20130101) A61B 5/02438 (20130101) A61B 5/7275 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338245 | JOHNSON et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Certus Critical Care, Inc. (Sacramento, California); Wake Forest University Health Sciences (Winston-Salem, North Carolina) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Michael Austin JOHNSON (Holladay, Utah); David POISNER (Carmichael, California); Melanie MCWADE (Portland, Oregon); Timothy WILLIAMS (Winston-Salem, North Carolina); Lucas NEFF (Winston-Salem, North Carolina) |
| ABSTRACT | Systems and methods for blood flow control are described herein. In some variations, a blood flow control system may comprise a blood flow control device. The blood flow control device may be placed within a body of a patient and may comprise an expandable member and a sensor. The sensor may be configured to measure at least one of a physiologic condition of the patient and a pressure associated with the expandable member. The blood flow control system may include at least one controller communicably coupled to the sensor to: receive data indicative of at least one of the physiologic condition of the patient and the pressure associated with the expandable member from the sensor, compare the received data with target data, identify at least one error based on the comparison, and in response to identifying the error, inhibit at least one function of the blood flow control system. |
| FILED | Thursday, July 01, 2021 |
| APPL NO | 17/365932 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/12109 (20130101) Original (OR) Class A61B 17/12136 (20130101) A61B 34/25 (20160201) A61B 2017/00557 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338349 | Farritor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shane Farritor (Lincoln, Nebraska); Erik Mumm (Longmont, Colorado); Philip Chu (Friendswood, Texas); Nishant Kumar (Bergenfield, New Jersey); Jason Dumpert (Omaha, Nebraska); Yutaka Tsutano (Campbell, California) |
| ABSTRACT | The embodiments disclosed herein relate to various medical device components, including components that can be incorporated into robotic and/or in vivo medical devices. Certain embodiments include various modular medical devices for in vivo medical procedures. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368023 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 17/29 (20130101) A61B 17/00234 (20130101) A61B 34/00 (20160201) A61B 34/30 (20160201) Original (OR) Class A61B 34/37 (20160201) A61B 90/30 (20160201) A61B 90/361 (20160201) A61B 2017/2906 (20130101) A61B 2034/302 (20160201) A61B 2217/005 (20130101) A61B 2217/007 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338593 | Ferrari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| ASSIGNEE(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| INVENTOR(S) | Mauro Ferrari (Houston, Texas); Ennio Tasciotti (Houston, Texas); Jason Sakamoto (Houston, Texas) |
| ABSTRACT | Multistage delivery vehicles are disclosed which include a first stage particle and a second stage particle. The first stage particle is a micro or nanoparticle that contains the second stage particle. The second stage particle includes an active agent, such as a therapeutic agent or an imaging agent. The multistage delivery vehicle allows sequential overcoming or bypassing of biological barriers. The multistage delivery vehicle is administered as a part of a composition that includes a plurality of the vehicles. Methods of making the multistage delivery vehicles are also provided. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368401 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/50 (20130101) Original (OR) Class A61K 9/51 (20130101) A61K 9/127 (20130101) A61K 9/1271 (20130101) A61K 31/165 (20130101) A61K 31/704 (20130101) A61K 31/7088 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338664 | Singh |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CFD Research Corporation (Huntsville, Alabama) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Narender Singh (Madison, Alabama) |
| ABSTRACT | A method for providing a therapy to a subject that has been exposed to an Aflatoxin B1 can include administering a compound having a structure of Formula 1 to the subject after exposure to the Aflatoxin B1: wherein: R1, R2, R3, R4, R5 and/or R6 are each individually a chemical moiety and n is 1, 2, 3, 4, or 5. The compound can be Amprenavir or a derivative thereof, prodrug thereof, salt thereof, or stereoisomer thereof, or having any chirality at any chiral center, or tautomer, polymorph, solvate, or combination thereof. The prodrug can be Amprenavir phosphate. |
| FILED | Wednesday, April 29, 2020 |
| APPL NO | 16/862500 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/497 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 1/16 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338736 | INGBER et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| ASSIGNEE(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| INVENTOR(S) | Donald E. INGBER (Boston, Massachusetts); Samira MUSAH (Malden, Massachusetts) |
| ABSTRACT | Embodiments of various aspects described herein relate to methods, kits, and cell culture media for generation of podocytes from pluripotent stem (PS) cells, as well as cells produced by the same, and methods of use. |
| FILED | Friday, July 02, 2021 |
| APPL NO | 17/366827 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/22 (20130101) Original (OR) Class A61K 35/545 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0686 (20130101) C12N 2501/16 (20130101) C12N 2501/155 (20130101) C12N 2501/165 (20130101) C12N 2501/385 (20130101) C12N 2501/415 (20130101) C12N 2501/727 (20130101) C12N 2506/02 (20130101) C12N 2506/45 (20130101) C12N 2533/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338789 | Khan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts); Whitehead Institute for Biomedical Research (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Omar F. Khan (Cambridge, Massachusetts); Jasdave S. Chahal (Arlington, Massachusetts); Daniel G. Anderson (Cambridge, Massachusetts); Hidde Ploegh (Brookline, Massachusetts); Robert S. Langer (Cambridge, Massachusetts); Tyler E. Jacks (Cambridge, Massachusetts); David A. Canner (Cambridge, Massachusetts) |
| ABSTRACT | Compositions and methods for modified dendrimer nanoparticle (“MDNP”) delivery of therapeutic, prophylactic and/or diagnostic agent such as large repRNA molecules to the cells of a subject have been developed. MDNPs efficiently drive proliferation of antigen-specific T cells against intracellular antigen, and potentiate antigen-specific antibody responses. MDNPs can be multiplexed to deliver two or more different repRNAs to modify expression kinetics of encoded antigens and to simultaneous deliver repRNAs and mRNAs including the same UTR elements that promote expression of encoded antigens. |
| FILED | Wednesday, March 10, 2021 |
| APPL NO | 17/198037 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/5146 (20130101) A61K 31/713 (20130101) A61K 39/002 (20130101) A61K 39/0012 (20130101) Original (OR) Class A61K 39/12 (20130101) A61K 39/145 (20130101) A61K 48/00 (20130101) A61K 2039/53 (20130101) A61K 2039/70 (20130101) A61K 2039/645 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/87 (20130101) C12N 15/88 (20130101) C12N 2740/16234 (20130101) C12N 2760/14134 (20130101) C12N 2760/16034 (20130101) C12N 2770/24134 (20130101) C12N 2770/36143 (20130101) Technologies for Adaptation to Climate Change Y02A 50/30 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339011 | ALBECK et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel); NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | Nurotone Medical Ltd. (Rosh Ha'Ayin, Israel); NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| INVENTOR(S) | Dan David ALBECK (Givat Shmuel, Israel); Claus Peter RICHTER (Skokie, Illinois) |
| ABSTRACT | Disclosed is a method of selecting stimulations for a cochlear implant or an auditory implant. The method may include: capturing an acoustical signal; dividing the acoustical signal into a plurality of frequency bands; determining a mean acoustical energy for each frequency band; for each frequency band: comparing the mean acoustical energy with the mean acoustical energy determined for neighboring frequency bands; merging neighboring frequency bands having a difference between the mean acoustical energies that is less than an acoustical energy threshold value; selecting one or more types of stimulation to be applied to one or more locations in a cochlea or along an auditory nerve based on bandwidths of each frequency band. The one or more types of stimulation may be selected from: electrical stimulation, optical stimulation and opto-electrical stimulation, and the one or more locations in cochlea or along the auditory nerve may correspond to specific frequencies of the acoustical signal. |
| FILED | Wednesday, August 14, 2019 |
| APPL NO | 17/268400 |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/0541 (20130101) Original (OR) Class A61N 1/36038 (20170801) A61N 1/36171 (20130101) A61N 1/36175 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339201 | Benton et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Porifera, Inc. (San Leandro, California) |
| ASSIGNEE(S) | Porifera, Inc. (San Leandro, California) |
| INVENTOR(S) | Charles Benton (Berkeley, California); Olgica Bakajin (Berkeley, California) |
| ABSTRACT | An example separation system includes a stack of membrane plate assemblies. An example membrane plate assembly may include membranes bonded to opposite sides of a spacer plate. The spacer plate may include a first opening in fluid communication with a region between the membranes, and a second opening in fluid communication with a region between membrane plate assemblies. Adjacent membrane plate assemblies in the stack may have alternating orientations such that bonding areas for adjacent membranes in the stack may be staggered. Accordingly, two isolated flows may be provided which may be orthogonal from one another. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375932 |
| CURRENT CPC | Separation B01D 61/002 (20130101) B01D 63/082 (20130101) Original (OR) Class B01D 63/084 (20130101) B01D 63/085 (20130101) B01D 2313/14 (20130101) B01D 2319/00 (20130101) B01D 2319/02 (20130101) B01D 2319/04 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/445 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339243 | GLEZER et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | MESO SCALE TECHNOLOGIES, LLC (Rockville, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Eli N. GLEZER (Chevy Chase, Maryland); Bandele Jeffrey-Coker (Darnestown, Maryland); Jeffery D. Debad (Gaithersburg, Maryland); Sudeep M. Kumar (Gaithersburg, Maryland); George B. Sigal (Rockville, Maryland); Bisbert Spieles (Bethesda, Maryland); Michael Tsionsky (Derwood, Maryland); Michael Warnock (Carlsbad, California) |
| ABSTRACT | We describe assay modules (e.g., assay plates, cartridges, multi-well assay plates, reaction vessels, etc.), processes for their preparation, and method of their use for conducting assays. Reagents may be present in free form or supported on solid phases including the surfaces of compartments (e.g., chambers, channels, flow cells, wells, etc.) in the assay modules or the surface of colloids, beads, or other particulate supports. In particular, dry reagents can be incorporated into the compartments of these assay modules and reconstituted prior to their use in accordance with the assay methods. A desiccant material may be used to maintain and stabilize these reagents in a dry state. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378294 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5025 (20130101) Original (OR) Class B01L 3/5085 (20130101) B01L 2200/12 (20130101) B01L 2200/16 (20130101) B01L 2300/105 (20130101) B01L 2300/0636 (20130101) B01L 2300/0645 (20130101) B01L 2300/0829 (20130101) B01L 2300/0851 (20130101) B01L 2300/0858 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5304 (20130101) G01N 33/54366 (20130101) G01N 33/54393 (20130101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 436/809 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339316 | Xia et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington (Seattle, Washington) |
| ASSIGNEE(S) | University of Washington (Seattle, Washington) |
| INVENTOR(S) | Younan Xia (St. Louis, Missouri); Sang-Hyuk Im (Pohang-Shi, South Korea); Yugang Sun (Naperville, Illinois); Yun Tack Lee (Seattle, Washington); Benjamin Wiley (Boston, Massachusetts) |
| ABSTRACT | Methods for producing silver nanostructures with improved dimensional control, yield, purity, monodispersed, and scale of synthesis. |
| FILED | Wednesday, March 17, 2021 |
| APPL NO | 17/249885 |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 1/0025 (20130101) B22F 9/24 (20130101) Original (OR) Class B22F 2001/0037 (20130101) B22F 2009/245 (20130101) B22F 2301/255 (20130101) B22F 2304/05 (20130101) B22F 2998/10 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Production and Refining of Metals; Pretreatment of Raw Materials C22B 11/04 (20130101) Alloys C22C 5/02 (20130101) C22C 5/06 (20130101) Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 7/00 (20130101) C30B 29/02 (20130101) C30B 29/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339325 | Grogan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Powdermet, Inc. (Euclid, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Mark Grogan (Cleveland, Ohio); Brian Doud (Cleveland Heights, Ohio); Andrew Sherman (Mentor, Ohio) |
| ABSTRACT | A heterogeneous composite consisting of near-nano ceramic clusters dispersed within a ductile matrix. The composite is formed through the high temperature compaction of a starting powder consisting of a core of ceramic nanoparticles held together with metallic binder. This core is clad with a ductile metal such that when the final powder is consolidated, the ductile metal forms a tough, near-zero contiguity matrix. The material is consolidated using any means that will maintain its heterogeneous structure. |
| FILED | Thursday, July 08, 2021 |
| APPL NO | 17/370431 |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 1/025 (20130101) B22F 3/14 (20130101) B22F 3/15 (20130101) B22F 3/17 (20130101) B22F 3/18 (20130101) B22F 3/20 (20130101) B22F 3/24 (20130101) B22F 3/105 (20130101) Working of Metal by the Action of a High Concentration of Electric Current on a Workpiece Using an Electrode Which Takes the Place of a Tool; Such Working Combined With Other Forms of Working of Metal B23H 1/08 (20130101) B23H 5/04 (20130101) B23H 5/12 (20130101) Original (OR) Class B23H 7/00 (20130101) Metal-working Not Otherwise Provided For; Combined Operations; Universal Machine Tools B23P 13/02 (20130101) Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 35/5626 (20130101) C04B 35/58014 (20130101) Alloys C22C 29/00 (20130101) C22C 32/00 (20130101) Shafts; Flexible Shafts; Elements or Crankshaft Mechanisms; Rotary Bodies Other Than Gearing Elements; Bearings F16C 17/00 (20130101) F16C 33/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339488 | Cardenas et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S. Army Combat Capabilities Development Command, Army Research Laboratory (Adelphi, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jorge A. Cardenas (Durham, North Carolina); Nathan S. Lazarus (North Bethesda, Maryland); Harvey H. Tsang (Rockville, Maryland) |
| ABSTRACT | Photonic annealing is used to treat electrically-conductive thermoplastic. The thermoplastic forms, partially or wholly, a part which may be formed by additive manufacturing, like fused filament fabrication (FFF). The photonic annealing improves part conductivity and also alter, enhance, or give rise to other material properties while taking significantly less time than other conventional post-process methods. For instance, the baseline conductivity of the electrically-conductive thermoplastic material may be on the order of 103 S/m or lower. After the photonic annealing, its conductivity may be raised to the order of 104-105 S/m or more. This represents an improvement of 10-100× or even more of conductivity of the electrically-conductive thermoplastic compared to electrically-conductive thermoplastic prior to the photonic annealing. |
| FILED | Monday, May 04, 2020 |
| APPL NO | 16/866396 |
| CURRENT CPC | Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/30 (20170801) B29C 64/118 (20170801) B29C 71/02 (20130101) Original (OR) Class B29C 2071/022 (20130101) Indexing Scheme Associated With Subclasses B29B, B29C or B29D, Relating to Moulding Materials or to Materials for Reinforcements, Fillers or Preformed Parts, e.g Inserts B29K 2101/12 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 30/00 (20141201) B33Y 40/20 (20200101) B33Y 80/00 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340049 | Wiest et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of the Navy (Crane, Indiana) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| INVENTOR(S) | Aaron Wiest (Norco, California); Rebecca Stevens (Anaheim, California); Robert Dale Conner (Oak Hills, California); Craig MacDougall (Norco, California); Sam Pratt (Arlington, Virginia) |
| ABSTRACT | Apparatus and methods for forming and printing hollow bodies from amorphous materials to form three-dimensional objects are provided. Apparatus provide a hollow body forming and printing machine, and methods for determining a desired amount of impact deformation for the hollow spheres, including calculating specific characteristics of the hollow spheres and the amorphous material, deriving a target viscosity range, adjusting the apparatus to satisfy the target viscosity range, and using the apparatus to form a plurality of hollow spheres with controlled deformation. |
| FILED | Monday, June 28, 2021 |
| APPL NO | 17/360426 |
| CURRENT CPC | Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/106 (20170801) B29C 64/194 (20170801) B29C 64/393 (20170801) B29C 2945/7605 (20130101) Producing Particular Articles From Plastics or From Substances in a Plastic State B29D 22/04 (20130101) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 30/00 (20141201) Manufacture, Shaping, or Supplementary Processes C03B 19/1075 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340067 | Boakye et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Government of the United States as represented by the Secretary of the Air Force (Wright-Patterson AFB, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Emmanuel E. Boakye (Centerville, Ohio); Michael K. Cinibulk (Beavercreek, Ohio); Randal S. Hay (Beavercreek, Ohio); Pavel Mogilevsky (Beavercreek, Ohio); Triplicane A. Parthasarathy (Beavercreek, Ohio); Kristin A. Keller (Springboro, Ohio) |
| ABSTRACT | A method of manufacturing a coated reinforcing fiber for use in Ceramic Matrix Composites, the method comprising pre-oxidizing a plurality of silicon-based fibers selected from the group consisting of silicon carbide (SiC) fibers, silicon nitride (Si3N4) fibers, SiCO fibers, SiCN fibers, SiCNO fibers, and SiBCN fibers at between 700 to 1300 degrees Celsius in an oxidizing atmosphere to form a silica surface layer on the plurality of silicon-based fibers, forming a plurality of pre-oxidized fibers; applying a rare earth orthophosphate (REPO4) coating to the plurality of pre-oxidized fibers; and heating the plurality of REPO4 coated pre-oxidized fibers at about 1000-1500 degrees Celsius in an inert atmosphere to react the REPO4 with the silica surface layer to form a rare earth silicate or disilicate. The pre-oxidizing step may be 0.5 hours to about 100 hours. The heating step may be about 5 minutes to about 100 hours. |
| FILED | Monday, March 29, 2021 |
| APPL NO | 17/214994 |
| CURRENT CPC | Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 35/80 (20130101) C04B 35/62675 (20130101) C04B 35/62881 (20130101) Original (OR) Class C04B 2235/5244 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340100 | SHAPIRO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | David J. SHAPIRO (Urbana, Illinois); Paul J. HERGENROTHER (Champaign, Illinois); Matthew W. BOUDREAU (Urbana, Illinois) |
| ABSTRACT | A set of small molecules ERα biomodulators that kill therapy-resistant ERα positive breast, ovarian, and endometrial cancer cells. These small molecules have increased therapeutic potential because of an increased ability to kill therapy-resistant breast cancer cells compared to BHPI and other conventional therapies (endocrine therapies, tamoxifen and fulvestrant/ICI). The new compounds do not only inhibit proliferation of the cancer cells but actually kills them, which prevents reactivation of tumors years later. |
| FILED | Thursday, May 13, 2021 |
| APPL NO | 17/319447 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Heterocyclic Compounds C07D 209/34 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340199 | Doudna et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jennifer A. Doudna (Berkeley, California); Kyle E. Watters (Moraga, California); Haridha Shivram (Berkeley, California); Christof Fellmann (Berkeley, California) |
| ABSTRACT | The present disclosure provides AcrIIA7 polypeptides, nucleic acids encoding the AcrIIA7 polypeptides, and kits comprising the AcrIIA7 polypeptides and/or nucleic acids encoding the ACRIIA7 polypeptides. The present disclosure provides methods of inhibiting an activity of a Cas9 polypeptide. |
| FILED | Monday, September 09, 2019 |
| APPL NO | 17/270691 |
| CURRENT CPC | Peptides C07K 14/4703 (20130101) Original (OR) Class C07K 2319/09 (20130101) C07K 2319/40 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/1137 (20130101) Enzymes C12Y 301/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340334 | PORTELA et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Carlos M. PORTELA (Pasadena, California); Daryl Wei Liang YEE (Pasadena, California); Dennis M. KOCHMANN (Pasadena, California); Julia R. GREER (Pasadena, California) |
| ABSTRACT | In an aspect, provided herein are low density materials, including shell-based materials, with three-dimensional architectures formed, in part, via self-assembly processes. Shell-based materials of some embodiments exhibit a combination of ultralow density (e.g., ≤100 mg cm−3 and optionally ≤10 100 mg cm−3) and non-periodic architectures characterized by low defect densities and geometries avoiding stress concentrations. Low density shell based materials of some embodiments have architectures characterized by small curvatures and lack of straight edges providing enhance mechanical response. In some embodiments, for example, the present low density materials, including shell-based materials, providing a combination target mechanical properties including high stiffness-to-density ratios, mechanical resilience and tolerance for deformation. |
| FILED | Friday, September 25, 2020 |
| APPL NO | 17/032539 |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 40/00 (20130101) Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 3/02 (20130101) Original (OR) Class C08J 9/26 (20130101) Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/403 (20130101) C23C 16/45525 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340415 | Tran et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S. Army Research Laboratory (Adelphi, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ngon T. Tran (Aberdeen, Maryland); Matthew A. Bartucci (Baltimore, Maryland); Joshua A. Orlicki (Havre de Grace, Maryland); Daniel B. Knorr, JR. (Oxford, Pennsylvania); Joseph L. Lenhart (Port Deposit, Maryland) |
| ABSTRACT | Disclosed is a method for improving interfacial adhesion of an adhesive to unprimed substrates and an improved adhesive composition, involving admixing an adhesive with an adhesive modifier, where the modifier is at least partially soluble in the at least one adhesive and includes either a non-aromatic polyol or a molecule having at least one ortho-hydroxyl substitution on a benzene ring. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378336 |
| CURRENT CPC | Adhesives; Non-mechanical Aspects of Adhesive Processes in General; Adhesive Processes Not Provided for Elsewhere; Use of Materials as Adhesives C09J 133/04 (20130101) C09J 163/00 (20130101) C09J 175/02 (20130101) C09J 175/04 (20130101) Original (OR) Class C09J 175/16 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340486 | Andrews et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DEKA Products Limited Partnership (Manchester, New Hampshire) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Richard E. Andrews (Manchester, New Hampshire); Dave D.B. Cannan (Manchester, New Hampshire); Alekhya Akkapeddi (Manchester, New Hampshire); Andrew G. Remec (Manchester, New Hampshire); Bryan A. Finseth (Newbury, New Hampshire); Kevin Kim (Hookset, New Hampshire) |
| ABSTRACT | System and method for providing biocompatible, nutrient filled media to the Human Cells, Tissues, and cellular and tissue-based Products (HCT/P) while removing wastes. The present teachings provide for sensing the characteristics of the media, and modifying the characteristics when necessary. The present teachings can also provide components that can provide fluid pumping integrated with fluid gas exchange, and sensing of fluid characteristics at consistent times during the fluid flow cycle. System and method control multiple bioreactors from a centralized media reservoir, while fluidically isolating the bioreactors from cross-contamination. |
| FILED | Wednesday, April 28, 2021 |
| APPL NO | 17/243324 |
| CURRENT CPC | Apparatus for Enzymology or Microbiology; C12M 23/28 (20130101) C12M 23/42 (20130101) C12M 23/44 (20130101) C12M 27/18 (20130101) C12M 29/00 (20130101) C12M 29/20 (20130101) C12M 41/12 (20130101) C12M 41/16 (20130101) C12M 41/32 (20130101) C12M 41/34 (20130101) C12M 41/48 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340488 | RAO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Maryland, Baltimore County (Baltimore, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Govind RAO (Ellicott city, Maryland); Yordan KOSTOV (Columbia, Maryland); Leah TOLOSA (Columbia, Maryland); Xudong GE (Woodstock, Maryland); Douglas Frey (Ellicott City, Maryland) |
| ABSTRACT | A portable and mobile bioprocessing system and method for protein manufacturing that is compact, integrated and suited for on-demand production of any type of proteins and for delivery of the produced proteins to patients or for assay purposes. The portable system and method can also be used for efficient on-demand production of any type of protein with point-of-care delivery. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376439 |
| CURRENT CPC | Apparatus for Enzymology or Microbiology; C12M 41/12 (20130101) C12M 47/10 (20130101) Original (OR) Class C12M 47/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340519 | KING et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF WASHINGTON (Seattle, Washington); UNIVERSITY OF UTAH (Salt Lake City, Utah) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Neil KING (Seattle, Washington); Wesley SUNDQUIST (Salt Lake City, Utah); Joerg VOTTELER (Salt Lake City, Utah); Yang HSIA (Seattle, Washington); David BAKER (Seattle, Washington); Jacob BALE (Seattle, Washington); Marc LAJOIE (Seattle, Washington); Gabriel BUTTERFIELD (Seattle, Washington); Elizabeth GRAY (Seattle, Washington); Daniel STETSON (Seattle, Washington) |
| ABSTRACT | The application discloses multimeric assemblies including multiple oligomeric substructures, where each oligomeric substructure includes multiple proteins that self-interact around at least one axis of rotational symmetry, where each protein includes one or more polypeptide-polypeptide interface (“O interface”); and one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding to one or more proteins in the eukaryotic ESCRT complex (“L domain”); and where the multimeric assembly includes one or more subunits comprising one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), as well as membrane-enveloped versions of the multimeric assemblies. |
| FILED | Wednesday, June 02, 2021 |
| APPL NO | 17/336889 |
| CURRENT CPC | Peptides C07K 14/00 (20130101) C07K 14/435 (20130101) C07K 2319/03 (20130101) C07K 2319/06 (20130101) C07K 2319/735 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/88 (20130101) Original (OR) Class Enzymes C12Y 401/02014 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340541 | SHARP et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ALBERT EINSTEIN COLLEGE OF MEDICINE (BRONX, New York) |
| ASSIGNEE(S) | ALBERT EINSTEIN COLLEGE OF MEDICINE (BRONX, New York) |
| INVENTOR(S) | David SHARP (Scarsdale, New York); Brian O'ROURKE (Rockville Centre, New York) |
| ABSTRACT | Methods and compositions are provided for inhibiting or treating metastasis based on discoveries regarding Kif19 and Cep192. Methods and compositions are provided for enhancing wound healing, treating fibrosis, reducing scarring and treating nerve pain. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/377351 |
| CURRENT CPC | Peptides C07K 14/4738 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) Original (OR) Class C12N 2310/14 (20130101) Enzymes C12Y 306/04004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340580 | Zu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S. Army DEVCOM Army Research Laboratory (Adelphi, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Theresah N. K. Zu (Elkridge, Maryland); Christian J. Sund (Bethesda, Maryland); Sanchao Liu (Ellicott City, Maryland); Elliot S. Gerlach (Silver Spring, Maryland) |
| ABSTRACT | A method of producing chemicals includes providing fermentative cells; co-feeding any of galacturonate and galacturonate polymers with carbohydrates to the fermentative cells; and producing a chemical from the fermentative cells. The fermentative cells may include any of Clostridium acetobutylicum and Clostridium saccharoperbutylacetonicum. The carbohydrates may include any of glucose, mannose, galactose, fructose, arabinose, xylose, sucrose, lactose, maltose, cellobiose, and starch. The method may include providing a substantially equal proportion of the any of galacturonate and galacturonate polymers and the carbohydrates for co-feeding to the fermentative cells. The method may include altering a proportion of the any of galacturonate and galacturonate polymers to the carbohydrates. The method may include modulating a production of the chemical by altering the proportion of the any of galacturonate and galacturonate polymers to the carbohydrates. The chemical may include any of acetate and butyrate. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376613 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/20 (20130101) Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 7/52 (20130101) C12P 7/54 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340692 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Taegon Oh (Evanston, Illinois); Sarah S. Park (Evanston, Illinois) |
| ABSTRACT | A post-synthetic method for stabilizing colloidal crystals programmed from nucleic acid is disclosed herein. In some embodiments, the method relies on Ag+ ions to stabilize the particle-connecting nucleic acid duplexes within the crystal lattice, essentially transforming them from loosely bound structures to ones with very strong interparticle links. In some embodiments, the nucleic acid is DNA. Such crystals do not dissociate as a function of temperature like normal DNA or DNA-interconnected colloidal crystals, and they can be moved from water to organic media or the solid state, and stay intact. The Ag+-stabilization of the nucleic acid (e.g., DNA) bonds is accompanied by a nondestructive contraction of the lattice, and both the stabilization and contraction are reversible with the chemical extraction of the Ag+ ions, e.g., by AgCl precipitation with NaCl. |
| FILED | Wednesday, September 25, 2019 |
| APPL NO | 17/272139 |
| CURRENT CPC | Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 7/08 (20130101) C30B 29/02 (20130101) Original (OR) Class C30B 29/58 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340752 | Peterson |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Folding Holdings, LLC (Bothell, Washington) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Elliot Peterson (Bothell, Washington) |
| ABSTRACT | A built-up beam includes a pair of I-beams each having opposing flanges, a web that extends between the opposing flanges, a plurality of flange openings in each of the opposing flanges, a plurality of web openings in the web, and a plurality of bolt holes in one of the opposing flanges. The I-beams are stacked together flange-to-flange in a stacked beam configuration and a plurality of bolts extend through the plurality of bolt holes and secure the pair of I-beams together in the stacked beam configuration. |
| FILED | Wednesday, April 29, 2020 |
| APPL NO | 16/862411 |
| CURRENT CPC | General Building Constructions; Walls, e.g Partitions; Roofs; Floors; Ceilings; Insulation or Other Protection of Buildings E04B 1/19 (20130101) Original (OR) Class Structural Elements; Building Materials E04C 3/04 (20130101) E04C 3/14 (20130101) E04C 2003/0413 (20130101) E04C 2003/0452 (20130101) E04C 2003/0465 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340933 | Garcia et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northrop Grumman Systems Corporation (Falls Church, Virginia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Benjamin W.C. Garcia (Tremonton, Utah); Brian Christensen (Willard, Utah); David R. Nelson (Logan, Utah); Braden Day (Nibley, Utah) |
| ABSTRACT | A hybrid metal composite (HMC) structure comprises a first tier comprising a first fiber composite material structure, a second tier longitudinally adjacent the first tier and comprising a first metallic structure and a second fiber composite material structure laterally adjacent the first metallic structure, a third tier longitudinally adjacent the second tier and comprising a third fiber composite material structure, and a fourth tier longitudinally adjacent the third tier and comprising a second metallic structure and a fourth fiber composite material structure laterally adjacent the second metallic structure. At least one lateral end of the second metallic structure is laterally offset from at least one lateral end of the first metallic structure most proximate thereto. Methods of forming an HMC structure, and related rocket motors and multi-stage rocket motor assemblies are also disclosed. |
| FILED | Tuesday, May 25, 2021 |
| APPL NO | 17/330040 |
| CURRENT CPC | Cosmonautics; Vehicles or Equipment Therefor B64G 1/403 (20130101) Jet-propulsion Plants F02K 9/34 (20130101) Original (OR) Class F02K 9/97 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2300/6032 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340989 | Miller et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Aerojet Rocketdyne, Inc. (Sacramento, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jeff Miller (Simi Valley, California); Steven Grota (Sacramento, California) |
| ABSTRACT | A pump includes a shaft that is rotatable about a central axis. An inducer is mounted on the shaft and has an inducer blade and inducer shroud attached at an outer end of the inducer blade. An impeller is mounted on the shaft downstream of the inducer and has an impeller blade and an impeller shroud attached at an outer end of the impeller blade. There is an axially-elongated annular seal element disposed at an axial end of the inducer shroud that provides sealing between the inducer shroud and the impeller shroud. |
| FILED | Friday, October 19, 2018 |
| APPL NO | 17/282395 |
| CURRENT CPC | Non-positive-displacement Pumps F04D 29/22 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
20210341261 — Composite Enclosure for Explosive Reactive Armor and Methods of Manufacturing the Same
| US 20210341261 | Klann et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia) |
| ASSIGNEE(S) | Government of the United States, as represented by the Secretary of the Army (Washington, District of Columbia) |
| INVENTOR(S) | Shawn C. Klann (Warren, Michigan); Frederick C. Rickert, II (Royal Oak, Michigan); David B. Witherspoon (Port Huron, Michigan); William T. Hoffman (Howell, Michigan) |
| ABSTRACT | An explosive reactive armor (ERA) enclosure for an ERA tile includes a bottom and a plurality of sidewalls extending from the bottom, where the plurality of sidewalls are continuous with each other and with the bottom so as to define an internal volume. The plurality of sidewalls are formed from a fiber-reinforced composite material having a plurality of plies of fiber sheet material. Additionally, a sidewall seam defined by abutting edges of the first ply is offset from a sidewall seam defined by abutting edges of the second ply. Methods of manufacturing ERA enclosures, including applying wrap layers and forming attachment structures for securing the fiber-reinforced composite ERA enclosure to an armor element, are also described. The composite enclosure is inexpensive and lightweight and improves the dynamic capabilities of armored vehicles using such ERA tiles. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376563 |
| CURRENT CPC | Armour; Armoured Turrets; Armoured or Armed Vehicles; Means of Attack or Defence, e.g Camouflage, in General F41H 5/007 (20130101) Original (OR) Class F41H 5/013 (20130101) F41H 7/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341264 | Starr |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SensorMetrix (San Diego, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Anthony F. Starr (San Diego, California) |
| ABSTRACT | A ballistic detection system includes one or more light sources configured to transmit collimated light through a detection area; a receiver array arranged with respect to the detection area to receive the collimated light in multiple side-by-side channels, the receiver array including (i) light detectors corresponding to the multiple side-by-side channels, and (ii) lenses arranged to focus respective portions of the collimated light, which has transited the detection area, onto respective ones of the light detectors corresponding to the multiple side-by-side channels; and a ballistics analysis computer coupled with the receiver array and programmed to identify a location of a projectile that passes through the detection area by performing ratiometric comparison of signal data from the light detectors, the signal data corresponding to fractional blockage, by the projectile, of the collimated light in one or more of the multiple side-by-side channels. |
| FILED | Friday, February 05, 2021 |
| APPL NO | 17/168907 |
| CURRENT CPC | Targets; Target Ranges; Bullet Catchers F41J 5/02 (20130101) Original (OR) Class F41J 5/08 (20130101) Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags G01V 8/22 (20130101) Optical Elements, Systems, or Apparatus G02B 3/0037 (20130101) G02B 5/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341320 | Williams et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | US Gov't as represented by Secretary of Air Force (Wright-Patterson AFB, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jeremiah Williams (Dayton, Ohio); Hengky Chandraalim (Beavercreek, Ohio) |
| ABSTRACT | A passive microscopic flow sensor includes a three-dimensional microscopic optical structure formed on a cleaved tip of an optical fiber. The three-dimensional microscopic optical structure includes a post attached off-center to and extending longitudinally from the cleaved tip of the optical fiber. A rotor of the three-dimensional microscopic optical structure is received for rotation on the post. The rotor has more than one blade. Each blade has a reflective undersurface that reflects a light signal back through the optical fiber when center aligned with the optical fiber, the blades of the rotor shaped to rotate at a rate related to a flow rate. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245645 |
| CURRENT CPC | Measuring Volume, Volume Flow, Mass Flow or Liquid Level; Metering by Volume G01F 1/103 (20130101) Original (OR) Class G01F 1/115 (20130101) Measuring Force, Stress, Torque, Work, Mechanical Power, Mechanical Efficiency, or Fluid Pressure G01L 11/025 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341376 | Di Carlo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Dino Di Carlo (Los Angeles, California); Daniel R. Gossett (Los Angeles, California); Henry T.K. Tse (San Francisco, California); Aram Chung (Los Angeles, California) |
| ABSTRACT | A system for deforming and analyzing a plurality of particles carried in a sample volume includes a substrate defining an inlet, configured to receive the sample volume, and an outlet; and a fluidic pathway fluidly coupled to the inlet and the outlet. The fluidic pathway includes a delivery region configured to receive the plurality of particles from the inlet and focus the plurality of particles from a random distribution to a focused state, a deformation region defining an intersection located downstream of the delivery region and coupled to the outlet, and wherein the deformation region is configured to receive the plurality of particles from the delivery region and to transmit each particle in the plurality of particles into the intersection from a single direction, a first branch fluidly coupled to the deformation region and configured to transmit a first flow into the intersection, and a second branch fluidly coupled to the deformation region and configured to transmit a second flow, substantially opposing the first flow, into the intersection, wherein the first flow and the second flow are configured to induce extension of one or more particles in the plurality of particles. |
| FILED | Friday, March 12, 2021 |
| APPL NO | 17/200728 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/147 (20130101) Original (OR) Class G01N 15/1404 (20130101) G01N 15/1434 (20130101) G01N 15/1436 (20130101) G01N 15/1459 (20130101) G01N 15/1484 (20130101) G01N 21/645 (20130101) G01N 21/6428 (20130101) G01N 33/50 (20130101) G01N 33/5091 (20130101) G01N 2015/0065 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/4604 (20130101) Image Data Processing or Generation, in General G06T 7/0004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341403 | Shepard et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Thermal Wave Imaging, Inc. (Madison Heights, Michigan) |
| ASSIGNEE(S) | Thermal Wave Imaging, Inc. (Madison Heights, Michigan) |
| INVENTOR(S) | Steven M. Shepard (Southfield, Michigan); Maria Frendberg Beemer (Clarkston, Michigan) |
| ABSTRACT | A method for performing non-destructive testing using active thermography includes applying, using at least one thermal excitation device, a first excitation pulse to a workpiece; capturing, using an imaging device, a first iso-time frame of the workpiece; and determining a second excitation pulse by modifying one or more of a duration D of the first excitation pulse, an amplitude A of the first excitation pulse, or a spacing W between the first excitation pulse and the second excitation pulse. The method also includes applying, using the at least one of the thermal excitation device, the second excitation pulse to the workpiece; capturing, using the imaging device, a second iso-time frame of the workpiece; and determining a numerical fit of the first iso-time frame and the second iso-time frame. |
| FILED | Tuesday, April 27, 2021 |
| APPL NO | 17/242000 |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 5/10 (20130101) G01J 2005/0081 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 25/72 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341404 | Gupta et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Chaitanya Gupta (San Carlos, California); Ross M. Walker (Salt Lake City, Utah); Boris Murmann (Stanford, California); Roger T. Howe (Stanford, California) |
| ABSTRACT | A high-gain and low-noise negative feedback control (“feedback control”) system can detect charge transfer in quantum systems at room temperatures. The feedback control system can attenuate dissipative coupling between a quantum system and its thermodynamic environment. The feedback control system can be integrated with standard commercial voltage-impedance measurement system, for example, a potentiostat. In one aspect, the feedback control system includes a plurality of electrodes that are configured to electrically couple to a sample, and a feedback mechanism coupled to a first electrode of the plurality of electrodes. The feedback mechanism is configured to detect a potential associated with the sample via the first electrode. The feedback mechanism provides a feedback signal to the sample via a second electrode of the plurality of electrodes, the feedback signal is configured to provide excitation control of the sample at a third electrode of the plurality of electrode. |
| FILED | Tuesday, May 11, 2021 |
| APPL NO | 17/317422 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/028 (20130101) Original (OR) Class G01N 27/49 (20130101) G01N 27/416 (20130101) G01N 27/3273 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341459 | Alden et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cornell University (Ithaca, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jonathan Alden (Ithaca, New York); Alejandro Cortese (Ithaca, New York); Arthur Barnard (Hayward, California); Paul McEuen (Newfield, New York) |
| ABSTRACT | A nanopore-containing substrate includes a substrate, a membrane on the substrate, and at least one nanoscale electronic element disposed on or embedded in the membrane. The membrane defines at least one nanopore. The nanoscale electronic element is aligned with one of the nanopores such that a shortest distance between an edge of the nanoscale electronic element and the edge of the nanopore is less than 50 nm. The nanopores may be formed by etching through a dielectric layer using a solution while applying a voltage to the nanoscale electronic element relative to the solution. The nanopore-containing substrate can be used to detect or sequence a biopolymer, such as a nucleic acid. The nanopore-containing substrate may be used with a biopolymer detection and/or sequencing system. |
| FILED | Monday, May 17, 2021 |
| APPL NO | 17/322168 |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6869 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/4145 (20130101) G01N 27/4146 (20130101) G01N 27/44791 (20130101) G01N 33/48721 (20130101) Original (OR) Class G01N 33/54366 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341474 | Raphael et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Marc P. Raphael (Washington, District of Columbia); Joseph A. Christodoulides (Alexandria, Virginia); Jeff M. Byers (Fairfax Station, Virginia) |
| ABSTRACT | A method for the spatiotemporal mapping of receptor-ligand binding kinetics in localized surface plasmon resonance (LSPR) imaging using a chip for LSPR imaging having a glass coverslip compatible for use in a standard microscope and at least one array of functionalized plasmonic nanostructures patterned onto the glass coverslip with electron beam nanolithography and projecting a magnified image of the array to a CCD camera and monitoring the binding kinetics of the array. The nanostructures can be regenerated allowing the chip to be used multiple times. |
| FILED | Saturday, July 17, 2021 |
| APPL NO | 17/378671 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/554 (20130101) G01N 33/557 (20130101) Original (OR) Class G01N 33/54346 (20130101) G01N 33/54373 (20130101) G01N 33/54386 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341489 | ULRICH et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE GOVERNMENT OF THE UNITED STATES, AS REPRESENTED BY THE SECRETARY OF THE ARMY (Fort Detrick, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Robert G. ULRICH (Frederick, Maryland); Teddy KAMATA (Frederick, Maryland) |
| ABSTRACT | The disclosure relates to compositions, assays, methods and kits comprising one or more amino acid sequences of a filovirus protein, or a fragment thereof, which find use in the detection of a filovirus infection and/or the presence of antibodies specific for a filovirus in a biological sample. |
| FILED | Wednesday, June 03, 2015 |
| APPL NO | 15/316020 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6854 (20130101) Original (OR) Class G01N 2333/08 (20130101) G01N 2469/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341596 | Kendra |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Leidos, Inc. (Reston, Virginia) |
| ASSIGNEE(S) | Leidos, Inc. (Reston, Virginia) |
| INVENTOR(S) | John R. Kendra (Arlington, Virginia) |
| ABSTRACT | A process and systems for constructing arbitrarily large virtual arrays using two or more collection platforms (e.g. AUX and MOV systems) having differing velocity vectors. Referred to as Motion Extended Array Synthesis (MXAS), the resultant imaging system is comprised of the collection of baselines that are created between the two collection systems as a function of time. Because of the unequal velocity vectors, the process yields a continuum of baselines over some range, which constitutes an offset imaging system (OIS) in that the baselines engendered are similar to those for a real aperture of the same size as that swept out by the relative motion, but which are offset by some (potentially very large) distance. |
| FILED | Wednesday, September 30, 2020 |
| APPL NO | 17/039602 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 13/46 (20130101) G01S 13/589 (20130101) G01S 13/904 (20190501) G01S 13/9023 (20130101) Original (OR) Class G01S 2013/0254 (20130101) G01S 2013/468 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341675 | Su et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Analog Photonics LLC (Boston, Massachusetts) |
| ASSIGNEE(S) | Analog Photonics LLC (Boston, Massachusetts) |
| INVENTOR(S) | Zhan Su (Boston, Massachusetts); Erman Timurdogan (Somerville, Massachusetts); Michael Robert Watts (Hingham, Massachusetts) |
| ABSTRACT | A polarization rotator structure includes: a first core structure formed at a first layer, extending from the first end to a second end, and a second core structure formed at a second layer that is at a different depth than the first layer and formed in proximity to the first core structure. The first core structure and the second core structure provide mode hybridization between at least two orthogonally polarized waveguide modes of the PRS. An optical splitter structure is optically coupled at a first end to the second end of the PRS, and optically coupled at a second end to at least two optical waveguides, and includes: a first core structure that is contiguous with at least one of the first or second core structures of the PRS, and a second core structure that is separate from both of the first and second core structures of the PRS. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245385 |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 6/14 (20130101) G02B 6/126 (20130101) G02B 6/2726 (20130101) G02B 6/2766 (20130101) Original (OR) Class G02B 6/2773 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341814 | SAFAVI-NAEINI et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Amir-Hossein SAFAVI-NAEINI (Palo Alto, California); Christopher John SARABALIS (Menlo Park, California); Jeremy David WITMER (Palo Alto, California); Patricio ARRANGOIZ ARRIOLA (San Francisco, California); Raphael Frank J VAN LAER (Menlo Park, California) |
| ABSTRACT | Systems and methods for steering an optical beam in two dimensions are disclosed. The system includes a substrate comprising an acousto-optic antenna array and an acoustic transducer. Each antenna of the antenna array includes a high-confinement surface waveguide carrying a light signal. The acoustic transducer imparts acoustic energy into each surface waveguide as a mechanical wave. Interaction of the light signal and mechanical wave in each surface waveguide induces light to scatter into free space. The light scattered out of the plurality of waveguides collectively defines the output beam. The longitudinal angle of output beam, relative to the substrate, is determined by the relative frequencies of the mechanical waves and the light signals. The transverse angle of the output beam is controlled by controlling the relative phases of the mechanical waves and/or light signals across the surface-waveguide array. |
| FILED | Monday, May 10, 2021 |
| APPL NO | 17/315876 |
| CURRENT CPC | Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/335 (20130101) Original (OR) Class G02F 1/2955 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341833 | Sreenivasan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Sidlgata V. Sreenivasan (Austin, Texas); Shrawan Singhal (Austin, Texas); Ovadia Abed (Austin, Texas); Lawrence Dunn (Austin, Texas); Paras Ajay (Austin, Texas); Ofodike Ezekoye (Austin, Texas) |
| ABSTRACT | A method for fabricating patterns on a flexible substrate in a roll-to-roll configuration. Drops of a monomer diluted in a solvent are dispensed on a substrate, where the drops spontaneously spread and merge with one another to form a liquid resist formulation. The solvent is evaporated (e.g., blanket evaporation) from the liquid resist formulation followed by selective multi-component resist film evaporation resulting in a non-uniform and substantially continuous film on the substrate. The gap between the film on the substrate and a template is closed such that the film fills the features of the template. After cross-linking the film to polymerize the film, the template is separated from the substrate thereby leaving the polymerized film on the substrate. |
| FILED | Thursday, August 03, 2017 |
| APPL NO | 16/322842 |
| CURRENT CPC | Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor; G03F 7/0002 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342443 | PRVULOVIC et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GEORGIA TECH RESEARCH CORPORATION (Atlanta, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Milos PRVULOVIC (Atlanta, Georgia); Chia-Lin CHENG (Atlanta, Georgia); Luong N. NGUYEN (Atlanta, Georgia); Alenka ZAJIC (Atlanta, Georgia) |
| ABSTRACT | A system for detecting hardware Trojans in a computerized device includes a digital circuit having switching components operating pursuant to at least one clock frequency and positioned within an interrogation range of an incident carrier wave. A modulated backscatter response is reflected from the digital circuit upon arrival of the incident carrier wave in the presence of the switching operations. A detection device is positioned to receive the modulated backscatter response. A computer connected to the detection device identifies harmonics of a respective clock frequency of the digital circuit from the backscatter response and identifies characteristics of the harmonics indicating a presence or an absence of a hardware Trojan connected to the digital circuit. |
| FILED | Thursday, January 16, 2020 |
| APPL NO | 16/973512 |
| CURRENT CPC | Electric Digital Data Processing G06F 21/44 (20130101) G06F 21/76 (20130101) G06F 21/554 (20130101) Original (OR) Class G06F 21/556 (20130101) G06F 21/566 (20130101) G06F 30/398 (20200101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342546 | Beigi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Ghazaleh Beigi (Tempe, Arizona); Kai Shu (Mesa, Arizona); Ruocheng Guo (Sichuan, China PRC); Suhang Wang (Mesa, Arizona); Huan Liu (Tempe, Arizona) |
| ASSIGNEE(S) | Arizona Board of Regents on Behalf of Arizona State University (Tempe, Arizona) |
| INVENTOR(S) | Ghazaleh Beigi (Tempe, Arizona); Kai Shu (Mesa, Arizona); Ruocheng Guo (Sichuan, China PRC); Suhang Wang (Mesa, Arizona); Huan Liu (Tempe, Arizona) |
| ABSTRACT | Various embodiments of a computer-implemented system which learns textual representations while filtering out potentially personally identifying data and retaining semantic meaning within the textual representations are disclosed herein. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245774 |
| CURRENT CPC | Electric Digital Data Processing G06F 21/6245 (20130101) G06F 40/30 (20200101) Original (OR) Class G06F 40/211 (20200101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/6235 (20130101) G06K 2009/6237 (20130101) Computer Systems Based on Specific Computational Models G06N 3/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342578 | Pezzaniti et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Polaris Sensor Technologies, Inc. (Huntsville, Alabama) |
| ASSIGNEE(S) | |
| INVENTOR(S) | J. Larry Pezzaniti (Huntsville, Alabama); David B. Chenault (Huntsville, Alabama) |
| ABSTRACT | A method for enhancing an image for facial recognition comprises capturing an image of the face with a polarizer and correcting the polarized image for non-uniformity. Stokes Parameters S0, S1, S2 are obtained by weighted subtraction of the polarized image to form Stokes images. DoLP is computed from the Stokes images, and facial recognition algorithms are applied to the DoLP image. A system for enhancing images for facial recognition comprises a polarimeter configured to record polarized image data of a subject's face, a signal processing unit and logic configured to receive and store in memory the image data from the polarimeter, calculate Stokes parameters from the image data, and compute a DoLP image from the Stokes parameters. |
| FILED | Monday, July 19, 2021 |
| APPL NO | 17/379527 |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 5/201 (20130101) G02B 27/00 (20130101) G02B 27/288 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/209 (20130101) G06K 9/00255 (20130101) G06K 9/00275 (20130101) G06K 9/00288 (20130101) Original (OR) Class G06K 9/4661 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342652 | Glassman |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BAE Systems Information and Electronics Systems Integration Inc. (Nashua, New Hampshire) |
| ASSIGNEE(S) | BAE Systems Information and Electronic Systems Integration Inc. (Nashua, New Hampshire) |
| INVENTOR(S) | Martin S. Glassman (Nashua, New Hampshire) |
| ABSTRACT | A classifier network has at least two distinct sets of refined data, wherein the first two sets of refined data are sets of numbers representing the features values data received from sensors or a manufactured part. Performing, via at least two distinct types of support vector machines using an associated feature selection process for each classifier independently in a first layer, anomaly detection on the manufactured part. Then, using the stored data including refined data of at least two different types of data transforms and performing, via at least a two distinct types of support vector machines in a second layer, an associated feature selection process for each classifier independently. Forming at least four distinct compound classifier types for anomaly detection on the part using the stored data or coefficients. The ensemble of second layer support vector machine outputs compare the results to determine the presence of an anomaly. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/862867 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/6228 (20130101) G06K 9/6232 (20130101) G06K 9/6262 (20130101) G06K 9/6269 (20130101) Original (OR) Class G06K 9/6289 (20130101) Computer Systems Based on Specific Computational Models G06N 20/10 (20190101) G06N 20/20 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342656 | MITTAL et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF MARYLAND, COLLEGE PARK (College Park, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Trisha MITTAL (College Park, Maryland); Aniket BERA (Greenbelt, Maryland); Uttaran BHATTACHARYA (College Park, Maryland); Rohan CHANDRA (College Park, Maryland); Dinesh MANOCHA (Chapel Hill, North Carolina) |
| ABSTRACT | Systems, methods, apparatuses, and computer program products for providing multimodal emotion recognition. The method may include receiving raw input from an input source. The method may also include extracting one or more feature vectors from the raw input. The method may further include determining an effectiveness of the one or more feature vectors. Further, the method may include performing, based on the determination, multiplicative fusion processing on the one or more feature vectors. The method may also include predicting, based on results of the multiplicative fusion processing, one or more emotions of the input source. |
| FILED | Wednesday, February 10, 2021 |
| APPL NO | 17/173018 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/623 (20130101) G06K 9/6232 (20130101) G06K 9/6288 (20130101) Original (OR) Class Speech Analysis or Synthesis; Speech Recognition; Speech or Voice Processing; Speech or Audio Coding or Decoding G10L 21/10 (20130101) G10L 25/63 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342667 | OLSON et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Edwin OLSON (Ann Arbor, Michigan); Dhanvin H. MEHTA (Ann Arbor, Michigan); Gonzalo FERRER (Ann Arbor, Michigan) |
| ABSTRACT | In Multi-Policy Decision-Making (MPDM), many computationally-expensive forward simulations are performed in order to predict the performance of a set of candidate policies. In risk-aware formulations of MPDM, only the worst outcomes affect the decision making process, and efficiently finding these influential outcomes becomes the core challenge. Recently, stochastic gradient optimization algorithms, using a heuristic function, were shown to be significantly superior to random sampling. In this disclosure, it was shown that accurate gradients can be computed-even through a complex forward simulation—using approaches similar to those in dep networks. The proposed approach finds influential outcomes more reliably, and is faster than earlier methods, allowing one to evaluate more policies while simultaneously eliminating the need to design an easily-differentiable heuristic function. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/371221 |
| CURRENT CPC | Computer Systems Based on Specific Computational Models G06N 3/02 (20130101) Original (OR) Class G06N 3/008 (20130101) G06N 3/084 (20130101) G06N 7/005 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342749 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | International Business Machines Corporation (Armonk, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shiqiang Wang (White Plains, New York); Tiffany Tuor (London, United Kingdom); Changchang Liu (White Plains, New York); Thai Franck Le (White Plains, New York) |
| ABSTRACT | Techniques for adaptive asynchronous federated learning are described herein. An aspect includes providing a first version of a global parameter to a first client and a second client. Another aspect includes receiving, from the first client, a first gradient, wherein the first gradient was computed by the first client based on the first version of the global parameter and a respective first local dataset of the first client. Another aspect includes determining whether the first version of the global parameter matches a most recent version of the global parameter. Another aspect includes, based on determining that the first version of the global parameter does not match the most recent version of the global parameter, selecting a version of the global parameter. Another aspect includes aggregating the first gradient with the selected version of the global parameter to determine an updated version of the global parameter. |
| FILED | Wednesday, April 29, 2020 |
| APPL NO | 16/861284 |
| CURRENT CPC | Computer Systems Based on Specific Computational Models G06N 20/20 (20190101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343186 | LAMPOTANG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Samsun LAMPOTANG (Gainesville, Florida); David Erik Lizdas (Gainesville, Florida); Barys Valerievich Ihnatsenka (Gainesville, Florida) |
| ABSTRACT | Techniques and systems are described for providing modularity, tracking and simulation features of a mixed reality simulator. A modular approach to tracking systems, tracked instruments, and interchangeable modular physical models is described. Enhanced indicators and indicator interfaces improve imaging probe and instrument orientation and alignment with respect to a physical target, including but not necessarily within a combined physical and virtual system; these include anisotropy indicators, indicators of alignment in both in-plane and out-of-plane ultrasound or other imaging techniques, and perpendicularity indicators for better placement of probes and instruments over curved surfaces. A universal needle hub is described that integrates tracking system components and simulation feedback components usably with varying needle types. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376498 |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 19/006 (20130101) Educational or Demonstration Appliances; Appliances for Teaching, or Communicating With, the Blind, Deaf or Mute; Models; Planetaria; Globes; Maps; Diagrams G09B 9/00 (20130101) G09B 19/00 (20130101) G09B 23/285 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343321 | Wang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Regents of the University of Minnesota (Minneapolis, Minnesota) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jian-Ping Wang (Shoreview, Minnesota); Delin Zhang (Saint Paul, Minnesota); Protyush Sahu (Minneapolis, Minnesota) |
| ABSTRACT | A magnetic device may include a layer stack. The layer stack may include a first ferromagnetic layer; a spacer layer on the first ferromagnetic layer; a second ferromagnetic layer on the spacer layer; and a dielectric barrier layer on the second ferromagnetic layer. In some examples, the layer stack may also include an additional ferromagnetic layer and an additional spacer layer. The magnetic device also may include a voltage source configured to apply a bias voltage across the layer stack to cause switching of a magnetic orientation of the second ferromagnetic layer without application of an external magnetic field. |
| FILED | Wednesday, April 29, 2020 |
| APPL NO | 16/861869 |
| CURRENT CPC | Static Stores G11C 11/18 (20130101) G11C 11/161 (20130101) Original (OR) Class G11C 11/1673 (20130101) G11C 11/1675 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/222 (20130101) H01L 43/04 (20130101) H01L 43/06 (20130101) H01L 43/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343519 | Ramsey et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The University of North Carolina at Chapel Hill (Chapel Hill, North Carolina) |
| ASSIGNEE(S) | |
| INVENTOR(S) | John Michael Ramsey (Chapel Hill, North Carolina); Andrew Hampton (Auburn, Alabama); Kevin Schultze (Chapel Hill, North Carolina) |
| ABSTRACT | A miniature electrode apparatus is disclosed for trapping charged particles, the apparatus includes, along a longitudinal direction, a first end cap electrode, a central electrode having an aperture, and a second end cap electrode. The aperture is elongated in the lateral plane and extends through the central electrode along the longitudinal direction and the central electrode surrounds the aperture in a lateral plane perpendicular to the longitudinal direction to define a transverse cavity for trapping charged particles. Electric fields can be applied in a y-direction of the lateral plane across one or more planes perpendicular to the longitudinal axis to translocate and/or manipulate ion trajectories. |
| FILED | Monday, March 01, 2021 |
| APPL NO | 17/188215 |
| CURRENT CPC | Electric Discharge Tubes or Discharge Lamps H01J 49/022 (20130101) H01J 49/0027 (20130101) H01J 49/065 (20130101) Original (OR) Class H01J 49/424 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343618 | Ma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Zhenqiang Ma (Middleton, Wisconsin); Huilong Zhang (Madison, Wisconsin); Shaoqin Gong (Middleton, Wisconsin) |
| ABSTRACT | Flexible transistors and electronic circuits incorporating the transistors are provided. The flexible transistors promote heat dissipation from the active regions of the transistors while preserving their mechanical flexibility and high-frequency performance. The transistor designs utilize thru-substrate vias (TSVs) beneath the active regions of thin-film type transistors on thin flexible substrates. To promote rapid heat dissipation, the TSVs are coated with a material having a high thermal conductivity that transfers heat from the active region of the transistor to a large-area ground. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/862825 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/3672 (20130101) Original (OR) Class H01L 23/5226 (20130101) H01L 29/778 (20130101) H01L 29/66431 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343701 | Urciuoli |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | U.S Army Combat Capabilities Development Command, Army Research Laboratory (Adelphi, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Damian P. Urciuoli (Bowie, Maryland) |
| ABSTRACT | A circuit comprising a first device (e.g., a high voltage MOSFET) coupled in series with a second device (e.g., a low voltage MOSFET or HEMT). The first device comprises a body diode. Additionally, the circuit comprises a diode coupled across the pair of devices. The diode is arranged antiparallel to the first device. In one exemplary embodiment, the first device is a SiC MOSFET and the second device is a Si MOSFET or GaN HEMT. |
| FILED | Wednesday, April 29, 2020 |
| APPL NO | 16/861274 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 27/0266 (20130101) Original (OR) Class H01L 29/1608 (20130101) H01L 29/7786 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343862 | NUZZO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Ralph G. NUZZO (Champaign, Illinois); John A. ROGERS (Wilmette, Illinois); Etienne MENARD (Voglans, France); Keon Jae LEE (Daejeon, South Korea); Dahl-Young KHANG (Seoul, South Korea); Yugang SUN (Gladwyne, Pennsylvania); Matthew MEITL (Durham, North Carolina); Zhengtao ZHU (Rapid City, South Dakota) |
| ABSTRACT | The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations. |
| FILED | Thursday, June 24, 2021 |
| APPL NO | 17/357697 |
| CURRENT CPC | Processes or Apparatus Specially Adapted for the Manufacture or Treatment of Microstructural Devices or Systems B81C 2201/0185 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 10/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/308 (20130101) H01L 21/322 (20130101) H01L 21/02521 (20130101) H01L 21/02603 (20130101) H01L 21/02628 (20130101) H01L 21/6835 (20130101) H01L 23/02 (20130101) H01L 24/03 (20130101) H01L 24/05 (20130101) H01L 24/08 (20130101) H01L 24/29 (20130101) H01L 24/32 (20130101) H01L 24/80 (20130101) H01L 24/83 (20130101) H01L 24/94 (20130101) H01L 24/97 (20130101) H01L 25/0753 (20130101) H01L 27/1285 (20130101) H01L 27/1292 (20130101) H01L 29/04 (20130101) H01L 29/06 (20130101) H01L 29/12 (20130101) H01L 29/068 (20130101) H01L 29/76 (20130101) Original (OR) Class H01L 29/0665 (20130101) H01L 29/0673 (20130101) H01L 29/0676 (20130101) H01L 29/78603 (20130101) H01L 29/78681 (20130101) H01L 29/78696 (20130101) H01L 31/0392 (20130101) H01L 31/1804 (20130101) H01L 31/1864 (20130101) H01L 31/1896 (20130101) H01L 31/03926 (20130101) H01L 33/007 (20130101) H01L 33/32 (20130101) H01L 33/0093 (20200501) H01L 2221/68368 (20130101) H01L 2221/68381 (20130101) H01L 2224/03 (20130101) H01L 2224/80 (20130101) H01L 2224/83 (20130101) H01L 2224/94 (20130101) H01L 2224/95 (20130101) H01L 2224/97 (20130101) H01L 2224/0332 (20130101) H01L 2224/0345 (20130101) H01L 2224/0362 (20130101) H01L 2224/2919 (20130101) H01L 2224/03614 (20130101) H01L 2224/05073 (20130101) H01L 2224/05082 (20130101) H01L 2224/05124 (20130101) H01L 2224/05144 (20130101) H01L 2224/05155 (20130101) H01L 2224/05166 (20130101) H01L 2224/05552 (20130101) H01L 2224/05553 (20130101) H01L 2224/05554 (20130101) H01L 2224/05555 (20130101) H01L 2224/05644 (20130101) H01L 2224/05666 (20130101) H01L 2224/08225 (20130101) H01L 2224/8385 (20130101) H01L 2224/9202 (20130101) H01L 2224/32225 (20130101) H01L 2224/80006 (20130101) H01L 2224/80121 (20130101) H01L 2224/80862 (20130101) H01L 2224/80895 (20130101) H01L 2224/83005 (20130101) H01L 2224/83121 (20130101) H01L 2224/83192 (20130101) H01L 2224/83193 (20130101) H01L 2224/83862 (20130101) H01L 2924/00012 (20130101) H01L 2924/14 (20130101) H01L 2924/0665 (20130101) H01L 2924/01032 (20130101) H01L 2924/1305 (20130101) H01L 2924/1306 (20130101) H01L 2924/1461 (20130101) H01L 2924/1579 (20130101) H01L 2924/10253 (20130101) H01L 2924/10329 (20130101) H01L 2924/12032 (20130101) H01L 2924/12036 (20130101) H01L 2924/12041 (20130101) H01L 2924/12042 (20130101) H01L 2924/12043 (20130101) H01L 2924/12044 (20130101) H01L 2924/13055 (20130101) H01L 2924/13063 (20130101) H01L 2924/13091 (20130101) H01L 2924/15159 (20130101) H01L 2924/15162 (20130101) H01L 2924/15788 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/547 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 70/50 (20151101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/707 (20130101) Y10S 977/724 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343923 | OLIVER et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William D. OLIVER (Arlington, Massachusetts); Simon GUSTAVSSON (Cambridge, Massachusetts); I-Jan WANG (Cambridge, Massachusetts) |
| ABSTRACT | A superconducting qubit is manufactured by stacking up atomically-thin, crystalline monolayers to form a heterostructure held together by van der Waals forces. Two sheets of superconducting material are separated by a third, thin sheet of dielectric to provide both a parallel plate shunting capacitor and a Josephson tunneling barrier. The superconducting material may be a transition metal dichalcogenide (TMD), such as niobium disilicate, and the dielectric may be hexagonal boron nitride. The qubit is etched, or material otherwise removed, to form a magnetic flux loop for tuning. The heterostructure may be protected by adhering additional layers of the dielectric or other insulator on its top and bottom. For readout, the qubit may be coupled to an external resonator, or the resonator may be integral with one of the sheets of superconducting material. |
| FILED | Monday, November 30, 2020 |
| APPL NO | 17/106562 |
| CURRENT CPC | Computer Systems Based on Specific Computational Models G06N 10/00 (20190101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 39/025 (20130101) H01L 39/223 (20130101) Original (OR) Class H01L 39/2416 (20130101) H01L 39/2493 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343948 | Dou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| INVENTOR(S) | Letian Dou (West Lafayette, Indiana); Yao Gao (West Lafayette, Indiana); Enzheng Shi (West Lafayette, Indiana) |
| ABSTRACT | The present disclosure relates to novel two-dimensional halide perovskite materials, and the method of making and using the two-dimensional halide perovskite materials. |
| FILED | Friday, September 04, 2020 |
| APPL NO | 17/012137 |
| CURRENT CPC | Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 7/24 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/06 (20130101) C09K 2211/188 (20130101) Capacitors; Capacitors, Rectifiers, Detectors, Switching Devices or Light-sensitive Devices, of the Electrolytic Type H01G 9/20 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 35/24 (20130101) H01L 35/26 (20130101) H01L 51/0077 (20130101) Original (OR) Class Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 5/36 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344001 | Hopkins et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| INVENTOR(S) | Brandon J. Hopkins (Bethesda, Maryland); Joseph F. Parker (Riva, Maryland); Jeffrey W. Long (Alexandria, Virginia); Debra R. Rolison (Arlington, Virginia) |
| ABSTRACT | Disclosed are methods of making porous zinc electrodes. Taken together, the steps are: forming a mixture of water, a soluble compound that increases the viscosity of the mixture, an insoluble porogen, and metallic zinc powder; placing the mixture in a mold to form a sponge; optionally drying the sponge; placing the sponge in a metal mesh positioned to allow air flow through substantially all the openings in the mesh; heating the sponge in an inert atmosphere at a peak temperature of 200 to 420° C. to fuse the zinc particles to each other to form a sintered sponge; and heating the sintered sponge in an oxygen-containing atmosphere at a peak temperature of 420 to 700° C. to form ZnO on the surfaces of the sintered sponge. The heating steps burn out the porogen. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375381 |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 3/11 (20130101) B22F 3/1007 (20130101) B22F 3/1143 (20130101) B22F 2301/30 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/30 (20130101) Original (OR) Class H01M 4/38 (20130101) H01M 4/244 (20130101) H01M 4/0433 (20130101) H01M 4/0471 (20130101) H01M 10/24 (20130101) H01M 2004/027 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344036 | Hersam et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Mark C. Hersam (Wilmette, Illinois); Kan-Sheng Chen (Chicago, Illinois); Ethan B. Secor (Chicago, Illinois) |
| ABSTRACT | Composites comprising anode and cathode active materials conformally coupled to few-layered graphene, corresponding electrodes and related methods of preparation. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369058 |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/131 (20130101) H01M 4/133 (20130101) H01M 4/134 (20130101) H01M 4/136 (20130101) H01M 4/139 (20130101) H01M 4/0416 (20130101) H01M 4/505 (20130101) H01M 4/625 (20130101) H01M 4/1393 (20130101) H01M 10/0525 (20130101) Original (OR) Class H01M 2004/028 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344081 | Eskra et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Eskra Technical Products, Inc. (Saukville, Wisconsin) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Michael David Eskra (Saukville, Wisconsin); Paula Margaret Ralston (Frederick, Maryland) |
| ABSTRACT | A system and method for providing a ceramic-based separator onto an electrode is disclosed. A separator is formed on the electrode via a dry, solvent-free application of a ceramic-based separator to the electrode. An electrode is provided to an application area via a feed mechanism and a separator layer is then applied to the electrode that is comprised of a binder including at least one of a thermoplastic material and a thermoset material and an electrically non-conductive separator material, with the separator layer being applied to the electrode via a dry dispersion application. |
| FILED | Monday, June 28, 2021 |
| APPL NO | 17/304862 |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/052 (20130101) H01M 50/46 (20210101) Original (OR) Class H01M 50/403 (20210101) H01M 50/446 (20210101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344306 | ROTHE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Rohit ROTHE (Ann Arbor, Michigan); Sechang OH (Ann Arbor, Michigan); Kyojin CHOO (Ann Arbor, Michigan); Seok Hyeon JEONG (Ann Arbor, Michigan); Dennis SYLVESTER (Ann Arbor, Michigan); David T. BLAAUW (Ann Arbor, Michigan) |
| ABSTRACT | An amplifier is presented with a sample and average common mode feedback resistor. The amplifier circuit includes a feedback capacitor and a feedback resistor in parallel with the feedback capacitor, where the feedback capacitor and the feedback resistor form part of the negative feedback path for the amplifier. Of note, the feedback resistor is comprised of a low pass filter in series with a switched capacitor resistor, such that the low pass filter is electrically coupled to the output of the amplifier circuit and the switched capacitor resistor is electrically coupled to the inverting input of the amplifier circuit. The amplifier circuit further includes a control circuit interfaced with switches of the switched capacitor resistor. The high pass corner of the switched capacitor resistor is preferably lower than corner of the low pass filter. |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/243721 |
| CURRENT CPC | Amplifiers H03F 1/34 (20130101) Original (OR) Class H03F 3/45475 (20130101) H03F 2200/171 (20130101) H03F 2200/331 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344417 | AHADIAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ULTRA COMMUNICATIONS, INC. (Vista, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Joseph F. AHADIAN (San Marcos, California); Vahid NAZER (San Marcos, California); Sandra SKENDZIC (Vista, California); Charles B. KUZNIA (Encinitas, California); Richard J. WEISS (San Diego, California) |
| ABSTRACT | Methods and systems for automated health assessment of fiber optic links of a fiber optic communication system are described. Tables are used to describe the fiber optic links, including access addresses to communication modules used in the links. Telemetry data representative of operation of the communication modules can be read via the access addresses into a central station. OTDR/OFDR measurement data of fiber optic segments used in the links can be read via the access addresses into the central station. The telemetry and/or OTDR/OFDR measurement data can be used by the central station for comparison against reference data to assess health of the links. The communication modules locally and continuously capture the telemetry data to detect transient events that may be the result of tampering of the links. |
| FILED | Monday, May 17, 2021 |
| APPL NO | 17/322743 |
| CURRENT CPC | Transmission H04B 10/071 (20130101) Original (OR) Class H04B 10/0793 (20130101) H04B 10/07955 (20130101) H04B 10/07957 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344554 | Farritor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shane Farritor (Lincoln, Nebraska); Tyler Wortman (Grand Island, Nebraska); Kyle Strabala (Pittsburgh, Pennsylvania); Ryan McCormick (Valencia, California); Amy Lehman (York, Nebraska); Dmitry Oleynikov (Omaha, Nebraska); Eric Markvicka (Lincoln, Nebraska) |
| ABSTRACT | Various medical devices and related systems, including robotic and/or in vivo medical devices, and various robotic surgical devices for in vivo medical procedures. Included herein, for example, is a robotic surgical system having a support beam positionable through an incision, and a robotic device having a device body, first and second rotating shoulder components coupled to the device body, and first and second robotic arms coupled to the first and second shoulder components, respectively. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/340669 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 34/30 (20160201) A61B 90/30 (20160201) A61B 90/361 (20160201) A61B 2034/302 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/06 (20130101) B25J 9/0087 (20130101) Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 2219/40418 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 41/0631 (20130101) Original (OR) Class H04L 43/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344616 | Blumrich et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NVIDIA Corp. (Santa Clara, California) |
| ASSIGNEE(S) | NVIDIA Corp. (Santa Clara, California) |
| INVENTOR(S) | Matthias Augustin Blumrich (Ridgefield, Connecticut); Nan Jiang (Acton, Massachusetts); Larry Robert Dennison (Mendon, Massachusetts) |
| ABSTRACT | A switch architecture enables ports to stash packets in unused buffers on other ports, exploiting excess internal bandwidth that may exist, for example, in a tiled switch. This architecture leverages unused port buffer memory to improve features such as congestion handling and error recovery. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/377943 |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 49/70 (20130101) H04L 49/101 (20130101) Original (OR) Class H04L 49/254 (20130101) H04L 49/3036 (20130101) H04L 49/9047 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210345038 | Ghaffarivardavagh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Reza Ghaffarivardavagh (Boston, Massachusetts); Sayed Saad Afzal (Cambridge, Massachusetts); Osvy Rodriguez (Cambridge, Massachusetts); Fadel Adib (Cambridge, Massachusetts) |
| ABSTRACT | An ultra-wide bandwidth acoustic transducer may include multiple layers, including an inner piezoelectric layer, a polymer coupling layer and an outer piezoelectric layer. The polymer layer may be located between, and may be bonded to, the inner and outer piezoelectric layers. The transducer may have multiple eigenfrequencies of vibration. These eigenfrequencies may include primary resonant frequencies of the inner and outer piezoelectric layers respectively and may also include resonant frequencies that arise due to coupling between the layers. An acoustic backscatter system may employ such a transducer in backscatter nodes as well as in a transmitter. The multiple eigenfrequencies may enable the system to perform spread-spectrum communication at a high throughput. These multiple eigenfrequencies may also enable each backscatter node to shift frequency of an uplink signal, which in turn may enable the system to mitigate self-interference and to decode concurrent signals from multiple backscatter nodes. |
| FILED | Sunday, April 11, 2021 |
| APPL NO | 17/227334 |
| CURRENT CPC | Loudspeakers, Microphones, Gramophone Pick-ups or Like Acoustic Electromechanical Transducers; Deaf-aid Sets; Public Address Systems H04R 1/44 (20130101) Original (OR) Class H04R 17/005 (20130101) H04R 17/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210345102 | Win et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Moe Z. Win (Framingham, Massachusetts); Tianyi Peng (Somerville, Massachusetts); Wenhan Dai (Cambridge, Massachusetts); Zehao Yu (Cambridge, Massachusetts) |
| ABSTRACT | Physical layer key generation provides privacy protection technique suitable for devices with limited computational ability. A key generation algorithm is based on OFDM waveforms. By exploiting the holistic CSI, key generation rate (KGR) is improved significantly. A cross-layer encryption protocol is based on the key generation algorithm and the AES. The secrecy of the encryption is enhanced compared to traditional encryption schemes with one pre-shared key (e.g., WPA2-PSK), even when some generated keys are leaked to the eavesdropper. The results lead to practical and robust applications of physical layer key generation. |
| FILED | Tuesday, September 08, 2020 |
| APPL NO | 17/014611 |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 9/085 (20130101) H04L 9/0875 (20130101) Wireless Communication Networks H04W 12/03 (20210101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210345132 | Jagannath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ANDRO Computational Solutions, LLC (Rome, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jithin Jagannath (Oriskany, New York); Anu Jagannath (Oriskany, New York); Andrew Louis Drozd (Rome, New York) |
| ABSTRACT | Embodiments of the disclosure provide a system for operating a radio frequency (RF) network having a plurality of communication nodes. A network transceiver communicates with communication nodes in the RF network. A computing device coupled to the network transceiver performs actions including: evaluating a state of the RF network using a machine learning model, based on a spectrum environment and a communication objective, generating a set of communication parameters based on the state of the RF network, causing the network transceiver to communicate with the a communication node using the generated set of communication parameters, and modifying the machine learning model based on a result of causing the network transceiver to communicate with the communication node. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245156 |
| CURRENT CPC | Wireless Communication Networks H04W 24/02 (20130101) Original (OR) Class H04W 72/085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Energy (DOE)
| US 20210338142 | Arnold et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | KNOW BIOLOGICAL, INC. (Milton, Georgia); National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Gary Stephen Arnold (Cumming, Georgia); Matthew Wallace Moorman (Albuquerque, New Mexico); Joshua Jonathan Whiting (Albuquerque, New Mexico) |
| ABSTRACT | Example aspects of a volatile organic compound detection device, a wearable health monitoring device, and a method of monitoring a user's health are disclosed. The volatile organic compound detection device can comprise a collector comprising a collector material configured to collect volatile organic compounds given off from a user's skin; a separator comprising a gas chromatography column configured to separate mixtures of the volatile organic compounds into their constituent chemicals; and an identifier comprising a detector and a processor, the detector configured to transduce the the constituent chemicals into a signal, the processor configured to process the signal to identify specific volatile organic compounds indicative of a health condition. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/340195 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/443 (20130101) A61B 5/4094 (20130101) Original (OR) Class A61B 5/6831 (20130101) A61B 5/6833 (20130101) A61B 10/00 (20130101) A61B 2010/0083 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 30/00 (20130101) G01N 30/20 (20130101) G01N 30/64 (20130101) G01N 30/80 (20130101) G01N 2030/025 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338463 | Mukerjee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| ASSIGNEE(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California); The Brigham and Women's Hospital, Inc. (Boston, Massachusetts); Duke University (Durham, North Carolina) |
| INVENTOR(S) | Erik V. Mukerjee (Livermore, California); Jane A. Leopold (Chestnut Hill, Massachusetts); Amanda Randles (Durham, North Carolina) |
| ABSTRACT | A stent apparatus, system, and method that senses wall shear stress by measuring fluid flow at localized areas within the stent, that processes measured information through an integrated circuit, and selectively sends power to mechanically controllable stent surfaces which results in localized geometric changes. In various embodiments the stent apparatus, system, and method sends data to outside the body in real time. |
| FILED | Tuesday, July 13, 2021 |
| APPL NO | 17/374616 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/4851 (20130101) A61B 5/6862 (20130101) A61B 5/6876 (20130101) Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/07 (20130101) A61F 2/90 (20130101) Original (OR) Class A61F 2002/828 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 31/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338880 | Maitland et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California); THE TEXAS A and M UNIVERSITY SYSTEM (College Station, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Duncan J. Maitland (College Station, Texas); Todd Lawrence Landsman (College Station, Texas); Tyler Joseph Touchet (Cypress, Texas); Elizabeth L. Cosgriff-Hernandez (College Station, Texas); Thomas S. Wilson (San Leandro, California) |
| ABSTRACT | An embodiment includes a wound dressing comprising: a shape memory polymer (SMP) foam, including open cells, having first and second states; and a hydrogel (HG) included within the cells; wherein (a) in a first position a composite, including the SMP foam and the HG, is configured to be located proximate a hemorrhagic tissue with the SMP foam in the first state; (b) in a second position the composite is configured to be expanded to the second state against the hemorrhagic tissue when the SMP foam is plasticized at 37° C. depressing a glass transition temperature (Tg) of the SMP foam to below 25° C. Other embodiments are described herein. |
| FILED | Tuesday, June 01, 2021 |
| APPL NO | 17/335316 |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 13/00017 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 15/18 (20130101) Original (OR) Class A61L 15/26 (20130101) A61L 15/46 (20130101) A61L 15/425 (20130101) A61L 24/0015 (20130101) A61L 24/0036 (20130101) A61L 24/0094 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339186 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rutgers, The State University of New Jersey (New Brunswick, New Jersey) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jing Li (Piscataway, New Jersey); Hao Wang (Shenzhen, China PRC) |
| ABSTRACT | The present disclosure relates to novel metal-organic frameworks (MOFs) comprising tetratopic ligands with small pore apertures. The present disclosure further relates to methods of utilizing the MOFs of the disclosure to separate hydrocarbons through adsorptive processes. |
| FILED | Friday, September 13, 2019 |
| APPL NO | 17/274388 |
| CURRENT CPC | Separation B01D 53/0423 (20130101) Original (OR) Class B01D 2253/204 (20130101) B01D 2256/24 (20130101) B01D 2257/7022 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 5/003 (20130101) C07F 7/003 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339473 | MORAN |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Bryan D. MORAN (Pleasanton, California) |
| ABSTRACT | The present disclosure relates to a method for forming a three dimensional (3D) component from a photopolymer resin. The method may involve generating a first optical beam at a first wavelength, with the first optical beam causing polymerization of a photopolymerizable resist. A second optical beam is generated at a second wavelength, different from the first wavelength, which inhibits polymerization of the photopolymerizable resist. A device is used to receive the first and second optical beams and to generate therefrom corresponding separate first and second light patterns, respectively, where the first light pattern forms a first image on the photopolymerizable resist to cause polymerization of a first portion of the photopolymerizable resist, while the second light pattern forms a second image on the photopolymerizable resist and inhibits polymerization of a second portion of the photopolymerizable resist. |
| FILED | Friday, June 11, 2021 |
| APPL NO | 17/345158 |
| CURRENT CPC | Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/268 (20170801) Original (OR) Class B29C 64/277 (20170801) B29C 64/393 (20170801) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 50/02 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339515 | Holowczak et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Hamilton Sundstrand Corporation (Charlotte, North Carolina) |
| ASSIGNEE(S) | |
| INVENTOR(S) | John E. Holowczak (South Windsor, Connecticut); Paul Sheedy (Bolton, Connecticut); Justin B. Alms (Coventry, Connecticut); John J. Gangloff, JR. (Middletown, Connecticut); Daniel A. Mosher (Glastonbury, Connecticut); Rajiv Ranja (South Windsor, Connecticut); Brian St. Rock (Andover, Connecticut) |
| ABSTRACT | A laminate composite structure having at least one tubular region and at least one bonded region. The structure has a first composite layer, a second composite layer, a cavity, and one or more reinforcing fibers. Each composite layer comprises composite material with a top face and a bottom face opposite the top face. The top face of one is joined to the bottom face of the other along an interlaminar region. The cavity separates the bottom face and the top face to form a tube. The tube has an internal boundary defined by the bottom face and the top face. The reinforcing fibers line the internal boundary and are arranged so that the reinforcing fibers reduce the propensity of the composites layer to separate under internal pressure loading. |
| FILED | Thursday, February 18, 2021 |
| APPL NO | 17/179038 |
| CURRENT CPC | Layered Products, i.e Products Built-up of Strata of Flat or Non-flat, e.g Cellular or Honeycomb, Form B32B 18/00 (20130101) B32B 37/10 (20130101) B32B 37/0053 (20130101) Original (OR) Class B32B 38/1808 (20130101) B32B 2038/0072 (20130101) Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 35/83 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340011 | LAINE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Richard M. LAINE (Ann Arbor, Michigan); Eleni TEMECHE (Ann Arbor, Michigan); Xinyu ZHANG (Ann Arbor, Michigan) |
| ABSTRACT | A method of synthesizing a precursor for making a polymer, glass, or ceramic material is provided. The method includes reacting OPCl3 with NH3 or MNH2, where M is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form O═P(NH2)3. The method then includes either: (i) reacting the O═P(NH2)3 with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor; or (ii) heating the O═P(NH2)3 to form a branched or cyclomeric compound, and reacting the branched or cyclomeric compound with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor. The precursor is an oligomer or a polymer. Uses for the precursor and the polymer, glass, or ceramic material as binders, sintering aids, adhesives, and electrolytes in battery components are also provided. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/271244 |
| CURRENT CPC | Non-metallic Elements; Compounds Thereof; C01B 21/0823 (20130101) Original (OR) Class Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/0525 (20130101) H01M 10/0562 (20130101) H01M 2300/0071 (20130101) H01M 2300/0085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340048 | Visco et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PolyPlus Battery Company (Berkeley, California) |
| ASSIGNEE(S) | PolyPlus Battery Company (Berkeley, California) |
| INVENTOR(S) | Steven J. Visco (Berkeley, California); Yevgeniy S. Nimon (Danville, California); Bruce D. Katz (Moraga, California) |
| ABSTRACT | Manufacturing methods can involve use of a vessel apparatus for making Li ion conducting sulfide glass by melt processing the inside the vessel apparatus, the apparatus having a liner assembly in an ampoule assembly providing an interior wall component that is chemically compatible in direct contact with the molten sulfide glass and maintains intimate thermal contact with the interior wall surface of the ampoule assembly. |
| FILED | Wednesday, April 28, 2021 |
| APPL NO | 17/243429 |
| CURRENT CPC | Manufacture, Shaping, or Supplementary Processes C03B 5/43 (20130101) Original (OR) Class C03B 17/064 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340070 | Sandhage |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Purdue Research Foundation (West Lafayette, Indiana) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Kenneth Henry Sandhage (Lafayette, Indiana) |
| ABSTRACT | Materials systems resistant to penetration of molten salts and may be present within a molten-salt-facing wall of a device for containing a molten salt bath at an elevated temperature, and molten-salt-facing walls and devices formed by such materials systems. A first layer of such a system defines an outer surface for direct contact with the molten salt bath, and resists erosion and corrosion and is penetrable by the molten salt at the elevated temperature. A second layer is located adjacent to the first layer and exhibits little or no wetting by the molten salt so that at least a portion of a thickness of the second layer is not penetrable by the molten salt. A third layer is located adjacent to the second layer and is porous and exhibits a low thermal conductivity at the elevated temperature. |
| FILED | Thursday, April 01, 2021 |
| APPL NO | 17/220605 |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 19/02 (20130101) B01J 19/0013 (20130101) Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 28/06 (20130101) C04B 28/105 (20130101) C04B 41/009 (20130101) C04B 41/65 (20130101) Original (OR) Class C04B 41/5001 (20130101) C04B 2111/2084 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 5/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340307 | Noonan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CARNEGIE MELLON UNIVERSITY (PITTSBURGH, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Kevin Noonan (Pittsburgh, Pennsylvania); Ryan Selhorst (Dayton, Ohio); Jamie Gaitor (Pittsburgh, Pennsylvania) |
| ABSTRACT | A statistical, cationic-functionalized norbornene copolymer is formed by a process including performing a vinyl addition polymerization in the presence of a metal catalyst of a first norbornene monomer substituted with a first alkyl group and at least a second norbornene monomer substituted with a second alkyl group, to form an intermediate norbornene copolymer. The second alkyl group includes a substituent which undergoes a substitution reaction with a precursor of a cationic group. The process further includes adding the precursor for the cationic group to the intermediate norbornene copolymer to form the cationic functionalized norbornene copolymer. The cationic group has a volume of 0.25 cm3/mol or greater (for example, a phosphonium group or an imidazolium group). |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/243877 |
| CURRENT CPC | Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 232/08 (20130101) C08F 287/00 (20130101) C08F 299/00 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340423 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yuzhan Li (Oak Ridge, Tennessee); Kyle R. Gluesenkamp (Oak Ridge, Tennessee); Monojoy Goswami (Oak Ridge, Tennessee); Navin Kumar (Oak Ridge, Tennessee); Timothy J. Laclair (Oak Ridge, Tennessee); Orlando Rios (Oak Ridge, Tennessee) |
| ABSTRACT | A phase change material composition for latent heat storage is provided. In one embodiment, the phase change material includes a salt hydrate having a melting temperature (Tm) of from 1° C. to 100° C. as determined in accordance with ASTM E793. The phase change material further includes a stabilizing matrix including a polysaccharide selected from the group of a nanocellulose, a sulfonated polysaccharide, a starch, a glycogen, a chitin, and combinations thereof. A composite article including the phase change material composition is also provided. |
| FILED | Tuesday, April 13, 2021 |
| APPL NO | 17/229035 |
| CURRENT CPC | Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 5/063 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340437 | Mabe et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California); Ludlum Measurements, Inc. (Sweetwater, Texas); National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| ASSIGNEE(S) | Lawrence Livermore National Security, LLC (Livermore, California); National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico); Ludlum Measurements, Inc. (Sweetwater, Texas); National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| INVENTOR(S) | Andrew Neil Mabe (Livermore, California); M Leslie Carman (San Ramon, California); Stephen Anthony Payne (Castro Valley, California); Natalia P. Zaitseva (Livermore, California); Charles R. Hurlbut (Sweetwater, Texas); Terence C. O'Brien (Sweetwater, Texas); Kyle Ray Shipp (Sweetwater, Texas); Nicholas Richard Myllenbeck (Livermore, California) |
| ABSTRACT | A plastic scintillator includes a polymer matrix, an aliphatic additive present in the polymer matrix in an effective amount to impart fog resistance to the plastic scintillator, and at least one fluorescent dye in the polymer matrix, the dye being effective to provide scintillation upon exposure to radiation. The effective amount of the aliphatic additive is in a range of greater than 0 weight percent up to 5 weight percent relative to the total weight of the plastic scintillator. Moreover, the aliphatic additive has a structure comprising up to 300 repeat units. |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/244805 |
| CURRENT CPC | Working-up; General Processes of Compounding; After-treatment Not Covered by Subclasses C08B, C08C, C08F, C08G or C08H C08J 3/20 (20130101) Use of Inorganic or Non-macromolecular Organic Substances as Compounding Ingredients C08K 5/353 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 11/02 (20130101) Original (OR) Class C09K 11/06 (20130101) C09K 2211/1007 (20130101) C09K 2211/1018 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340452 | HAFENSTINE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Glenn Richard HAFENSTINE (Wheat Ridge, Colorado); Derek Richard VARDON (Lakewood, Colorado); Xiangchen HUO (Golden, Colorado); Nabila Asem HUQ (Boulder, Colorado) |
| ABSTRACT | The present disclosure relates to a composition that includes a first oxide having a phosphate, a ratio of Brønsted acid sites to Lewis acid sites between 0.05 and 1.00, and a total acidity between 50 μmol/g and 300 μmol/g, where the phosphate is at least one of a functional group covalently bonded to the first oxide and/or an anion ionically bonded to the first oxide. |
| FILED | Monday, July 19, 2021 |
| APPL NO | 17/379477 |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 23/44 (20130101) B01J 27/195 (20130101) B01J 27/1802 (20130101) B01J 35/023 (20130101) B01J 35/026 (20130101) B01J 35/1014 (20130101) B01J 35/1019 (20130101) B01J 35/1038 (20130101) B01J 35/1042 (20130101) Acyclic or Carbocyclic Compounds C07C 41/09 (20130101) Fuels Not Otherwise Provided for; Natural Gas; Synthetic Natural Gas Obtained by Processes Not Covered by Subclasses C10G, C10K; Liquefied Petroleum Gas; Adding Materials to Fuels or Fires to Reduce Smoke or Undesirable Deposits or to Facilitate Soot Removal; Firelighters C10L 1/02 (20130101) C10L 1/023 (20130101) C10L 1/026 (20130101) Original (OR) Class C10L 2200/0423 (20130101) C10L 2200/0446 (20130101) C10L 2270/023 (20130101) C10L 2270/026 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340553 | Hittinger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Chris Todd Hittinger (Madison, Wisconsin); EmilyClare Patricia Baker (Madison, Wisconsin) |
| ABSTRACT | Polypeptides comprising maltose/maltotriose transporters are provided. Additionally, polynucleotides, DNA constructs, and vectors encoding a maltose/maltotriose transporter, or yeast cells harboring such polynucleotides are provided. The yeast cell may be a Saccharomyces eubayanus cell modified to increase the expression or transport activity of a maltose/maltotriose transporter at the plasma membrane of the cell. Further, methods are provided for making a fermentation product by culturing any one of the yeast cells described herein with a fermentable substrate. Finally, methods are provided to select for and isolate maltotriose-utilizing strains of Saccharomyces eubayanus. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/341224 |
| CURRENT CPC | Peptides C07K 14/395 (20130101) Beer; Preparation of Beer by Fermentation; Preparation of Malt for Making Beer; Preparation of Hops for Making Beer C12C 11/00 (20130101) Wine; Preparation Thereof; Alcoholic Beverages; Preparation of Alcoholic Beverages Not Provided for in Subclasses C12C or C12H C12G 1/0203 (20130101) C12G 3/02 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/16 (20130101) C12N 15/81 (20130101) Original (OR) Class C12N 2500/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340683 | Zhang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Tennessee Research Foundation (Knoxville, Tennessee) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Feng Yuan Zhang (Tullahoma, Tennessee); Kui Li (Tullahoma, Tennessee) |
| ABSTRACT | A ruthenium-copper (RuCu) nano-sponge (NSP) electrocatalyst for use in the electrolytic reduction of nitrogen to provide ammonia is described. The RuCu NSP can be prepared as a porous nanoparticle comprising a RuCu alloy via facile reduction of Ru and Cu precursors under ambient conditions. Electrodes prepared with surface disposed RuCu NSPs can be used to prepare ammonia from nitrogen with good yields and Faradaic efficiency at room temperature and atmospheric pressure. |
| FILED | Friday, October 30, 2020 |
| APPL NO | 17/085720 |
| CURRENT CPC | Ammonia; Cyanogen; Compounds Thereof C01C 1/00 (20130101) Electrolytic or Electrophoretic Processes for the Production of Compounds or Non-metals; Apparatus Therefor C25B 1/00 (20130101) C25B 11/035 (20130101) Original (OR) Class C25B 11/0431 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340688 | FREIDERICH et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Consolidated Nuclear Security, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | |
| INVENTOR(S) | John W. FREIDERICH (Oak Ridge, Tennessee); Tasha L. BOYD (Clinton, Tennessee) |
| ABSTRACT | Methods for electropolishing and coating aluminum on a surface of an air and/or moisture sensitive substrate, including: in a vessel, submerging the substrate in a first molten salt bath and applying an anodizing current to the substrate at a first temperature to electropolish the surface of the substrate; wherein the first molten salt bath includes one of a first organic salt bath and first inorganic salt bath; wherein, when used, the first organic salt bath includes one of (a) aluminum halide and ionic liquid, (b) a combination of an aluminum halide and halogenatedmethylphenylsulfone (C6(H5-y,Xy)SO2CX3, where y is a number from 0-5), (c) a combination of an aluminum halide, an ionic liquid, and halogenatedmethylphenylsulfone (C6(H5-y,Xy)SO2CX3), and (d) AlF3-organofluoride-hydrofluoric acid adduct; wherein, when used, the first inorganic salt bath includes aluminum halide and alkali metal halide; and wherein the anodizing current is 10-30 mA/cm2. |
| FILED | Monday, July 19, 2021 |
| APPL NO | 17/379395 |
| CURRENT CPC | Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 18/31 (20130101) Processes for the Electrolytic or Electrophoretic Production of Coatings; Electroforming; Apparatus Therefor C25D 3/44 (20130101) C25D 3/665 (20130101) C25D 5/44 (20130101) Processes for the Electrolytic Removal of Materials From Objects; Apparatus Therefor C25F 3/16 (20130101) C25F 3/20 (20130101) Original (OR) Class C25F 3/22 (20130101) C25F 3/26 (20130101) C25F 3/28 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340692 | Mirkin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Chad A. Mirkin (Wilmette, Illinois); Taegon Oh (Evanston, Illinois); Sarah S. Park (Evanston, Illinois) |
| ABSTRACT | A post-synthetic method for stabilizing colloidal crystals programmed from nucleic acid is disclosed herein. In some embodiments, the method relies on Ag+ ions to stabilize the particle-connecting nucleic acid duplexes within the crystal lattice, essentially transforming them from loosely bound structures to ones with very strong interparticle links. In some embodiments, the nucleic acid is DNA. Such crystals do not dissociate as a function of temperature like normal DNA or DNA-interconnected colloidal crystals, and they can be moved from water to organic media or the solid state, and stay intact. The Ag+-stabilization of the nucleic acid (e.g., DNA) bonds is accompanied by a nondestructive contraction of the lattice, and both the stabilization and contraction are reversible with the chemical extraction of the Ag+ ions, e.g., by AgCl precipitation with NaCl. |
| FILED | Wednesday, September 25, 2019 |
| APPL NO | 17/272139 |
| CURRENT CPC | Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 7/08 (20130101) C30B 29/02 (20130101) Original (OR) Class C30B 29/58 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341369 | GE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shencheng GE (Boston, Massachusetts); Yunzhe WANG (Baltimore, Maryland); Nicolas J. DESHLER (Berkeley, California); Daniel J. PRESTON (Houston, Texas); George M. WHITESIDES (Newton, Massachusetts) |
| ABSTRACT | A device is disclosed, including: a plate including a sample deposition tube adapted to receive a sample comprising one or more analytes, the sample deposition tube defining a vertical axis substantially perpendicular to a main surface of the plate; and a mirror positioned to project, substantially parallel to the main surface of the plate, an image of the sample deposition tube along its vertical axis, so as to allow determination of the vertical location of the one or more analytes inside the sample deposition tube. Methods for determining the density of one or more analytes using various embodiments of the device are also described. |
| FILED | Friday, May 17, 2019 |
| APPL NO | 17/056142 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 9/18 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341399 | Graves et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William Graves (Tempe, Arizona); Lucas Malin (Tempe, Arizona) |
| ABSTRACT | A method includes simulating diffraction in a transmission geometry of relativistic electron bunches from a crystallographic structure of a crystal thereby simulating diffraction of the relativistic electron bunches into a plurality of Bragg peaks. The method includes selecting a range of angles between a direction of propagation of the relativistic electron bunches and a normal direction of crystal including an angle at which a diffraction portion is maximized. The method includes sequentially accelerating a plurality of physical electron bunches to relativistic energies toward a physical crystal having the crystallographic structure and diffracting the plurality of physical electron bunches off the physical crystal at different angles and measuring the diffraction portion into the respective Bragg peak at the different angles. The method includes selecting a final angle based on the measured diffraction portion into the respective Bragg peak at the different angles and generating a pulse of light. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378094 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 23/20008 (20130101) Original (OR) Class G01N 2223/102 (20130101) G01N 2223/0565 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341439 | Van Berkel |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-BATTELLE, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Gary J. Van Berkel (Oak Ridge, Tennessee) |
| ABSTRACT | A system for sampling a sample material includes a probe which can have an outer probe housing with an open end. A liquid supply conduit within the housing has an outlet positioned to deliver liquid to the open end of the housing. The liquid supply conduit can be connectable to a liquid supply for delivering liquid at a first volumetric flow rate to the open end of the housing. A liquid exhaust conduit within the housing is provided for removing liquid from the open end of the housing. A liquid exhaust system can be provided for removing liquid from the liquid exhaust conduit at a second volumetric flow rate. A droplet dispenser can dispense drops of a sample or a sample-containing solvent into the open end of the housing. A sensor and a processor can be provided to monitor and maintain a liquid dome present at the open end. |
| FILED | Tuesday, January 12, 2021 |
| APPL NO | 17/147450 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/443 (20130101) A61B 10/02 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/00 (20130101) G01N 1/20 (20130101) G01N 30/7233 (20130101) Original (OR) Class G01N 35/1095 (20130101) G01N 2030/027 (20130101) Electric Discharge Tubes or Discharge Lamps H01J 49/0404 (20130101) H01J 49/0431 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341764 | Du et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Qiang Du (Pleasanton, California); Russell B. Wilcox (Berkeley, California); Tong Zhou (San Pablo, California); Lawrence R. Doolittle (Walnut Creek, California); Gang Huang (Fremont, California); Derun Li (Concord, California) |
| ABSTRACT | This disclosure provides systems, methods, and apparatus related to optical systems. In one aspect, a method includes: generating a plurality of laser beams; receiving the plurality of laser beams at the point at a diffractive optical element, the diffracting optical element diffracting the plurality of laser beams to generate a plurality of output laser beams including a central laser beam and a plurality of side laser beams; measuring a power of at least two of the plurality of output laser beams generated by the diffractive optical element; determining a phase error in laser beams of the plurality of laser beams from the power of the at least two of the plurality of output laser beams; and changing the phase N−1 laser beams of the plurality of laser beams, with N being a number of the plurality of laser beams. |
| FILED | Thursday, April 22, 2021 |
| APPL NO | 17/237384 |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 27/1086 (20130101) G02B 27/4277 (20130101) Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/0121 (20130101) Original (OR) Class G02F 2203/50 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/23 (20130101) H01S 3/0085 (20130101) H01S 3/06754 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341903 | Vernon |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri) |
| ASSIGNEE(S) | Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri) |
| INVENTOR(S) | Gregory John Vernon (Kansas City, Missouri) |
| ABSTRACT | A system and method of creating a shape-conforming lattice structure for a part formed via additive manufacturing. The method includes receiving a computer model of the part and generating a finite element mesh. A lattice structure including a number of lattice cellular components may also be generated. Some of the mesh elements of the finite element mesh may be deformed so that the finite element mesh conforms to the overall shape of the part. The lattice structure may then be deformed so that the lattice structure has a cellular periodicity corresponding to the finite elements of the finite element mesh. In this way, the part retains the benefits of its overall shape and the benefits of lattice features without introducing structural weak points, directional stresses, and other structural deficiencies. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/367936 |
| CURRENT CPC | Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 64/386 (20170801) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 50/02 (20141201) Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 19/4099 (20130101) Original (OR) Class G05B 2219/35134 (20130101) G05B 2219/49007 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 90/02 (20151101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341991 | Yoon et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Battelle Energy Alliance, LLC (Idaho Falls, Idaho) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Su Jong Yoon (Idaho Falls, Idaho); Jeffery A. Aguiar (Salt Lake City, Utah); Johanna H. Oxstrand (ldaho Falls, Idaho); Katya L. Le Blanc (ldaho Falls, Idaho) |
| ABSTRACT | Systems, devices, and methods are described for performing augmented reality (AR) to assist user performing a task in an environment. An AR device may be configured to capture real-time data. An AR engine may be configured to monitor user behavior from the real-time data responsive to feature extraction from the real-time data, compare the user behavior to pre-defined work procedures, and generate augmented reality objects to be output by the AR device. |
| FILED | Wednesday, October 02, 2019 |
| APPL NO | 17/250895 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/02438 (20130101) Electric Digital Data Processing G06F 3/011 (20130101) Original (OR) Class G06F 3/017 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/00335 (20130101) G06K 9/00671 (20130101) Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/063114 (20130101) Wireless Communication Networks H04W 4/80 (20180201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342285 | SEYEDZADEHDELCHEH et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ADVANCED MICRO DEVICES, INC. (Santa Clara, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | SeyedMohammad SEYEDZADEHDELCHEH (Bellevue, Washington); Steven RAASCH (Austin, Texas); Sergey BLAGODUROV (Bellevue, Washington) |
| ABSTRACT | Data are serially communicated over an interconnect between an encoder and a decoder. The encoder includes a first training unit to count a frequency of symbol values in symbol blocks of a set of N number of symbol blocks in an epoch. A circular shift unit of the encoder stores a set of most-recently-used (MRU) amplitude values. An XOR unit is coupled to the first training unit and the first circular shift unit as inputs and to the interconnect as output. A transmitter is coupled to the encoder XOR unit and the interconnect and thereby contemporaneously sends symbols and trains on the symbols. In a system, a device includes a receiver and decoder that receive, from the encoder, symbols over the interconnect. The decoder includes its own training unit for decoding the transmitted symbols. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863149 |
| CURRENT CPC | Electric Digital Data Processing G06F 13/4027 (20130101) Original (OR) Class G06F 13/4282 (20130101) Coding; Decoding; Code Conversion in General H03M 7/30 (20130101) H03M 9/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342958 | Dobrzynski et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| ASSIGNEE(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| INVENTOR(S) | Daniel S. Dobrzynski (Forest Park, Illinois); Jason D. Harper (Plainfield, Illinois) |
| ABSTRACT | A charging management system includes a network interface, a memory, and a processing circuit including a processor. The processing circuit is configured to determine monetary information related to an energy price, determine an electrical vehicle (EV) power limit PLIM for a total amount of EVs in an EV charging network, transmit the monetary information to two or more agents, each of the two or more agents associated with an EV in the EV charging network, receive, from each of the two or more agents, a bid including: an agent monetary value, a desired charging rate PD, and a charging interval, and allow the EVs associated with the two or more agents to be charged based on each of the bids. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863958 |
| CURRENT CPC | Propulsion of Electrically-propelled Vehicles; Supplying Electric Power for Auxiliary Equipment of Electrically-propelled Vehicles; Electrodynamic Brake Systems for Vehicles in General; Magnetic Suspension or Levitation for Vehicles; Monitoring Operating Variables of Electrically-propelled Vehicles; Electric Safety Devices for Electrically-propelled Vehicles B60L 53/62 (20190201) B60L 53/665 (20190201) Data Processing Systems or Methods, Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes; Systems or Methods Specially Adapted for Administrative, Commercial, Financial, Managerial, Supervisory or Forecasting Purposes, Not Otherwise Provided for G06Q 10/06312 (20130101) G06Q 20/145 (20130101) G06Q 30/08 (20130101) G06Q 30/0234 (20130101) G06Q 40/04 (20130101) G06Q 50/06 (20130101) Original (OR) Class Circuit Arrangements or Systems for Supplying or Distributing Electric Power; Systems for Storing Electric Energy H02J 7/007 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343444 | Graves |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William Graves (Tempe, Arizona) |
| ABSTRACT | A method includes accelerating an electron bunch along a direction of propagation to a relativistic energy and partitioning the electron bunch by transmitting the electron bunch through a grating at the relativistic energy. The grating includes a plurality of alternating narrow portions and wide portions. The narrow portions have a first thickness in a direction substantially parallel to the direction of propagation of the electron bunch, and the wide portions have a second thickness in the direction substantially parallel to the direction of propagation of the electron bunch. The second thickness is greater than the first thickness. The method also includes generating a pulse of light using the partitioned electron bunch. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378099 |
| CURRENT CPC | Techniques for Handling Particles or Ionising Radiation Not Otherwise Provided For; Irradiation Devices; Gamma Ray or X-ray Microscopes G21K 1/062 (20130101) Original (OR) Class G21K 2201/061 (20130101) G21K 2201/067 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 4/00 (20130101) X-ray Technique H05G 2/008 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343454 | Grover |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Battelle Energy Alliance, LLC (Idaho Falls, Idaho) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Blair K. Grover (Idaho Falls, Idaho) |
| ABSTRACT | A feedthrough assembly may include a feedthrough conductor, a first insulator, and a first metal gasket forming a seal between the feedthrough conductor and the first insulator. The feedthrough assembly may additionally include a body, and a second metal gasket forming a seal between the body and the first insulator. Methods of manufacturing such feedthrough assemblies may include compressing the first metal gasket between the feedthrough conductor and the first metal gasket to form a seal therebetween. The methods may further include compressing the second metal gasket between the body and the first insulator to form a seal therebetween. Induction furnace systems may include one or more such feed assemblies. |
| FILED | Monday, April 26, 2021 |
| APPL NO | 17/302168 |
| CURRENT CPC | Furnaces, Kilns, Ovens, or Retorts in General; Open Sintering or Like Apparatus F27B 5/06 (20130101) Cables; Conductors; Insulators; Selection of Materials for Their Conductive, Insulating or Dielectric Properties H01B 17/308 (20130101) Original (OR) Class Electric Heating; Electric Lighting Not Otherwise Provided for H05B 6/26 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343685 | MURIALDO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Maxwell MURIALDO (Westminster, California); Yuliya KANARSKA (Livermore, California); Andrew J. PASCALL (Livermore, California) |
| ABSTRACT | In one aspect the present disclosure relates to a 3D printed signal control backbone apparatus. The apparatus may have a filament including a first material section and a plurality of second material sections. The first material section is bounded on opposing ends by the second material sections. The first material section is formed by an ink having a percolating network of a plurality of chiplets infused in a non-conductive polymer. The plurality of chiplets form electrically responsive elements imparting a predetermined logic function and which are responsive to a predetermined electrical signal. The second material sections are formed by an ink which is electrically conductive. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375788 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 25/07 (20130101) H01L 25/16 (20130101) Original (OR) Class H01L 25/50 (20130101) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 1/16 (20130101) H05K 3/30 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343862 | NUZZO et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Ralph G. NUZZO (Champaign, Illinois); John A. ROGERS (Wilmette, Illinois); Etienne MENARD (Voglans, France); Keon Jae LEE (Daejeon, South Korea); Dahl-Young KHANG (Seoul, South Korea); Yugang SUN (Gladwyne, Pennsylvania); Matthew MEITL (Durham, North Carolina); Zhengtao ZHU (Rapid City, South Dakota) |
| ABSTRACT | The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations. |
| FILED | Thursday, June 24, 2021 |
| APPL NO | 17/357697 |
| CURRENT CPC | Processes or Apparatus Specially Adapted for the Manufacture or Treatment of Microstructural Devices or Systems B81C 2201/0185 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 10/00 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/308 (20130101) H01L 21/322 (20130101) H01L 21/02521 (20130101) H01L 21/02603 (20130101) H01L 21/02628 (20130101) H01L 21/6835 (20130101) H01L 23/02 (20130101) H01L 24/03 (20130101) H01L 24/05 (20130101) H01L 24/08 (20130101) H01L 24/29 (20130101) H01L 24/32 (20130101) H01L 24/80 (20130101) H01L 24/83 (20130101) H01L 24/94 (20130101) H01L 24/97 (20130101) H01L 25/0753 (20130101) H01L 27/1285 (20130101) H01L 27/1292 (20130101) H01L 29/04 (20130101) H01L 29/06 (20130101) H01L 29/12 (20130101) H01L 29/068 (20130101) H01L 29/76 (20130101) Original (OR) Class H01L 29/0665 (20130101) H01L 29/0673 (20130101) H01L 29/0676 (20130101) H01L 29/78603 (20130101) H01L 29/78681 (20130101) H01L 29/78696 (20130101) H01L 31/0392 (20130101) H01L 31/1804 (20130101) H01L 31/1864 (20130101) H01L 31/1896 (20130101) H01L 31/03926 (20130101) H01L 33/007 (20130101) H01L 33/32 (20130101) H01L 33/0093 (20200501) H01L 2221/68368 (20130101) H01L 2221/68381 (20130101) H01L 2224/03 (20130101) H01L 2224/80 (20130101) H01L 2224/83 (20130101) H01L 2224/94 (20130101) H01L 2224/95 (20130101) H01L 2224/97 (20130101) H01L 2224/0332 (20130101) H01L 2224/0345 (20130101) H01L 2224/0362 (20130101) H01L 2224/2919 (20130101) H01L 2224/03614 (20130101) H01L 2224/05073 (20130101) H01L 2224/05082 (20130101) H01L 2224/05124 (20130101) H01L 2224/05144 (20130101) H01L 2224/05155 (20130101) H01L 2224/05166 (20130101) H01L 2224/05552 (20130101) H01L 2224/05553 (20130101) H01L 2224/05554 (20130101) H01L 2224/05555 (20130101) H01L 2224/05644 (20130101) H01L 2224/05666 (20130101) H01L 2224/08225 (20130101) H01L 2224/8385 (20130101) H01L 2224/9202 (20130101) H01L 2224/32225 (20130101) H01L 2224/80006 (20130101) H01L 2224/80121 (20130101) H01L 2224/80862 (20130101) H01L 2224/80895 (20130101) H01L 2224/83005 (20130101) H01L 2224/83121 (20130101) H01L 2224/83192 (20130101) H01L 2224/83193 (20130101) H01L 2224/83862 (20130101) H01L 2924/00012 (20130101) H01L 2924/14 (20130101) H01L 2924/0665 (20130101) H01L 2924/01032 (20130101) H01L 2924/1305 (20130101) H01L 2924/1306 (20130101) H01L 2924/1461 (20130101) H01L 2924/1579 (20130101) H01L 2924/10253 (20130101) H01L 2924/10329 (20130101) H01L 2924/12032 (20130101) H01L 2924/12036 (20130101) H01L 2924/12041 (20130101) H01L 2924/12042 (20130101) H01L 2924/12043 (20130101) H01L 2924/12044 (20130101) H01L 2924/13055 (20130101) H01L 2924/13063 (20130101) H01L 2924/13091 (20130101) H01L 2924/15159 (20130101) H01L 2924/15162 (20130101) H01L 2924/15788 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 10/547 (20130101) Climate Change Mitigation Technologies in the Production or Processing of Goods Y02P 70/50 (20151101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/707 (20130101) Y10S 977/724 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343888 | CASWELL |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SUNPOWER CORPORATION (San Jose, California) |
| ASSIGNEE(S) | SUNPOWER CORPORATION (San Jose, California) |
| INVENTOR(S) | Nathaniel CASWELL (Sunnyvale, California) |
| ABSTRACT | A solar device includes a first string of first solar wafers, wherein a plurality of the first solar wafers each overlap with at least one vertically adjacent solar wafer from the first string. Additionally, the solar device includes a second string of second solar wafers, wherein a plurality of the second solar wafers each overlap with at least one vertically adjacent solar wafer from the second string, wherein a plurality of the first solar wafers overlap with one or more of the plurality of second solar wafers to electrically connect horizontally adjacent solar wafers in parallel. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/305540 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 31/042 (20130101) H01L 31/068 (20130101) H01L 31/0465 (20141201) H01L 31/0508 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343939 | Brown et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States Department of Energy (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Kevin Brown (Stony Brook, New York); Thomas Roser (Huntington, New York) |
| ABSTRACT | A system and method for storing information in a quantum computer using a quantum storage ring. The method comprises cooling ions in the quantum storage ring to a low temperature; and binding the ions into a lattice structure, forming an ion Coulomb crystal. |
| FILED | Friday, May 01, 2020 |
| APPL NO | 16/864332 |
| CURRENT CPC | Computer Systems Based on Specific Computational Models G06N 10/00 (20190101) Static Stores G11C 11/54 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 49/006 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344005 | Cairns |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Elton J. Cairns (Walnut Creek, California) |
| ABSTRACT | Described is a method of synthesizing a plurality of core-shell nanoparticles. The method includes forming shells around a plurality of lithium sulfide nanoparticles, wherein the shells conduct electrons and lithium ions. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369241 |
| CURRENT CPC | Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/4417 (20130101) Cables; Conductors; Insulators; Selection of Materials for Their Conductive, Insulating or Dielectric Properties H01B 1/122 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/131 (20130101) H01M 4/133 (20130101) H01M 4/136 (20130101) H01M 4/137 (20130101) H01M 4/366 (20130101) Original (OR) Class H01M 4/0402 (20130101) H01M 4/0428 (20130101) H01M 4/0471 (20130101) H01M 4/485 (20130101) H01M 4/587 (20130101) H01M 4/622 (20130101) H01M 4/1397 (20130101) H01M 4/5815 (20130101) H01M 10/052 (20130101) H01M 10/0525 (20130101) H01M 10/0569 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344018 | PAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Ke-Ji PAN (Ellicott City, Maryland); Mohammed Hussain ABDUL JABBAR (College Park, Maryland); Dong DING (Idaho Falls, Idaho); Eric WACHSMAN (Fulton, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ke-Ji PAN (Ellicott City, Maryland); Mohammed Hussain ABDUL JABBAR (College Park, Maryland); Dong DING (Idaho Falls, Idaho); Eric WACHSMAN (Fulton, Maryland) |
| ABSTRACT | In various embodiments, a solid oxide fuel cell is fabricated in part by disposing a functional layer between the cathode and the solid electrolyte. |
| FILED | Monday, May 24, 2021 |
| APPL NO | 17/327910 |
| CURRENT CPC | Processes for Applying Fluent Materials to Surfaces, in General B05D 7/50 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/8663 (20130101) Original (OR) Class H01M 4/9033 (20130101) H01M 4/9066 (20130101) H01M 8/126 (20130101) H01M 8/1213 (20130101) H01M 8/1246 (20130101) H01M 8/1253 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344030 | SELVERSTON et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CASE WESTERN RESERVE UNIVERSITY (Cleveland, Ohio) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Steven SELVERSTON (Cleveland Heights, Ohio); Jesse S. WAINRIGHT (Willoughby Hills, Ohio); Robert SAVINELL (Solon, Ohio) |
| ABSTRACT | A battery system comprising a sealed aqueous flow battery that employs a passive, in-tank electrolyte recombination system. The recombination system allows for electrolyte stabilization in batteries where hydrogen evolution may occur as a side reaction without the need to use any externally-supplied rebalancing reactants. The system is a passive system that does not require a control system, additional pumps, or pumping energy. |
| FILED | Wednesday, June 30, 2021 |
| APPL NO | 17/363269 |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/36 (20130101) H01M 8/20 (20130101) H01M 8/188 (20130101) Original (OR) Class H01M 8/0662 (20130101) Reduction of Greenhouse Gas [GHG] Emissions, Related to Energy Generation, Transmission or Distribution Y02E 60/50 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344036 | Hersam et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NORTHWESTERN UNIVERSITY (Evanston, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Mark C. Hersam (Wilmette, Illinois); Kan-Sheng Chen (Chicago, Illinois); Ethan B. Secor (Chicago, Illinois) |
| ABSTRACT | Composites comprising anode and cathode active materials conformally coupled to few-layered graphene, corresponding electrodes and related methods of preparation. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369058 |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/131 (20130101) H01M 4/133 (20130101) H01M 4/134 (20130101) H01M 4/136 (20130101) H01M 4/139 (20130101) H01M 4/0416 (20130101) H01M 4/505 (20130101) H01M 4/625 (20130101) H01M 4/1393 (20130101) H01M 10/0525 (20130101) Original (OR) Class H01M 2004/028 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344080 | Zhang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Xinijie ZHANG (Winchester, Massachusetts); Novarials Corporation (Woburn, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Xinjie Zhang (Winchester, Massachusetts); Kuiyang Jiang (Winchester, Massachusetts) |
| ABSTRACT | This invention relates to novel battery separators comprising ceramic nanowires, more specifically, inorganic carbonate nanowires. The novel ceramic nanowire separators are suited for use in lithium batteries, such as lithium ion rechargeable, lithium metal rechargeable and lithium sulfur rechargeable batteries, and provide high safety, high power density, and long cycle life to the fabricated rechargeable batteries. The battery separators comprise ceramic nanowires that may be optionally bonded together by organic polymer binders and/or may further comprise organic nanofibers. |
| FILED | Friday, October 19, 2018 |
| APPL NO | 17/274376 |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 50/44 (20210101) H01M 50/406 (20210101) H01M 50/434 (20210101) H01M 50/446 (20210101) Original (OR) Class H01M 50/4295 (20210101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344162 | Kane |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Daniel J Kane (Santa Fe, New Mexico) |
| ASSIGNEE(S) | Mesa Photonics, LLC (Santa Fe, New Mexico) |
| INVENTOR(S) | Daniel J Kane (Santa Fe, New Mexico) |
| ABSTRACT | A pulse analysis system or method includes a frequency filter that receives an ultrafast pulse under test and disperses the pulse under test over a frequency range. The frequency filter separates the pulse under test into component frequency slices and provides the frequency slices to a detector coupled to a digitizer, which processes the digitized signal and collects a sonogram characteristic of the pulse under test. The frequency slices are arranged to overlap. Ptychography is performed on the sonogram to obtain characteristics of the pulse under test. |
| FILED | Friday, May 01, 2020 |
| APPL NO | 16/864970 |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 26/101 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/11 (20130101) Original (OR) Class H01S 3/0057 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344240 | Islam et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | North Carolina State University (Raleigh, North Carolina) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Md. Sariful Islam (Raleigh, North Carolina); Iqbal Husain (Raleigh, North Carolina) |
| ABSTRACT | Various examples are provided related to machines utilizing heavy rare earth (HRE) free permanent magnets. In one example, a rotor assembly including a rotor core having a plurality of rotor slots and magnets positioned within the plurality of rotor slots. At least a portion of the magnets are free of heavy rare earth (HRE) elements. The magnets can include a combination HRE segments and HRE-free segments or can be free of HRE elements. The rotor assembly can be included in an electric machine such as, e.g., a permanent magnet (PM) machine. |
| FILED | Friday, April 02, 2021 |
| APPL NO | 17/221447 |
| CURRENT CPC | Dynamo-electric Machines H02K 1/02 (20130101) H02K 1/2766 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344258 | SINGH |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Deere and Company (Moline, Illinois) |
| ASSIGNEE(S) | |
| INVENTOR(S) | BRIJ N. SINGH (West Fargo, North Dakota) |
| ABSTRACT | Design and packaging of wide bandgap (WBG) power electronic power stages are disclosed herein. An example apparatus includes a first printed circuit board (PCB) including: a first voltage phase circuit cluster; a second voltage phase circuit cluster; and a cluster of traces, the cluster of traces routed substantially perpendicular to the second voltage phase circuit cluster; a second PCB positioned below the first PCB; and a connector to connect the first PCB to the second PCB, the connector electrically coupled to the first voltage phase circuit cluster by the cluster of traces. |
| FILED | Friday, October 16, 2020 |
| APPL NO | 17/072988 |
| CURRENT CPC | Arrangement or Mounting of Propulsion Units or of Transmissions in Vehicles; Arrangement or Mounting of Plural Diverse Prime-movers in Vehicles; Auxiliary Drives for Vehicles; Instrumentation or Dashboards for Vehicles; Arrangements in Connection With Cooling, Air Intake, Gas Exhaust or Fuel Supply of Propulsion Units in Vehicles B60K 1/00 (20130101) Vehicles, Vehicle Fittings, or Vehicle Parts, Not Otherwise Provided for B60R 16/03 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/4735 (20130101) Electrically-conductive Connections; Structural Associations of a Plurality of Mutually-insulated Electrical Connecting Elements; Coupling Devices; Current Collectors H01R 12/523 (20130101) Installation of Electric Cables or Lines, or of Combined Optical and Electric Cables or Lines H02G 5/10 (20130101) Dynamo-electric Machines H02K 7/006 (20130101) H02K 11/33 (20160101) Original (OR) Class H02K 2211/03 (20130101) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 1/144 (20130101) H05K 1/0233 (20130101) H05K 7/20272 (20130101) H05K 7/20927 (20130101) H05K 2201/10189 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344301 | Gilchrist et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Enphase Energy, Inc. (Petaluma, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Phil Gilchrist (Austin, Texas); William Morris (Round Rock, Texas); Kristine Little (Austin, Texas); Patrick L. Chapman (Austin, Texas); William P. Mulligan (Wilson, Wyoming); Marco A. Marroquin (Austin, Texas) |
| ABSTRACT | Various technologies for integrating a microinverter with a photovoltaic module are disclosed. An alternating current photovoltaic (ACPV) module includes a photovoltaic module having a frame and a junction box including a direct current (DC) output connector, and a microinverter having a housing coupled to the frame and a DC input connector electrically mated with the DC output connector of the photovoltaic module. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/375722 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 31/02013 (20130101) Generation of Electric Power by Conversion of Infra-red Radiation, Visible Light or Ultraviolet Light, e.g Using Photovoltaic [PV] Modules H02S 40/32 (20141201) Original (OR) Class H02S 40/34 (20141201) Printed Circuits; Casings or Constructional Details of Electric Apparatus; Manufacture of Assemblages of Electrical Components H05K 3/301 (20130101) H05K 7/142 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344851 | Kester et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | REBELLION PHOTONICS, INC. (Houston, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Robert Timothy Kester (Friendswood, Texas); Patrick Charles O'DRISCOLL (Houston, Texas); Steve Patrick GAUTIERI (Gladstone, Missouri); Gary Timothy NOE, II (Houston, Texas); Venus J. DANTAS (Arlington Heights, Illinois); Carlos A. CLAVERIA (Buffalo Grove, Illinois); Ronald J. MARTIN (Nicholson, Georgia); Michael Jon FREEMAN (Cambridge, Canada); Ryan Patrick MALLERY (Houston, Texas) |
| ABSTRACT | Thermal imaging systems are provided. An example thermal imaging system includes an infrared (IR) imager that acquires IR image data of a field of view of the IR imager. The thermal imaging system further includes video analysis circuitry operably coupled to the IR imager. The video analysis circuitry receives first temperature data of a first field reference within the field of view of the IR imager, receives second temperature data of a second field reference within the field of view of the IR imager, and receives IR image data from the IR imager. The video analysis circuitry calibrates the IR imager based upon the first temperature data, the second temperature data, and the IR image data. The thermal imaging system may further include a temperature control chamber enclosing the IR imager and configured to thermally isolate the IR imager and temperature sensors thermally coupled to the IR imager. |
| FILED | Tuesday, April 27, 2021 |
| APPL NO | 17/241420 |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 5/0003 (20130101) G01J 2005/0077 (20130101) G01J 2005/0085 (20130101) Pictorial Communication, e.g Television H04N 5/332 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344852 | ISBERG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | REBELLION PHOTONICS, INC. (Houston, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Thomas A. ISBERG (Minneapolis, Minnesota); Robert Timothy KESTER (Friendswood, Texas); Suresh VENKATARAYALU (Waxhaw, North Carolina); Patrick Charles O'DRISCOLL (Houston, Texas); Steve Patrick GAUTIERI (Gladstone, Missouri); Gary Timothy NOE, II (Houston, Texas); Venus J. DANTAS (Arlington Heights, Illinois); Carlos A. CLAVERIA (Buffalo Grove, Illinois); Ronald J. MARTIN (Nicholson, Georgia); Michael Jon FREEMAN (Cambridge, Canada); Ryan Patrick MALLERY (Houston, Texas) |
| ABSTRACT | In one embodiment, an infrared (IR) imaging system for determining a concentration of a target species in an object is disclosed. The imaging system can include an optical system including an optical focal plane array (FPA) unit. The optical system can have components defining at least two optical channels thereof, said at least two optical channels being spatially and spectrally different from one another. Each of the at least two optical channels can be positioned to transfer IR radiation incident on the optical system towards the optical FPA. The system can include a processing unit containing a processor that can be configured to acquire multispectral optical data representing said target species from the IR radiation received at the optical FPA. Said optical system and said processing unit can be contained together in a data acquisition and processing module configured to be worn or carried by a person. |
| FILED | Tuesday, April 27, 2021 |
| APPL NO | 17/241478 |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 5/0205 (20130101) G01J 5/0265 (20130101) G01J 2005/0077 (20130101) Pictorial Communication, e.g Television H04N 5/332 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Science Foundation (NSF)
| US 20210337804 | Roeder et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ABSTRACT | Polymer coatings and surfaces are disclosed with antimicrobial properties. The antimicrobial action is provided by high surface area materials contained within the coating or surface. The high surface area materials may contain photocatalysts that create reactive oxygen species upon exposure to visible light or transition metals that create reactive oxygen species upon exposure to hydrogen peroxide. The high surface area materials may also sorb disinfecting liquids and desorb them over time to provide disinfection. |
| FILED | Wednesday, June 09, 2021 |
| APPL NO | 17/343723 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 25/10 (20130101) A01N 59/06 (20130101) A01N 59/20 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338092 | Akbari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Yama Akbari (Irvine, California); Robert H. Wilson (Irvine, California); Christian Crouzet (Irvine, California); Thomas Milner (Irvine, California); Bernard Choi (Irvine, California) |
| ABSTRACT | A portable device for quantitative measurement of tissue autoregulation and neurovascular coupling via portable measurement of blood flow, oxygenation, metabolism, and/or EEG signals and methods for using said device. The device may comprise a body and a plurality of legs pivotably attached to the body. The plurality of legs may comprise at least one reference electrode leg and at least one measurement electrode leg for electrical measurement, and an optical detection fiber leg and at least one optical source fiber leg for optical blood flow, oxygenation, and metabolism measurement. The present invention is additionally directed to a portable device for blood flow measurement and therapeutic photobiomodulation. The device may comprise a body and a plurality of legs. The plurality of legs may comprise at least one optical detection fiber leg and at least one optical source fiber leg, and at least one leg for therapeutic photobiomodulation. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/377123 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0075 (20130101) A61B 5/0261 (20130101) Original (OR) Class A61B 5/6801 (20130101) A61B 5/14553 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338171 | Derksen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of Michigan (Ann Arbor, Michigan) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Hendrikus Derksen (Dexter, Michigan); Neriman Tokcan (Somerville, Massachusetts); Kayvan Najarian (Northville, Michigan); Jonathan Gryak (Ann Arbor, Michigan) |
| ABSTRACT | A method of generating an assessment of medical condition for a patient includes obtaining a patient data tensor indicative of a plurality of tests conducted on the patient, obtaining a set of tensor factors, each tensor factor of the set of tensor factors being indicative of a decomposition of training tensor data for the plurality of tests, the decomposition amplifying low rank structure of the training tensor data, determining a patient tensor factor for the patient based on the obtained patient data tensor and the obtained set of tensor factors, applying the determined patient tensor factor to a classifier such that the determined further tensor factor establishes a feature vector for the patient, the classifier being configured to process the feature vector to generate the assessment, and providing output data indicative of the assessment. |
| FILED | Thursday, February 04, 2021 |
| APPL NO | 17/167140 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/7264 (20130101) Original (OR) Class Electric Digital Data Processing G06F 17/40 (20130101) Computer Systems Based on Specific Computational Models G06N 20/00 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338408 | MacEwan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington University (St. Louis, Missouri) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Matthew R. MacEwan (St. Louis, Missouri); Jingwei Xie (St. Louis, Missouri); Zack Ray (St. Louis, Missouri); Younan Xia (St. Louis, Missouri) |
| ABSTRACT | A multi-laminar electrospun nanofiber scaffold for use in repairing a defect in a tissue substrate is provided. The scaffold includes a first layer formed by a first plurality of electrospun polymeric fibers, and a second layer formed by a second plurality of electrospun polymeric fibers. The second layer is combined with the first layer. A first portion of the scaffold includes a higher density of fibers than a second portion of the scaffold, and the first portion has a higher tensile strength than the second portion. The scaffold is configured to degrade via hydrolysis after at least one of a predetermined time or an environmental condition. The scaffold is configured to be applied to the tissue substrate containing the defect, and is sufficiently flexible to facilitate application of the scaffold to uneven surfaces of the tissue substrate, and to enable movement of the scaffold by the tissue substrate. |
| FILED | Friday, June 25, 2021 |
| APPL NO | 17/358463 |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/02 (20130101) Original (OR) Class A61F 2/0063 (20130101) A61F 2/105 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 15/22 (20130101) A61L 15/42 (20130101) A61L 27/14 (20130101) A61L 27/50 (20130101) Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 48/05 (20190201) B29C 48/142 (20190201) Apparatus for Enzymology or Microbiology; C12M 25/14 (20130101) Mechanical Methods or Apparatus in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons D01D 5/0076 (20130101) D01D 5/0092 (20130101) Making Textile Fabrics, e.g From Fibres or Filamentary Material; Fabrics Made by Such Processes or Apparatus, e.g Felts, Non-woven Fabrics; Cotton-wool; Wadding D04H 1/728 (20130101) D04H 3/016 (20130101) D04H 3/073 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338583 | Campbell |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Robert B. Campbell (Quincy, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Robert B. Campbell (Quincy, Massachusetts) |
| ABSTRACT | Nanoliposome compositions and methods of making the same for selective targeting, image analysis and therapy (e.g., cancer therapy) are provided. In some aspects, the nanoliposomes comprise membrane material derived from cells (e.g., tumor cells) in order to selectively target agents (e.g., chemotherapeutic agents) to cancer cells. Membranes used to generate the nanoliposomes provided herein may be derived from cells in vivo, ex vivo, or in vitro. The disclosure also provides pharmaceutical compositions comprising nanoliposomes and methods of treatment by administering the same. |
| FILED | Tuesday, July 23, 2019 |
| APPL NO | 17/262292 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/1272 (20130101) A61K 9/1277 (20130101) Original (OR) Class A61K 31/704 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338628 | Lopez-Mejias et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vilmali Lopez-Mejias (San Juan, Puerto Rico); Jeaninna P. Flores Bello (San Juan, Puerto Rico); Israel Rodriguez Rodriguez (San Juan, Puerto Rico); Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Vilmali Lopez-Mejias (San Juan, Puerto Rico); Jeaninna P. Flores Bello (San Juan, Puerto Rico); Israel Rodriguez Rodriguez (San Juan, Puerto Rico); Joyce Marie Serrano Valcarcel (San Juan, Puerto Rico) |
| ABSTRACT | A series of pharmaceutical metal complexes (pMCs) were produced and characterized using the mast cell stabilizer, cromolyn, and bioactive metal ions (Zn+2, Mg+2, and Ca+2). Three novel pMCs, Cromolyn-Zn, Cromolyn-Mg, and Cromolyn-Ca were formed through reactions under controlled temperature and pH conditions. TGA demonstrated that these metal complexes showed an enhanced thermal stability due to the strong coordination with the ligand, cromolyn. PXRD data indicates a high degree of crystallinity as well as a unique packing arrangement for each pMCs. SEM analysis showed materials with well-defined morphologies while EDS presented elemental evidence for the unique composition of each pMCs. The crystal structure for these materials was elucidated through SCXRD, and a variety of binding modes and packing motifs were found within each respective metal complex. Only 2D structures were achieved under the conditions studied. Dissolution studies show high stability and slow degradation for the metal complexes, while a higher dissolution was observed for the drug compound in PBS. Neither CS nor the pMCs dissolved significantly in FaSSGF at 37° C. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307208 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/315 (20130101) Original (OR) Class A61K 31/352 (20130101) General Methods of Organic Chemistry; Apparatus Therefor C07B 2200/13 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338906 | Mayes et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board Of Regents, The University Of Texas System (Austin, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Sarah Mayes (Austin, Texas); Christine E. Schmidt (Gainesville, Florida) |
| ABSTRACT | A non-synthetic, hydrophilic, biodegradable, biocompatible polysaccharide based non-toxic anti-adhesion hydrogel barrier is disclosed herein. The barrier of the present invention is formed by constructing a unique interpenetrating, crosslinked network with a unique porosity. Furthermore, the barrier of the present invention is comprised of tunable biopolymers for controllable mechanical robustness and degradation. The barrier of the present invention effectively reduces unwanted adhesions using non-synthetic components. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369067 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/192 (20130101) A61K 31/195 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 31/16 (20130101) A61L 31/041 (20130101) Original (OR) Class A61L 31/145 (20130101) A61L 31/148 (20130101) A61L 2300/43 (20130101) A61L 2300/62 (20130101) A61L 2300/414 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339242 | Yang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (FARMINGTON, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ruiguo Yang (Lincoln, Nebraska); Arian Jaberi (Lincoln, Nebraska); Amir Monemian Esfahani (Lincoln, Nebraska); Ali Tamayol (Providence, Rhode Island) |
| ABSTRACT | Microfluidic gradient generators that can create robust platforms that can not only be used for creating co-cultures of cells with various ratios, but also can simultaneously generate gradients of mechanical and chemical stresses. A chip utilizes microchambers embedded within channels to provide space for 3D cell culture and exposes these cells to gradients of mechanical shear stress and a chemical treatment. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245381 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5025 (20130101) Original (OR) Class B01L 2300/087 (20130101) B01L 2300/0877 (20130101) B01L 2300/0883 (20130101) Apparatus for Enzymology or Microbiology; C12M 41/46 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/34 (20130101) C12N 2513/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339253 | KLEVAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DxNow, Inc. (Gaithersburg, Maryland); The Brigham and Women's Hospital, Inc. (Cambridge, Massachusetts); Board of Trustees of the Leland Stanford Junior University (Redwood City, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Leonard KLEVAN (Cave Creek, Arizona); Fatih INCI (Palo Alto, California); Utkan DEMIRCI (Stanford, California) |
| ABSTRACT | Embodiments of the present disclosure relate to a magnetic bead platform for isolating sperm cells from biological samples. In some embodiments, such magnetic bead platforms integrate recognition reagents to its surface to bind target cells, such as sperm cells. Such embodiments provide the ability to at least one of rapidly isolate and quantitate sperm cells from biological samples as occur in sexual assault evidence, for example, thereby enhancing identification of suspects in these cases and contributing to the safety of society. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369490 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/502761 (20130101) Original (OR) Class B01L 2200/027 (20130101) Apparatus for Enzymology or Microbiology; C12M 23/16 (20130101) C12M 35/06 (20130101) C12M 41/36 (20130101) C12M 41/48 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339316 | Xia et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington (Seattle, Washington) |
| ASSIGNEE(S) | University of Washington (Seattle, Washington) |
| INVENTOR(S) | Younan Xia (St. Louis, Missouri); Sang-Hyuk Im (Pohang-Shi, South Korea); Yugang Sun (Naperville, Illinois); Yun Tack Lee (Seattle, Washington); Benjamin Wiley (Boston, Massachusetts) |
| ABSTRACT | Methods for producing silver nanostructures with improved dimensional control, yield, purity, monodispersed, and scale of synthesis. |
| FILED | Wednesday, March 17, 2021 |
| APPL NO | 17/249885 |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 1/0025 (20130101) B22F 9/24 (20130101) Original (OR) Class B22F 2001/0037 (20130101) B22F 2009/245 (20130101) B22F 2301/255 (20130101) B22F 2304/05 (20130101) B22F 2998/10 (20130101) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 30/00 (20130101) B82Y 40/00 (20130101) Production and Refining of Metals; Pretreatment of Raw Materials C22B 11/04 (20130101) Alloys C22C 5/02 (20130101) C22C 5/06 (20130101) Single-crystal-growth; Unidirectional Solidification of Eutectic Material or Unidirectional Demixing of Eutectoid Material; Refining by Zone-melting of Material; Production of a Homogeneous Polycrystalline Material With Defined Structure; Single Crystals or Homogeneous Polycrystalline Material With Defined Structure; After-treatment of Single Crystals or a Homogeneous Polycrystalline Material With Defined Structure; Apparatus Therefor C30B 7/00 (20130101) C30B 29/02 (20130101) C30B 29/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340011 | LAINE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Richard M. LAINE (Ann Arbor, Michigan); Eleni TEMECHE (Ann Arbor, Michigan); Xinyu ZHANG (Ann Arbor, Michigan) |
| ABSTRACT | A method of synthesizing a precursor for making a polymer, glass, or ceramic material is provided. The method includes reacting OPCl3 with NH3 or MNH2, where M is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form O═P(NH2)3. The method then includes either: (i) reacting the O═P(NH2)3 with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor; or (ii) heating the O═P(NH2)3 to form a branched or cyclomeric compound, and reacting the branched or cyclomeric compound with M1NH2, where M1 is Li, Na, K, Mg, Ca, Ba, or combinations thereof, to form the precursor. The precursor is an oligomer or a polymer. Uses for the precursor and the polymer, glass, or ceramic material as binders, sintering aids, adhesives, and electrolytes in battery components are also provided. |
| FILED | Friday, August 30, 2019 |
| APPL NO | 17/271244 |
| CURRENT CPC | Non-metallic Elements; Compounds Thereof; C01B 21/0823 (20130101) Original (OR) Class Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/0525 (20130101) H01M 10/0562 (20130101) H01M 2300/0071 (20130101) H01M 2300/0085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340034 | Westerhoff et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Paul K. Westerhoff (Scottsdale, Arizona); Francois Perreault (Tempe, Arizona); Sergio Garcia-Segura (Tempe, Arizona); Shahnawaz Sinha (Chandler, Arizona); Ana Barrios (Tempe, Arizona); Renato Martin Montenegro Ayo (Lima, Peru) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Paul K. Westerhoff (Scottsdale, Arizona); Francois Perreault (Tempe, Arizona); Sergio Garcia-Segura (Tempe, Arizona); Shahnawaz Sinha (Chandler, Arizona); Ana Barrios (Tempe, Arizona); Renato Martin Montenegro Ayo (Lima, Peru) |
| ABSTRACT | A water-disinfecting apparatus includes a vessel with a cathode, an insert with a photoanode, an ultraviolet light source configured to be positioned in the insert, and a power source. The cathode forms an electrically conductive layer on an inner surface of the vessel. The photoanode is configured to be positioned in the cathode. The power source is configured to be operably coupled to the cathode, the photoanode, and the light source. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245640 |
| CURRENT CPC | Travelling or Camp Equipment: Sacks or Packs Carried on the Body A45F 3/18 (20130101) A45F 2003/003 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/325 (20130101) C02F 1/4672 (20130101) C02F 1/46109 (20130101) Original (OR) Class C02F 2001/46142 (20130101) C02F 2001/46171 (20130101) C02F 2201/009 (20130101) C02F 2303/04 (20130101) C02F 2305/10 (20130101) C02F 2305/023 (20130101) C02F 2307/02 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340187 | Berger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Virginia Patent Foundation (Charlottesville, Virginia) |
| ASSIGNEE(S) | University of Virginia Patent Foundation (Charlottesville, Virginia) |
| INVENTOR(S) | Bryan Berger (Charlottesville, Virginia); Holly Mayton (Charlottesville, Virginia) |
| ABSTRACT | Provided are polypeptides that have at least about 95% but less than 100% sequence identity to SEQ ID NO: 2, optionally wherein the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 4, with the proviso that the polypeptide does not have 100% sequence identity to SEQ ID NO: 2. Also provided are polypeptides that include an amino acid sequence that is a variant of SEQ ID NO: 2, wherein the variant sequence has at least one substitution at an amino acid position selected from the group consisting of D287, D291, D311, N313, D315, L307, and N284 of SEQ ID NO: 2; optionally wherein the polypeptide inhibits growth of a microbe and/or microbial biofilm and/or disrupts a microbial biofilm; nucleic acid molecules encoding the disclosed polypeptides; vectors and recombinant host cells that include the disclosed nucleic acid molecules; antimicrobial compositions that include an effective amount of the disclosed polypeptides, optionally that also include a carrier and/or one or more additional active agents; and methods for inhibiting the growth of microbes and/or microbial biofilms on surfaces and/or for disrupting microbial biofilms on surfaces and methods for inhibiting the growth of microbes on and/or in agricultural products and/or subjects. |
| FILED | Monday, May 03, 2021 |
| APPL NO | 17/306623 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 37/46 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 2/16 (20130101) Peptides C07K 14/01 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340192 | NIVALA |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF WASHINGTON (Seattle, Washington) |
| ASSIGNEE(S) | UNIVERSITY OF WASHINGTON (Seattle, Washington) |
| INVENTOR(S) | Jeffrey Matthew NIVALA (Seattle, Washington) |
| ABSTRACT | The disclosure provides fusion reporter protein constructs and related compositions, systems, and methods for nanopore-based detection biological activity. In one aspect, the disclosure provides a fusion reporter protein comprising, in order: a blocking domain with a stably folded tertiary structure; a flexible analyte domain; and a flexible tail domain, wherein the flexible tail domain has a net negative charge. The disclosure also provides nucleic acid constructs encoding the disclosed fusion reporter protein, and vectors and cells comprising the nucleic acids. Also provided are nanopore-based systems and methods for using the disclosed fusion reporter protein constructs to detect and characterize biological activity. |
| FILED | Friday, October 04, 2019 |
| APPL NO | 17/283007 |
| CURRENT CPC | Peptides C07K 14/245 (20130101) Original (OR) Class C07K 2319/035 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/54366 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340199 | Doudna et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jennifer A. Doudna (Berkeley, California); Kyle E. Watters (Moraga, California); Haridha Shivram (Berkeley, California); Christof Fellmann (Berkeley, California) |
| ABSTRACT | The present disclosure provides AcrIIA7 polypeptides, nucleic acids encoding the AcrIIA7 polypeptides, and kits comprising the AcrIIA7 polypeptides and/or nucleic acids encoding the ACRIIA7 polypeptides. The present disclosure provides methods of inhibiting an activity of a Cas9 polypeptide. |
| FILED | Monday, September 09, 2019 |
| APPL NO | 17/270691 |
| CURRENT CPC | Peptides C07K 14/4703 (20130101) Original (OR) Class C07K 2319/09 (20130101) C07K 2319/40 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/1137 (20130101) Enzymes C12Y 301/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340387 | Aguayo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Matthew Aguayo (Chandler, Arizona); Aashay Arora (Tempe, Arizona); Narayanan Neithalath (Chandler, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Matthew Aguayo (Chandler, Arizona); Aashay Arora (Tempe, Arizona); Narayanan Neithalath (Chandler, Arizona) |
| ABSTRACT | Methods and formulations for use of phase change materials (PCMs) as coatings or integrated with building materials are disclosed. A formulation comprises an amount of phase change material, for example a mass fraction of about 0.01 to about 0.50. The PCM materials may be applied as a surface treatment such as paint, for example in order to provide improved thermal regulation to a building or a portion thereof. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/372031 |
| CURRENT CPC | Coating Compositions, e.g Paints, Varnishes or Lacquers; Filling Pastes; Chemical Paint or Ink Removers; Inks; Correcting Fluids; Woodstains; Pastes or Solids for Colouring or Printing; Use of Materials Therefor C09D 5/26 (20130101) Original (OR) Class C09D 5/028 (20130101) C09D 7/70 (20180101) C09D 133/00 (20130101) Materials for Miscellaneous Applications, Not Provided for Elsewhere C09K 5/063 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 25/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340553 | Hittinger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Chris Todd Hittinger (Madison, Wisconsin); EmilyClare Patricia Baker (Madison, Wisconsin) |
| ABSTRACT | Polypeptides comprising maltose/maltotriose transporters are provided. Additionally, polynucleotides, DNA constructs, and vectors encoding a maltose/maltotriose transporter, or yeast cells harboring such polynucleotides are provided. The yeast cell may be a Saccharomyces eubayanus cell modified to increase the expression or transport activity of a maltose/maltotriose transporter at the plasma membrane of the cell. Further, methods are provided for making a fermentation product by culturing any one of the yeast cells described herein with a fermentable substrate. Finally, methods are provided to select for and isolate maltotriose-utilizing strains of Saccharomyces eubayanus. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/341224 |
| CURRENT CPC | Peptides C07K 14/395 (20130101) Beer; Preparation of Beer by Fermentation; Preparation of Malt for Making Beer; Preparation of Hops for Making Beer C12C 11/00 (20130101) Wine; Preparation Thereof; Alcoholic Beverages; Preparation of Alcoholic Beverages Not Provided for in Subclasses C12C or C12H C12G 1/0203 (20130101) C12G 3/02 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/16 (20130101) C12N 15/81 (20130101) Original (OR) Class C12N 2500/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340559 | Ozias-Akins et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF GEORGIA RESEARCH FOUNDATION, INC. (ATHENS, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Peggy Ozias-Akins (Tifton, Georgia); Joann A. Conner (Tifton, Georgia) |
| ABSTRACT | Methods and compositions disclosed herein generally relate to genes involved in plant reproduction and methods of using the same. |
| FILED | Tuesday, March 17, 2020 |
| APPL NO | 16/821755 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8287 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340562 | Christensen |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shawn Christensen (Arlington, Texas) |
| ABSTRACT | Engineered transposons and methods of use thereof are provided. The transposons typically include an RNA component and a protein component. The RNA component can include, for example, a DNA targeting sequence, one or more protein binding motifs, and a nucleic acid sequence of interest to be integrated into a target DNA. The protein component is typically derived from a RLE LINE element protein and can include a DNA binding domain, an RNA binding domain, a reverse transcriptase, a linker domain, and an endonuclease. Pharmaceutical compositions and methods of use for introducing nucleic acid sequences into the genomes of cells are also provided. |
| FILED | Monday, October 21, 2019 |
| APPL NO | 17/286772 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 9/1276 (20130101) C12N 15/85 (20130101) Original (OR) Class C12N 2800/90 (20130101) C12N 2840/203 (20130101) Enzymes C12Y 207/07049 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341369 | GE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shencheng GE (Boston, Massachusetts); Yunzhe WANG (Baltimore, Maryland); Nicolas J. DESHLER (Berkeley, California); Daniel J. PRESTON (Houston, Texas); George M. WHITESIDES (Newton, Massachusetts) |
| ABSTRACT | A device is disclosed, including: a plate including a sample deposition tube adapted to receive a sample comprising one or more analytes, the sample deposition tube defining a vertical axis substantially perpendicular to a main surface of the plate; and a mirror positioned to project, substantially parallel to the main surface of the plate, an image of the sample deposition tube along its vertical axis, so as to allow determination of the vertical location of the one or more analytes inside the sample deposition tube. Methods for determining the density of one or more analytes using various embodiments of the device are also described. |
| FILED | Friday, May 17, 2019 |
| APPL NO | 17/056142 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 9/18 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341376 | Di Carlo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| INVENTOR(S) | Dino Di Carlo (Los Angeles, California); Daniel R. Gossett (Los Angeles, California); Henry T.K. Tse (San Francisco, California); Aram Chung (Los Angeles, California) |
| ABSTRACT | A system for deforming and analyzing a plurality of particles carried in a sample volume includes a substrate defining an inlet, configured to receive the sample volume, and an outlet; and a fluidic pathway fluidly coupled to the inlet and the outlet. The fluidic pathway includes a delivery region configured to receive the plurality of particles from the inlet and focus the plurality of particles from a random distribution to a focused state, a deformation region defining an intersection located downstream of the delivery region and coupled to the outlet, and wherein the deformation region is configured to receive the plurality of particles from the delivery region and to transmit each particle in the plurality of particles into the intersection from a single direction, a first branch fluidly coupled to the deformation region and configured to transmit a first flow into the intersection, and a second branch fluidly coupled to the deformation region and configured to transmit a second flow, substantially opposing the first flow, into the intersection, wherein the first flow and the second flow are configured to induce extension of one or more particles in the plurality of particles. |
| FILED | Friday, March 12, 2021 |
| APPL NO | 17/200728 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/147 (20130101) Original (OR) Class G01N 15/1404 (20130101) G01N 15/1434 (20130101) G01N 15/1436 (20130101) G01N 15/1459 (20130101) G01N 15/1484 (20130101) G01N 21/645 (20130101) G01N 21/6428 (20130101) G01N 33/50 (20130101) G01N 33/5091 (20130101) G01N 2015/0065 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/4604 (20130101) Image Data Processing or Generation, in General G06T 7/0004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341399 | Graves et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William Graves (Tempe, Arizona); Lucas Malin (Tempe, Arizona) |
| ABSTRACT | A method includes simulating diffraction in a transmission geometry of relativistic electron bunches from a crystallographic structure of a crystal thereby simulating diffraction of the relativistic electron bunches into a plurality of Bragg peaks. The method includes selecting a range of angles between a direction of propagation of the relativistic electron bunches and a normal direction of crystal including an angle at which a diffraction portion is maximized. The method includes sequentially accelerating a plurality of physical electron bunches to relativistic energies toward a physical crystal having the crystallographic structure and diffracting the plurality of physical electron bunches off the physical crystal at different angles and measuring the diffraction portion into the respective Bragg peak at the different angles. The method includes selecting a final angle based on the measured diffraction portion into the respective Bragg peak at the different angles and generating a pulse of light. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378094 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 23/20008 (20130101) Original (OR) Class G01N 2223/102 (20130101) G01N 2223/0565 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341406 | Yao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Massachusetts (Boston, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jun Yao (Boston, Massachusetts); Derek R. Lovley (Amherst, Massachusetts); Alexander Smith (Boston, Massachusetts); Xiaomeng Liu (Boston, Massachusetts) |
| ABSTRACT | A gas sensor includes a biomaterial comprising electrically-conductive protein nanowires and at least two electrodes. The at least two electrodes are in operative arrangement with the protein nanowires and configured to provide a signal indicative of a change in conductivity of the protein nanowires. The conductivity of the protein nanowires is responsive to a change in concentration of a gas exposed to the biomaterial, such as ammonia, or to a change in relative humidity. |
| FILED | Thursday, April 22, 2021 |
| APPL NO | 17/302063 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/082 (20130101) A61B 2562/0285 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/121 (20130101) G01N 27/127 (20130101) Original (OR) Class G01N 33/0054 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341714 | Trubko et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RemoteReality Corporation (Windsor, Connecticut) |
| ASSIGNEE(S) | RemoteReality Corporation (Windsor, Connecticut) |
| INVENTOR(S) | Sergey Trubko (Shrewsbury, Massachusetts); Raghu Menon (Marlborough, Massachusetts); Yangiu (Julia) Zhu (Chepachet, Rhode Island); Mike Zwolinski (Westford, Massachusetts) |
| ABSTRACT | An optical system for a camera includes a convex reflector, a decompression lens, and an image sensor. The convex reflector has a first diameter and a non-parabolic, axially symmetric, aspheric surface that provides a virtual curved and compressed image of a scene having a non-parabolic image compression. The decompression lens is positioned to receive the virtual curved and compressed image. The decompression lens is configured to decompress the virtual curved and compressed image into a real image having a parabolic image decompression and project the real image. The image sensor is positioned to receive the real image. The real image has a second diameter at the image sensor that is less than the first diameter. A ratio of the first diameter to the second diameter is between 6.5:1 and 2.3:1. The optical system provides a polychromatic modulation transfer function of 30% or more for 150 cy/mm. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/371983 |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 5/09 (20130101) G02B 5/208 (20130101) G02B 9/12 (20130101) G02B 13/06 (20130101) Original (OR) Class G02B 13/18 (20130101) G02B 17/08 (20130101) Apparatus or Arrangements for Taking Photographs or for Projecting or Viewing Them; Apparatus or Arrangements Employing Analogous Techniques Using Waves Other Than Optical Waves; Accessories Therefor G03B 37/06 (20130101) Signalling or Calling Systems; Order Telegraphs; Alarm Systems G08B 13/19628 (20130101) Pictorial Communication, e.g Television H04N 5/23238 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341814 | SAFAVI-NAEINI et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the Leland Stanford Junior University (Stanford, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Amir-Hossein SAFAVI-NAEINI (Palo Alto, California); Christopher John SARABALIS (Menlo Park, California); Jeremy David WITMER (Palo Alto, California); Patricio ARRANGOIZ ARRIOLA (San Francisco, California); Raphael Frank J VAN LAER (Menlo Park, California) |
| ABSTRACT | Systems and methods for steering an optical beam in two dimensions are disclosed. The system includes a substrate comprising an acousto-optic antenna array and an acoustic transducer. Each antenna of the antenna array includes a high-confinement surface waveguide carrying a light signal. The acoustic transducer imparts acoustic energy into each surface waveguide as a mechanical wave. Interaction of the light signal and mechanical wave in each surface waveguide induces light to scatter into free space. The light scattered out of the plurality of waveguides collectively defines the output beam. The longitudinal angle of output beam, relative to the substrate, is determined by the relative frequencies of the mechanical waves and the light signals. The transverse angle of the output beam is controlled by controlling the relative phases of the mechanical waves and/or light signals across the surface-waveguide array. |
| FILED | Monday, May 10, 2021 |
| APPL NO | 17/315876 |
| CURRENT CPC | Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/335 (20130101) Original (OR) Class G02F 1/2955 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341833 | Sreenivasan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Sidlgata V. Sreenivasan (Austin, Texas); Shrawan Singhal (Austin, Texas); Ovadia Abed (Austin, Texas); Lawrence Dunn (Austin, Texas); Paras Ajay (Austin, Texas); Ofodike Ezekoye (Austin, Texas) |
| ABSTRACT | A method for fabricating patterns on a flexible substrate in a roll-to-roll configuration. Drops of a monomer diluted in a solvent are dispensed on a substrate, where the drops spontaneously spread and merge with one another to form a liquid resist formulation. The solvent is evaporated (e.g., blanket evaporation) from the liquid resist formulation followed by selective multi-component resist film evaporation resulting in a non-uniform and substantially continuous film on the substrate. The gap between the film on the substrate and a template is closed such that the film fills the features of the template. After cross-linking the film to polymerize the film, the template is separated from the substrate thereby leaving the polymerized film on the substrate. |
| FILED | Thursday, August 03, 2017 |
| APPL NO | 16/322842 |
| CURRENT CPC | Photomechanical Production of Textured or Patterned Surfaces, e.g for Printing, for Processing of Semiconductor Devices; Materials Therefor; Originals Therefor; Apparatus Specially Adapted Therefor; G03F 7/0002 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342144 | Huang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Notre Dame du Lac (South Bend, Indiana) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jane Huang (Granger, Indiana); Michael Vierhauser (Linz, Austria); Ankit Agrawal (South Bend, Indiana) |
| ABSTRACT | Systems and methods for maintaining the safety of a software-based system. One method includes automatically generating a first artifact tree for a hazard for a first version of the system and automatically transforming the first artifact tree into a first augmented tree using a set of heuristics. The method also includes automatically generating a second artifact tree for the hazard for a second version of the system and automatically transforming the second artifact tree for the hazard into a second augmented tree using the set of heuristics. The method further includes automatically comparing the first augmented tree and the second augmented tree to generate a delta view, and automatically generating, based on the delta view, at least one selected from a group consisting of a safety warning for the second version of the software-based system and an actionable recommendation to maintain safety of the second version of the software-based system. |
| FILED | Tuesday, October 15, 2019 |
| APPL NO | 17/272650 |
| CURRENT CPC | Electric Digital Data Processing G06F 8/71 (20130101) Original (OR) Class G06F 11/3684 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342232 | Gopalan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Research Foundation for The State University of New York (Binghamton, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Kartik Gopalan (Vestal, New York); Ping Yang (Vestal, New York); Dinuni K. Fernando (Hapugoda, Sri Lanka); Jonathan Terner (Beacon, New York) |
| ABSTRACT | Post-copy is one of the two key techniques (besides pre-copy) for live migration of virtual machines in data centers. Post-copy provides deterministic total migration time and low downtime for write-intensive VMs. However, if post-copy migration fails for any reason, the migrating VM is lost because the VM's latest consistent state is split between the source and destination nodes during migration. PostCopyFT provides a new approach to recover a VM after a destination or network failure during post-copy live migration using an efficient reverse incremental checkpointing mechanism. PostCopyFT was implemented and evaluated in the KVM/QEMU platform. Experimental results show that the total migration time of post-copy remains unchanged while maintaining low failover time, downtime, and application performance overhead. |
| FILED | Wednesday, April 28, 2021 |
| APPL NO | 17/242508 |
| CURRENT CPC | Electric Digital Data Processing G06F 11/301 (20130101) G06F 11/0772 (20130101) G06F 11/0793 (20130101) G06F 11/1471 (20130101) G06F 11/1484 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342259 | IDREOS et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Stratos IDREOS (Cambridge, Massachusetts); Niv DAYAN (Somerville, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Stratos IDREOS (Cambridge, Massachusetts); Niv DAYAN (Somerville, Massachusetts) |
| ABSTRACT | Embodiments of the invention utilize an improved LSM-tree-based key-value approach to strike the optimal balance between the costs of updates and lookups and storage space. The improved approach involves use of a new merge policy that removes merge operations from all but the largest levels of LSM-tree. In addition, the improved approach may include an improved LSM-tree that allows separate control over the frequency of merge operations for the largest level and for all other levels. By adjusting various parameters, such as the storage capacity of the largest level, the storage capacity of the other smaller levels, and/or the size ratio between adjacent levels in the improved LSM-tree, the improved LSM-tree-based key-value approach may maximize throughput for a particular workload. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376827 |
| CURRENT CPC | Electric Digital Data Processing G06F 12/0238 (20130101) Original (OR) Class G06F 16/1734 (20190101) G06F 16/2246 (20190101) G06F 2212/7202 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342443 | PRVULOVIC et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GEORGIA TECH RESEARCH CORPORATION (Atlanta, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Milos PRVULOVIC (Atlanta, Georgia); Chia-Lin CHENG (Atlanta, Georgia); Luong N. NGUYEN (Atlanta, Georgia); Alenka ZAJIC (Atlanta, Georgia) |
| ABSTRACT | A system for detecting hardware Trojans in a computerized device includes a digital circuit having switching components operating pursuant to at least one clock frequency and positioned within an interrogation range of an incident carrier wave. A modulated backscatter response is reflected from the digital circuit upon arrival of the incident carrier wave in the presence of the switching operations. A detection device is positioned to receive the modulated backscatter response. A computer connected to the detection device identifies harmonics of a respective clock frequency of the digital circuit from the backscatter response and identifies characteristics of the harmonics indicating a presence or an absence of a hardware Trojan connected to the digital circuit. |
| FILED | Thursday, January 16, 2020 |
| APPL NO | 16/973512 |
| CURRENT CPC | Electric Digital Data Processing G06F 21/44 (20130101) G06F 21/76 (20130101) G06F 21/554 (20130101) Original (OR) Class G06F 21/556 (20130101) G06F 21/566 (20130101) G06F 30/398 (20200101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342508 | Arroyave et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Texas A and M University System (College Station, Texas) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Raymundo Arroyave (College Station, Texas); Tanner Q. Kirk (College Station, Texas); Richard J. Malak (College Station, Texas) |
| ABSTRACT | A system and method for determining optimal configuration of a functionally graded material is provided. A multi-dimensional configuration space can be sampled to create a model including an obstacle and free space. Using a cost function including a lack of monotonicity objective, and a path planning algorithm, a gradient path for a functionally graded materially can be determined through the free space in the configuration space. The resulting gradient path can be used to create functionally graded materials with desirable combinations of characteristics. |
| FILED | Friday, May 28, 2021 |
| APPL NO | 17/333726 |
| CURRENT CPC | Electric Digital Data Processing G06F 30/23 (20200101) G06F 30/27 (20200101) Original (OR) Class G06F 2111/20 (20200101) Computer Systems Based on Specific Computational Models G06N 5/003 (20130101) G06N 20/10 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342546 | Beigi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Ghazaleh Beigi (Tempe, Arizona); Kai Shu (Mesa, Arizona); Ruocheng Guo (Sichuan, China PRC); Suhang Wang (Mesa, Arizona); Huan Liu (Tempe, Arizona) |
| ASSIGNEE(S) | Arizona Board of Regents on Behalf of Arizona State University (Tempe, Arizona) |
| INVENTOR(S) | Ghazaleh Beigi (Tempe, Arizona); Kai Shu (Mesa, Arizona); Ruocheng Guo (Sichuan, China PRC); Suhang Wang (Mesa, Arizona); Huan Liu (Tempe, Arizona) |
| ABSTRACT | Various embodiments of a computer-implemented system which learns textual representations while filtering out potentially personally identifying data and retaining semantic meaning within the textual representations are disclosed herein. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245774 |
| CURRENT CPC | Electric Digital Data Processing G06F 21/6245 (20130101) G06F 40/30 (20200101) Original (OR) Class G06F 40/211 (20200101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/6235 (20130101) G06K 2009/6237 (20130101) Computer Systems Based on Specific Computational Models G06N 3/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210342690 | WANG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The George Washington University (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ke WANG (Alexandria, Virginia); Hao ZHENG (Arlington, Virginia); Ahmed LOURI (Vienna, Virginia) |
| ABSTRACT | Systems and methods are disclosed for improving on-chip security, while minimizes the latency and cost of security techniques to improve system-level performance and power simultaneously. The framework uses machine learning algorithms, such as an artificial neural network (ANN), for runtime attack detection with higher accuracy. Further, a learning-based attack mitigation method using deep reinforcement learning is disclosed, where the method may be used to isolate the malicious components and to optimize network latency and energy-efficiency. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307563 |
| CURRENT CPC | Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 9/6262 (20130101) Computer Systems Based on Specific Computational Models G06N 3/04 (20130101) G06N 3/08 (20130101) Original (OR) Class Transmission of Digital Information, e.g Telegraphic Communication H04L 63/1425 (20130101) H04L 63/1441 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343444 | Graves |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | |
| INVENTOR(S) | William Graves (Tempe, Arizona) |
| ABSTRACT | A method includes accelerating an electron bunch along a direction of propagation to a relativistic energy and partitioning the electron bunch by transmitting the electron bunch through a grating at the relativistic energy. The grating includes a plurality of alternating narrow portions and wide portions. The narrow portions have a first thickness in a direction substantially parallel to the direction of propagation of the electron bunch, and the wide portions have a second thickness in the direction substantially parallel to the direction of propagation of the electron bunch. The second thickness is greater than the first thickness. The method also includes generating a pulse of light using the partitioned electron bunch. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/378099 |
| CURRENT CPC | Techniques for Handling Particles or Ionising Radiation Not Otherwise Provided For; Irradiation Devices; Gamma Ray or X-ray Microscopes G21K 1/062 (20130101) Original (OR) Class G21K 2201/061 (20130101) G21K 2201/067 (20130101) Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 4/00 (20130101) X-ray Technique H05G 2/008 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343479 | Gu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Drexel University (Philadelphia, Pennsylvania); epoXtal, LLC (Philadelphia, Pennsylvania); The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Zongquan Gu (Chalfont, Pennsylvania); Jonathan E. Spanier (Bala Cynwyd, Pennsylvania); Lane W. Martin (Moraga, California); Christopher R. Elsass (Santa Barbara, California); Alessia Polemi (Philadelphia, Pennsylvania); Anoop Rama Damodoran (Minneapolis, Minnesota) |
| ABSTRACT | The present disclosure describes a strained dielectric material comprising at least one type of component containing a domain wall variant pattern, or superdomain structure, that is in phase-co-existence with, or in close phase proximity to, a paraelectric state achieved at zero electric field or over a finite range of non-zero electric field, wherein the at least one type of component comprises one or more of an in-plane sub-domain polarization component, a plane-normal sub-domain polarization component, or a solid solution of a ferroelectric. |
| FILED | Thursday, August 01, 2019 |
| APPL NO | 17/264687 |
| CURRENT CPC | Capacitors; Capacitors, Rectifiers, Detectors, Switching Devices or Light-sensitive Devices, of the Electrolytic Type H01G 5/0138 (20130101) H01G 7/026 (20130101) Original (OR) Class Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 41/1871 (20130101) H01L 41/1876 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343528 | LEE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | STRATIO (Seoul, South Korea) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jae Hyung LEE (Palo Alto, California); Yaul NA (East Palo Alto, California); Youngsik KIM (Seoul, South Korea) |
| ABSTRACT | A method for obtaining a semiconductor island includes epitaxially growing a semiconductor structure over a substrate with a mask layer defining a region not covered by the mask layer. The semiconductor structure includes a first portion located adjacent to the mask layer and a second portion located away from the mask layer. The first portion has a first height that is less than a second height of a portion of the mask layer located adjacent to the first portion. The second portion has a third height that is equal to, or greater than the second height. The method also includes forming a filling layer over at least the first portion; and, subsequently removing at least a portion of the semiconductor structure that is located above the second height. Devices made by this method are also disclosed. |
| FILED | Friday, November 09, 2018 |
| APPL NO | 17/289205 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/02381 (20130101) H01L 21/02488 (20130101) H01L 21/02532 (20130101) H01L 21/02636 (20130101) Original (OR) Class H01L 21/02664 (20130101) H01L 21/30625 (20130101) H01L 21/31053 (20130101) H01L 21/823871 (20130101) H01L 21/823892 (20130101) H01L 23/53271 (20130101) H01L 27/092 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344400 | Gupta et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | WASHINGTON STATE UNIVERSITY (Pullman, Washington) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Subhanshu Gupta (Pullman, Washington); Erfan Ghaderi (Hillsboro, Oregon) |
| ABSTRACT | An N-element baseband (BB) time-domain spatial signal processor system and methodology for large modulated bandwidth multi-antenna receivers are provided. Such a processor generally includes a pipeline converter configured as an asynchronous time-to-digital converter, wherein the asynchronous time-to-digital converter arrangement generates a residue value and an asynchronous pulse and is further arranged to amplify the residue value so as to result in an amplified residue value; and a 2-bit flash time-to-digital-converter configured to quantize the amplified residue value. Thus, a true-time delay spatial signal processing system and technique in the time-domain that enables beamforming, beam-nulling and multiple independent interference cancellation after time-alignment of signals using cascaded voltage-to-time converters and quantization using relaxed pipeline time-to-digital converters is presented. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307008 |
| CURRENT CPC | Time-interval Measuring G04F 10/005 (20130101) Antennas, i.e Radio Aerials H01Q 3/36 (20130101) H01Q 3/2611 (20130101) Transmission H04B 7/0639 (20130101) Original (OR) Class Transmission of Digital Information, e.g Telegraphic Communication H04L 25/03891 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344538 | PADOS et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Research Foundation for The State University of New York (Amherst, New York) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Dimitrios PADOS (Amherst, New York); Stella BATALAMA (Amherst, New York); Georgios SKILVANITIS (North Tonawanda, New York); Song-Wen HUANG (Amherst, New York) |
| ABSTRACT | The present disclosure may be embodied as a transmitter for multiuser multicarrier-chirp-division-multiplexing (“MU-MCDM”) communications. The present disclosure may be embodied as a receive for MU-MCDM communications. The present disclosure may also be embodied as a method for transmitting an MU-MCDM communication signal. The present disclosure may also be embodied as a method for receiving an MU-MCDM communication signal. |
| FILED | Monday, September 30, 2019 |
| APPL NO | 17/281146 |
| CURRENT CPC | Transmission H04B 1/7087 (20130101) H04B 2001/6912 (20130101) Multiplex Communication H04J 13/0077 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 27/0014 (20130101) H04L 27/264 (20130101) Original (OR) Class H04L 27/2639 (20130101) H04L 27/3405 (20130101) H04L 27/26025 (20210101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344554 | Farritor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shane Farritor (Lincoln, Nebraska); Tyler Wortman (Grand Island, Nebraska); Kyle Strabala (Pittsburgh, Pennsylvania); Ryan McCormick (Valencia, California); Amy Lehman (York, Nebraska); Dmitry Oleynikov (Omaha, Nebraska); Eric Markvicka (Lincoln, Nebraska) |
| ABSTRACT | Various medical devices and related systems, including robotic and/or in vivo medical devices, and various robotic surgical devices for in vivo medical procedures. Included herein, for example, is a robotic surgical system having a support beam positionable through an incision, and a robotic device having a device body, first and second rotating shoulder components coupled to the device body, and first and second robotic arms coupled to the first and second shoulder components, respectively. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/340669 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 34/30 (20160201) A61B 90/30 (20160201) A61B 90/361 (20160201) A61B 2034/302 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/06 (20130101) B25J 9/0087 (20130101) Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 2219/40418 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 41/0631 (20130101) Original (OR) Class H04L 43/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344617 | LOURI et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The George Washington University (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ahmed LOURI (Vienna, Virginia); Yuecben Chen (Arlington, Virginia) |
| ABSTRACT | Systems and methods are disclosed for reducing latency and power consumption of on-chip movement through an approximate communication framework for network-on-chips (“NoCs”). The technology leverages the fact that big data applications (e.g., recognition, mining, and synthesis) can tolerate modest error and transfers data with the necessary accuracy, thereby improving the energy-efficiency and performance of multi-core processors. |
| FILED | Tuesday, May 04, 2021 |
| APPL NO | 17/307745 |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 49/109 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344618 | ZHENG et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The George Washington University (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Hao ZHENG (Arlington, Virginia); Ke WANG (Alexandria, Virginia); Ahmed LOURI (Vienna, Virginia) |
| ABSTRACT | An interconnection network for a processing unit having an array of cores. The interconnection network includes routers and adaptable links that selectively connect routers in the interconnection network. For example, each router may be electrically connected to one or more of the adaptable links via one or more multiplexers and a link controller may control the multiplexers to selectively connect routers via the adaptable links. In another example, adaptable links may be formed as part of an interposer and the link controller selectively connect routers via the adaptable links in the interposer using interposer switches. The adaptable links enable the interconnection network to be dynamically partitioned. Each of those partitions may be dynamically reconfigured to form a topology. |
| FILED | Friday, October 30, 2020 |
| APPL NO | 17/085454 |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 12/44 (20130101) H04L 41/12 (20130101) H04L 41/0813 (20130101) H04L 45/60 (20130101) H04L 49/15 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Agriculture (USDA)
| US 20210337791 | Choi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Man Y. Choi (Albany, Oregon); Robert K. Vander Meer (Newberry, Florida); Satya P. Chinta (Gainesville, Florida) |
| ABSTRACT | Methods for killing insects (e.g., Drosophila species such as Drosophila suzukii), involving treating an object or area with an insect (e.g., Drosophila species such as Drosophila suzukii) killing effective amount of a composition containing at least tyramine and/or N-methyl-tyramine, optionally a phagostimulant (e.g., sucrose), optionally food material (e.g., materials used to attract insects (e.g., Drosophila species such as Drosophila suzukii adults) such as grape juice, fruit juices, apple cider vinegars), optionally non-caloric sugars (e.g., sucralose and erythritol), and optionally a carrier. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245165 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 25/006 (20130101) A01N 33/10 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210338698 | Kuchipudi |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Penn State Research Foundation (University Park, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Suresh Kuchipudi (State College, Pennsylvania) |
| ABSTRACT | Provided are methods for prophylaxis or treatment of SARS-CoV-2 by administering a composition comprising one or more iminosugars to an individual in need thereof. The compositions may be administered to an individual who is at risk of becoming infected by SARS-CoV-2, or has been diagnosed with a SARS-CoV-2 infection. The iminosugars can inhibit SARS-CoV-2 cell entry and replication. The iminosugars potentiate co-administered antiviral agents, such as nucleoside analogs. |
| FILED | Tuesday, April 27, 2021 |
| APPL NO | 17/241894 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/437 (20130101) A61K 31/445 (20130101) A61K 31/702 (20130101) Original (OR) Class A61K 31/706 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/14 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340081 | MIR |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | AGROFRESH INC. (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Nazir MIR (Somerset, New Jersey) |
| ABSTRACT | Disclosed are adsorption complexes that include 1-methylcyclopropene (1-MCP) and a metal coordination polymer network (MCPN), wherein the MCPN is a porous material, and the 1-MCP is adsorbed into the MCPN. Also disclosed are kits for containing 1-MCP that include the adsorption complex in a 1-MCP-impermeable package. Also disclosed are methods of releasing 1-methylcyclopropene (1-MCP) from the kit that include the application of aqueous fluids, heat, and/or pressure. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/371329 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 3/00 (20130101) A01N 25/10 (20130101) A01N 27/00 (20130101) Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 20/226 (20130101) Acyclic or Carbocyclic Compounds C07C 7/10 (20130101) C07C 7/12 (20130101) Original (OR) Class C07C 53/06 (20130101) C07C 55/02 (20130101) C07C 317/14 (20130101) C07C 317/44 (20130101) Heterocyclic Compounds C07D 251/12 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 1/08 (20130101) C07F 3/02 (20130101) C07F 3/06 (20130101) C07F 15/02 (20130101) C07F 15/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340553 | Hittinger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| INVENTOR(S) | Chris Todd Hittinger (Madison, Wisconsin); EmilyClare Patricia Baker (Madison, Wisconsin) |
| ABSTRACT | Polypeptides comprising maltose/maltotriose transporters are provided. Additionally, polynucleotides, DNA constructs, and vectors encoding a maltose/maltotriose transporter, or yeast cells harboring such polynucleotides are provided. The yeast cell may be a Saccharomyces eubayanus cell modified to increase the expression or transport activity of a maltose/maltotriose transporter at the plasma membrane of the cell. Further, methods are provided for making a fermentation product by culturing any one of the yeast cells described herein with a fermentable substrate. Finally, methods are provided to select for and isolate maltotriose-utilizing strains of Saccharomyces eubayanus. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/341224 |
| CURRENT CPC | Peptides C07K 14/395 (20130101) Beer; Preparation of Beer by Fermentation; Preparation of Malt for Making Beer; Preparation of Hops for Making Beer C12C 11/00 (20130101) Wine; Preparation Thereof; Alcoholic Beverages; Preparation of Alcoholic Beverages Not Provided for in Subclasses C12C or C12H C12G 1/0203 (20130101) C12G 3/02 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/16 (20130101) C12N 15/81 (20130101) Original (OR) Class C12N 2500/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340559 | Ozias-Akins et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNIVERSITY OF GEORGIA RESEARCH FOUNDATION, INC. (ATHENS, Georgia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Peggy Ozias-Akins (Tifton, Georgia); Joann A. Conner (Tifton, Georgia) |
| ABSTRACT | Methods and compositions disclosed herein generally relate to genes involved in plant reproduction and methods of using the same. |
| FILED | Tuesday, March 17, 2020 |
| APPL NO | 16/821755 |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8287 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343618 | Ma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wisconsin Alumni Research Foundation (Madison, Wisconsin) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Zhenqiang Ma (Middleton, Wisconsin); Huilong Zhang (Madison, Wisconsin); Shaoqin Gong (Middleton, Wisconsin) |
| ABSTRACT | Flexible transistors and electronic circuits incorporating the transistors are provided. The flexible transistors promote heat dissipation from the active regions of the transistors while preserving their mechanical flexibility and high-frequency performance. The transistor designs utilize thru-substrate vias (TSVs) beneath the active regions of thin-film type transistors on thin flexible substrates. To promote rapid heat dissipation, the TSVs are coated with a material having a high thermal conductivity that transfers heat from the active region of the transistor to a large-area ground. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/862825 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/3672 (20130101) Original (OR) Class H01L 23/5226 (20130101) H01L 29/778 (20130101) H01L 29/66431 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Aeronautics and Space Administration (NASA)
| US 20210338593 | Ferrari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| ASSIGNEE(S) | Board of Regents of the University of Texas System (Austin, Texas); The Ohio State University Research Foundation (Columbus, Ohio) |
| INVENTOR(S) | Mauro Ferrari (Houston, Texas); Ennio Tasciotti (Houston, Texas); Jason Sakamoto (Houston, Texas) |
| ABSTRACT | Multistage delivery vehicles are disclosed which include a first stage particle and a second stage particle. The first stage particle is a micro or nanoparticle that contains the second stage particle. The second stage particle includes an active agent, such as a therapeutic agent or an imaging agent. The multistage delivery vehicle allows sequential overcoming or bypassing of biological barriers. The multistage delivery vehicle is administered as a part of a composition that includes a plurality of the vehicles. Methods of making the multistage delivery vehicles are also provided. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368401 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/50 (20130101) Original (OR) Class A61K 9/51 (20130101) A61K 9/127 (20130101) A61K 9/1271 (20130101) A61K 31/165 (20130101) A61K 31/704 (20130101) A61K 31/7088 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339894 | Murphey et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Thomas W. Murphey (Fort Collins, Colorado); Levi Nicholson (Fort Collins, Colorado); Michael Folkers (Fort Collins, Colorado); Kyle Egan (Fort Collins, Colorado); Erik Pranckh (Fort Collins, Colorado); Opterus Research and Development Inc. (Fort Collins, Colorado) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Thomas W. Murphey (Fort Collins, Colorado); Levi Nicholson (Fort Collins, Colorado); Michael Folkers (Fort Collins, Colorado); Kyle Egan (Fort Collins, Colorado); Erik Pranckh (Fort Collins, Colorado) |
| ABSTRACT | A trussed collapsible tubular mast includes a deformable beam having an extended state, a flattened state, and a rolled state, where a stiffness and strength of the deformable beam in the extended state is greater than a different stiffness and a different strength of the deformable beam in the flattened state. At least one collapsible tubular mast wall has a plurality of truss members of a first material having a first material thickness. At least one truss member is disposed substantially perpendicular to a longitudinal axis of the trussed collapsible tubular mast. Disposed between the truss members is a wall area of a second material thickness less thick than the first material thickness. |
| FILED | Wednesday, July 14, 2021 |
| APPL NO | 17/305740 |
| CURRENT CPC | Cosmonautics; Vehicles or Equipment Therefor B64G 1/222 (20130101) B64G 1/407 (20130101) B64G 1/443 (20130101) B64G 9/00 (20130101) Original (OR) Class Structural Elements; Building Materials E04C 3/005 (20130101) E04C 3/28 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341098 | Aston et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Boeing Company (Chicago, Illinois) |
| ASSIGNEE(S) | The Boeing Company (Chicago, Illinois) |
| INVENTOR(S) | Richard W. Aston (Brea, California); Michael John Langmack (Huntington Beach, California); Anna M. Tomzynska (Seal Beach, California); Matthew Herrmann (Rancho Palos Verdes, California); Emily C. Woods (Redondo Beach, California) |
| ABSTRACT | An isolation coupler for coupling a functional element to a support structure includes a first bracket. The first bracket includes a number of first-bracket sides. The number of first-bracket sides forms a closed polygonal shape, in plan view. The isolation coupler further includes a number of isolators coupled to each one of the first-bracket sides. The isolation coupler also includes a second bracket. The second bracket includes a number of second-bracket sides. The second bracket sides are coupled to the isolators. The number of second-bracket sides is equal to the number of first-bracket sides and forms the closed polygonal shape, in plan view. The isolators separate each one of the first-bracket sides from a corresponding one of the second-bracket sides to attenuate a load transferred from the first bracket to the second bracket. |
| FILED | Monday, July 19, 2021 |
| APPL NO | 17/378902 |
| CURRENT CPC | Equipment for Fitting in or to Aircraft; Flying Suits; Parachutes; Arrangements or Mounting of Power Plants or Propulsion Transmissions in Aircraft B64D 47/00 (20130101) Springs; Shock-absorbers; Means for Damping Vibration F16F 1/3732 (20130101) F16F 15/08 (20130101) Frames, Casings or Beds of Engines, Machines or Apparatus, Not Specific to Engines, Machines or Apparatus Provided for Elsewhere; Stands; Supports F16M 13/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343921 | CHOI et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UNITED STATES OF AMERICA AS REPRESENTED BY THE ADMINISTRATOR OF NASA (WASHINGTON, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | SANG H. CHOI (POQUOSON, Virginia); HYUN JUNG KIM (POQUOSON, Virginia); ADAM J. DUZIK (ROCKLEDGE, Florida); CHEOL PARK (YORKTOWN, Virginia) |
| ABSTRACT | A metal junction thermoelectric device includes at least one thermoelectric element. The thermoelectric element has first and second opposite sides, and a first conductor made from a first metal, and a second conductor made from a second metal. The first and second conductors are electrically interconnected in series, and the first and second conductors are arranged to conduct heat in parallel between the first and second sides. The first metal has a first occupancy state, and the second metal has a second occupancy state that is lower than the first occupancy state. A temperature difference between the first and second sides of the thermoelectric element causes a charge potential due to the difference in occupancy states of the first and second metals. The charge potential generates electrical power. |
| FILED | Tuesday, July 13, 2021 |
| APPL NO | 17/374091 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 35/20 (20130101) Original (OR) Class H01L 35/32 (20130101) H01L 35/34 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344161 | Delavaux et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cybel, LLC. (Bethlehem, Pennsylvania) |
| ASSIGNEE(S) | Cybel, LLC. (Bethlehem, Pennsylvania) |
| INVENTOR(S) | Jean-Marc Delavaux (Pittstown, New Jersey); Robert E. Tench (Allentown, Pennsylvania); Alexandre Amavigan (Whitehall, Pennsylvania) |
| ABSTRACT | A multi-stage thulium-doped (Tm-doped) fiber amplifiers (TDFA) is based on the use of single-clad Tm-doped optical fiber and includes a wavelength conditioning element to compensate for the nonuniform spectral response of the initial stage(s) prior to providing power boosting in the output stage. The wavelength conditioning element, which may comprise a gain shaping filter, exhibits a wavelength-dependent response that flattens the gain profile and output power distribution of the amplified signal prior to reaching the output stage of the multi-stage TDFA. The inclusion of the wavelength conditioning element allows the operating bandwidth of the amplifier to be extended so as to encompass a large portion of the eye-safe 2 μm wavelength region. |
| FILED | Friday, May 01, 2020 |
| APPL NO | 16/864528 |
| CURRENT CPC | Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/0941 (20130101) H01S 3/1003 (20130101) H01S 3/1616 (20130101) H01S 3/06708 (20130101) H01S 3/06758 (20130101) Original (OR) Class H01S 3/094003 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344554 | Farritor et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Shane Farritor (Lincoln, Nebraska); Tyler Wortman (Grand Island, Nebraska); Kyle Strabala (Pittsburgh, Pennsylvania); Ryan McCormick (Valencia, California); Amy Lehman (York, Nebraska); Dmitry Oleynikov (Omaha, Nebraska); Eric Markvicka (Lincoln, Nebraska) |
| ABSTRACT | Various medical devices and related systems, including robotic and/or in vivo medical devices, and various robotic surgical devices for in vivo medical procedures. Included herein, for example, is a robotic surgical system having a support beam positionable through an incision, and a robotic device having a device body, first and second rotating shoulder components coupled to the device body, and first and second robotic arms coupled to the first and second shoulder components, respectively. |
| FILED | Monday, June 07, 2021 |
| APPL NO | 17/340669 |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 34/30 (20160201) A61B 90/30 (20160201) A61B 90/361 (20160201) A61B 2034/302 (20160201) Manipulators; Chambers Provided With Manipulation Devices B25J 9/06 (20130101) B25J 9/0087 (20130101) Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 2219/40418 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 41/0631 (20130101) Original (OR) Class H04L 43/08 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Environmental Protection Agency (EPA)
| US 20210337804 | Roeder et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jeffrey F. Roeder (Brookfield, Connecticut); Melissa A. Petruska (Newtown, None); Trevor E. James (Plantsville, Connecticut); Thomas J. Spoonmore (Norwalk, Connecticut); Peter C. Van Buskirk (Newtown, Connecticut) |
| ABSTRACT | Polymer coatings and surfaces are disclosed with antimicrobial properties. The antimicrobial action is provided by high surface area materials contained within the coating or surface. The high surface area materials may contain photocatalysts that create reactive oxygen species upon exposure to visible light or transition metals that create reactive oxygen species upon exposure to hydrogen peroxide. The high surface area materials may also sorb disinfecting liquids and desorb them over time to provide disinfection. |
| FILED | Wednesday, June 09, 2021 |
| APPL NO | 17/343723 |
| CURRENT CPC | Preservation of Bodies of Humans or Animals or Plants or Parts Thereof; Biocides, e.g as Disinfectants, as Pesticides or as Herbicides; Pest Repellants or Attractants; Plant Growth Regulators A01N 25/10 (20130101) A01N 59/06 (20130101) A01N 59/20 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210339207 | Chowdhury et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Connecticut (Farmington, Connecticut) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Maqsud R. Chowdhury (Willimantic, Connecticut); Jeffrey R. McCutcheon (Tolland, Connecticut) |
| ABSTRACT | A method of making a polymer membrane, the method including providing a first monomer solution having a first solvent, a second monomer solution having a second solvent, and a substrate having a surface, and including electrospraying the first monomer solution onto the substrate surface and electrospraying the second monomer solution onto the substrate surface to form the polymer membrane on at least a portion of the substrate surface. |
| FILED | Tuesday, July 13, 2021 |
| APPL NO | 17/374506 |
| CURRENT CPC | Separation B01D 61/025 (20130101) B01D 67/0006 (20130101) B01D 69/02 (20130101) B01D 69/125 (20130101) Original (OR) Class B01D 71/56 (20130101) B01D 2325/06 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/441 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341422 | FAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Xudong FAN (Saline, Michigan); Hongbo ZHU (Johnson City, Tennessee); Katsuo KURABAYASHI (Ann Arbor, Michigan) |
| ABSTRACT | An integrated microfluidic photoionization detector (PID) is provided including a microfluidic ionization chamber a microfluidic ultraviolet radiation chamber that is configured to generate ultraviolet photons. An ultrathin transmissive window is disposed between the microfluidic ionization chamber and the microfluidic ultraviolet radiation chamber that permits the ultraviolet photons to pass from the microfluidic ultraviolet radiation chamber into the microfluidic ionization chamber. Detection systems for one or more VOC analytes are also provided that include a gas chromatography (GC) unit including at least one gas chromatography column and an integrated microfluidic photoionization detector (PID) disposed downstream of the gas chromatography (GC) unit. |
| FILED | Wednesday, October 02, 2019 |
| APPL NO | 17/282671 |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/64 (20130101) Original (OR) Class G01N 30/64 (20130101) G01N 30/463 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Non-Profit Organization (NPO)
| US 20210340126 | Debnath et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York Blood Center, Inc. (New York, New York); The United States of America, As Represented By The Secretary, Department of Health and Human Servic (Bethesda, Maryland) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Asim Kumar Debnath (New York, New York); Francesca Curreli (New, New York); Peter D. Kwong (Bethesda, Maryland); Young Do Kwon (Bethesda, Maryland) |
| ABSTRACT | Substituted phenylpyrrolecarboxamide compounds such as those represented by Formula A can be used in the treatment of HIV infection and related conditions. |
| FILED | Friday, July 02, 2021 |
| APPL NO | 17/366920 |
| CURRENT CPC | Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/18 (20180101) Heterocyclic Compounds C07D 207/34 (20130101) C07D 241/04 (20130101) C07D 401/14 (20130101) C07D 403/12 (20130101) Original (OR) Class C07D 405/14 (20130101) C07D 413/12 (20130101) C07D 417/12 (20130101) C07D 417/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340218 | HEDRICK et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | La Jolla Institute for Allergy and Immunology (La Jolla, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Catherine C. HEDRICK (La Jolla, California); Richard HANNA (San Diego, California) |
| ABSTRACT | Disclosed herein are methods of increasing numbers of monocytes to a tumor or cancer metastasis site in a subject. Non-limiting embodiments include administering or using a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist. Also disclosed herein are methods of increasing, stimulating, activating or promoting monocyte migration to or mobilization against a tumor or cancer metastasis in a subject. Non-limiting embodiments include administering a Nur77 polypeptide or subsequence thereof; a Nur77 agonist; a CX3CR1 agonist; CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD11b+GR1− (Ly6C−)) monocytes; or CD14+CD16+ monocytes and/or CD14dimCD16+ (CD115+CD111b+GR1− (Ly6C−)) monocytes contacted with a Nur77 agonist or contacted with a CX3CR1 agonist. |
| FILED | Tuesday, July 06, 2021 |
| APPL NO | 17/368706 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/704 (20130101) A61K 35/15 (20130101) A61K 38/195 (20130101) A61K 38/1783 (20130101) A61K 39/3955 (20130101) A61K 45/06 (20130101) A61K 47/02 (20130101) A61K 47/6849 (20170801) A61K 2039/545 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) A61P 35/04 (20180101) Peptides C07K 14/70567 (20130101) Original (OR) Class C07K 16/24 (20130101) C07K 16/2857 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210340486 | Andrews et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DEKA Products Limited Partnership (Manchester, New Hampshire) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Richard E. Andrews (Manchester, New Hampshire); Dave D.B. Cannan (Manchester, New Hampshire); Alekhya Akkapeddi (Manchester, New Hampshire); Andrew G. Remec (Manchester, New Hampshire); Bryan A. Finseth (Newbury, New Hampshire); Kevin Kim (Hookset, New Hampshire) |
| ABSTRACT | System and method for providing biocompatible, nutrient filled media to the Human Cells, Tissues, and cellular and tissue-based Products (HCT/P) while removing wastes. The present teachings provide for sensing the characteristics of the media, and modifying the characteristics when necessary. The present teachings can also provide components that can provide fluid pumping integrated with fluid gas exchange, and sensing of fluid characteristics at consistent times during the fluid flow cycle. System and method control multiple bioreactors from a centralized media reservoir, while fluidically isolating the bioreactors from cross-contamination. |
| FILED | Wednesday, April 28, 2021 |
| APPL NO | 17/243324 |
| CURRENT CPC | Apparatus for Enzymology or Microbiology; C12M 23/28 (20130101) C12M 23/42 (20130101) C12M 23/44 (20130101) C12M 27/18 (20130101) C12M 29/00 (20130101) C12M 29/20 (20130101) C12M 41/12 (20130101) C12M 41/16 (20130101) C12M 41/32 (20130101) C12M 41/34 (20130101) C12M 41/48 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Small Business Administration (SBA)
| US 20210338585 | Bloembergen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GreenMark Biomedical Inc. (East Lansing, Michigan) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Steven Bloembergen (Okemos, Michigan); Ian J. McLennan (Burlington, Canada); Nathan Jones (Hamilton, Canada); Ryan Wagner (Kitchener, Canada); Aareet Mahadevan (Waterloo, Canada); Abdel Rahman Elsayed (Waterloo, Canada); Juewen Liu (Kitchener, Canada) |
| ABSTRACT | A delivery device for an active agent comprises nanoparticles based on a biopolymer such as starch. The delivery device may also be in the form of an aptamer-biopolymer-active agent conjugate wherein the aptamer targets the device for the treatment of specific disorders. The nanoparticles may be made by applying a high shear force in the presence of a crosslinker. The particles may be predominantly in the range of 50-150 nm and form a colloidal dispersion of crosslinked hydrogel particles in water. The biopolymer may be functionalized. The aptamer may be conjugated directly to the cross-linked biopolymers. The active agent may be a drug useful for the treatment of cancer. The delivery device survives for a period of time in the body sufficient to allow for the sustained release of a drug and for the transportation and uptake of the conjugate into targeted cells. However, the biopolymer is biocompatible and resorbable. |
| FILED | Thursday, July 15, 2021 |
| APPL NO | 17/376837 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/145 (20130101) Original (OR) Class A61K 9/1676 (20130101) A61K 9/5161 (20130101) A61K 31/704 (20130101) A61K 47/36 (20130101) A61K 47/549 (20170801) A61K 47/6939 (20170801) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Polysaccharides; Derivatives Thereof C08B 31/003 (20130101) C08B 31/185 (20130101) C08B 33/00 (20130101) C08B 35/00 (20130101) Technical Subjects Covered by Former USPC Cross-reference Art Collections [XRACs] and Digests Y10S 977/773 (20130101) Y10S 977/906 (20130101) Technical Subjects Covered by Former US Classification Y10T 428/2982 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210343528 | LEE et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | STRATIO (Seoul, South Korea) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Jae Hyung LEE (Palo Alto, California); Yaul NA (East Palo Alto, California); Youngsik KIM (Seoul, South Korea) |
| ABSTRACT | A method for obtaining a semiconductor island includes epitaxially growing a semiconductor structure over a substrate with a mask layer defining a region not covered by the mask layer. The semiconductor structure includes a first portion located adjacent to the mask layer and a second portion located away from the mask layer. The first portion has a first height that is less than a second height of a portion of the mask layer located adjacent to the first portion. The second portion has a third height that is equal to, or greater than the second height. The method also includes forming a filling layer over at least the first portion; and, subsequently removing at least a portion of the semiconductor structure that is located above the second height. Devices made by this method are also disclosed. |
| FILED | Friday, November 09, 2018 |
| APPL NO | 17/289205 |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/02381 (20130101) H01L 21/02488 (20130101) H01L 21/02532 (20130101) H01L 21/02636 (20130101) Original (OR) Class H01L 21/02664 (20130101) H01L 21/30625 (20130101) H01L 21/31053 (20130101) H01L 21/823871 (20130101) H01L 21/823892 (20130101) H01L 23/53271 (20130101) H01L 27/092 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210344161 | Delavaux et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cybel, LLC. (Bethlehem, Pennsylvania) |
| ASSIGNEE(S) | Cybel, LLC. (Bethlehem, Pennsylvania) |
| INVENTOR(S) | Jean-Marc Delavaux (Pittstown, New Jersey); Robert E. Tench (Allentown, Pennsylvania); Alexandre Amavigan (Whitehall, Pennsylvania) |
| ABSTRACT | A multi-stage thulium-doped (Tm-doped) fiber amplifiers (TDFA) is based on the use of single-clad Tm-doped optical fiber and includes a wavelength conditioning element to compensate for the nonuniform spectral response of the initial stage(s) prior to providing power boosting in the output stage. The wavelength conditioning element, which may comprise a gain shaping filter, exhibits a wavelength-dependent response that flattens the gain profile and output power distribution of the amplified signal prior to reaching the output stage of the multi-stage TDFA. The inclusion of the wavelength conditioning element allows the operating bandwidth of the amplifier to be extended so as to encompass a large portion of the eye-safe 2 μm wavelength region. |
| FILED | Friday, May 01, 2020 |
| APPL NO | 16/864528 |
| CURRENT CPC | Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/0941 (20130101) H01S 3/1003 (20130101) H01S 3/1616 (20130101) H01S 3/06708 (20130101) H01S 3/06758 (20130101) Original (OR) Class H01S 3/094003 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Homeland Security (DHS)
| US 20210341373 | Zang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Utah Research Foundation (Salt Lake City, Utah); Vaporsens, Inc. (Salt Lake City, Utah) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ling Zang (Salt Lake City, Utah); Jayc Johnson (Salt Lake City, Utah); Paul Slattum (Salt Lake City, Utah); Benjamin Ross Bunes (Murray, Utah); Douglas Wayne Later (Sandy, Utah) |
| ABSTRACT | A sensor to detect solid particles of a target salt can include a support substrate, an adsorption layer, a sensing layer oriented between the support substrate and the adsorption layer, and an electrode pair in contact with the sensing layer and separated by the sensing layer. The adsorption layer can include an ion exchange medium formed of a first porous structured material functionalized with basic or acidic functional groups. The basic or acidic functional groups can remove an acid or base component from the target salt to form a free base or free acid, respectively, of the target salt. The sensing layer can include a second porous structured material functionalized to detect the free base or acid of the target salt by a change in conductivity. |
| FILED | Friday, April 23, 2021 |
| APPL NO | 17/239247 |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 35/00 (20130101) Chemical Features in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons; Apparatus Specially Adapted for the Manufacture of Carbon Filaments D01F 9/00 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/1031 (20130101) Original (OR) Class G01N 33/15 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341617 | Sutherland et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| INVENTOR(S) | William T. Sutherland (Washington, District of Columbia); John Bray (Washington, District of Columbia) |
| ABSTRACT | Various embodiments of the present invention are directed towards a system and methods for generating three dimensional (3D) images with increased composite vertical field of view and composite resolution for a spinning three-dimensional sensor, based on actuating the sensor to generate a plurality of sensor axis orientations as a function of rotation of the actuator. The output data from the sensor, such as a spinning LIDAR, is transformable as a function of the actuator angle to generate three dimensional imagery. |
| FILED | Monday, July 12, 2021 |
| APPL NO | 17/373383 |
| CURRENT CPC | Vehicles, Vehicle Fittings, or Vehicle Parts, Not Otherwise Provided for B60R 2300/301 (20130101) Indexing Scheme Relating to Wind, Spring, Weight, Inertia or Like Motors, to Machines or Engines for Liquids Covered by Subclasses F03B, F03D and F03G F05B 2270/804 (20130101) F05B 2270/805 (20130101) F05B 2270/806 (20130101) Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/4813 (20130101) G01S 7/4817 (20130101) G01S 13/00 (20130101) G01S 15/00 (20130101) G01S 17/00 (20130101) G01S 17/88 (20130101) G01S 17/89 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Justice (DOJ)
| US 20210339253 | KLEVAN et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | DxNow, Inc. (Gaithersburg, Maryland); The Brigham and Women's Hospital, Inc. (Cambridge, Massachusetts); Board of Trustees of the Leland Stanford Junior University (Redwood City, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Leonard KLEVAN (Cave Creek, Arizona); Fatih INCI (Palo Alto, California); Utkan DEMIRCI (Stanford, California) |
| ABSTRACT | Embodiments of the present disclosure relate to a magnetic bead platform for isolating sperm cells from biological samples. In some embodiments, such magnetic bead platforms integrate recognition reagents to its surface to bind target cells, such as sperm cells. Such embodiments provide the ability to at least one of rapidly isolate and quantitate sperm cells from biological samples as occur in sexual assault evidence, for example, thereby enhancing identification of suspects in these cases and contributing to the safety of society. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369490 |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/502761 (20130101) Original (OR) Class B01L 2200/027 (20130101) Apparatus for Enzymology or Microbiology; C12M 23/16 (20130101) C12M 35/06 (20130101) C12M 41/36 (20130101) C12M 41/48 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Veterans Affairs (DVA)
| US 20210340516 | CALDWELL |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Augusta University Research Institute, Inc. (Augusta, Georgia); The US Government as Represented by the Department of Veterans Affairs (Washington, District of Columbia) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Ruth CALDWELL (Augusta, Georgia) |
| ABSTRACT | Pathological retinal neovascularization is a common micro-vascular complication in several retinal diseases including retinopathy of prematurity (ROP), diabetic retinopathy, age-related macular degeneration and central vein occlusion. Disclosed herein are compositions and methods useful for the treatment or prevention of retinal neovascularization and related diseases in a subject in need thereof. Exemplary methods include administering a composition including PEGylated arginase 1 to a subject in need thereof to promote reparative angiogenesis and decrease retinal neovascularization in the eye. |
| FILED | Thursday, April 29, 2021 |
| APPL NO | 17/244385 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/00 (20130101) A61K 47/60 (20170801) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 27/02 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/78 (20130101) Original (OR) Class Enzymes C12Y 305/03001 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Security Agency (NSA)
| US 20210344616 | Blumrich et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NVIDIA Corp. (Santa Clara, California) |
| ASSIGNEE(S) | NVIDIA Corp. (Santa Clara, California) |
| INVENTOR(S) | Matthias Augustin Blumrich (Ridgefield, Connecticut); Nan Jiang (Acton, Massachusetts); Larry Robert Dennison (Mendon, Massachusetts) |
| ABSTRACT | A switch architecture enables ports to stash packets in unused buffers on other ports, exploiting excess internal bandwidth that may exist, for example, in a tiled switch. This architecture leverages unused port buffer memory to improve features such as congestion handling and error recovery. |
| FILED | Friday, July 16, 2021 |
| APPL NO | 17/377943 |
| CURRENT CPC | Transmission of Digital Information, e.g Telegraphic Communication H04L 49/70 (20130101) H04L 49/101 (20130101) Original (OR) Class H04L 49/254 (20130101) H04L 49/3036 (20130101) H04L 49/9047 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Nuclear Regulatory Commission (NRC)
| US 20210340520 | GARNER et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NANOVIS, LLC (Columbia City, Indiana); PURDUE RESEARCH FOUNDATION (West Lafayette, Indiana) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Allen L. GARNER (West Lafayette, Indiana); Ram Anand VADLAMANI (West Lafayette, Indiana); David Alan DETWILER (Columbia City, Indiana); Aginiprakash DHANABAL (West Lafayette, Indiana) |
| ABSTRACT | The present disclosure relates to methods of stimulating cell proliferation, promoting differentiation of cells, regenerating cells, promoting nodule formation, and promoting myotube formation. The methods include applying one or more pulses of electricity to cells, each pulse of electricity having a duration of between about 10 nanoseconds and about 1,000 nanoseconds, wherein said pulses of electricity are applied under conditions effective to stimulate cell proliferation, promote differentiation of cells, regenerate cells, promote nodule formation, and promote myotube formation. |
| FILED | Wednesday, July 07, 2021 |
| APPL NO | 17/369271 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/32 (20130101) A61K 35/34 (20130101) A61K 45/06 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/326 (20130101) A61N 1/3616 (20130101) A61N 1/36171 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0654 (20130101) C12N 5/0658 (20130101) C12N 13/00 (20130101) Original (OR) Class C12N 2529/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
U.S. State Government
| US 20210338632 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Rong Li (San Antonio, Texas); Bin Yuan (San Antonio, Texas); Tyler Curiel (San Antonio, Texas) |
| ABSTRACT | The present invention provides methods and compositions for treating or preventing breast cancer with S-equol. The method and compositions are particularly suited to treating triple-negative breast cancer. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule. |
| FILED | Friday, July 09, 2021 |
| APPL NO | 17/372352 |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/353 (20130101) Original (OR) Class A61K 39/3955 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/2818 (20130101) C07K 16/2827 (20130101) C07K 2317/21 (20130101) C07K 2317/24 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Government Rights Acknowledged
| US 20210341547 | BAGGA et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SUNNY BAGGA (CORONA, California); BRIAN J. CADWELL (PASADENA, California); SHAUN MARK GOODWIN (EAST NEW MARKET, Maryland) |
| ASSIGNEE(S) | NORTHROP GRUMMAN SYSTEMS CORPORATION (FALLS CHURCH, Virginia) |
| INVENTOR(S) | SUNNY BAGGA (CORONA, California); BRIAN J. CADWELL (PASADENA, California); SHAUN MARK GOODWIN (EAST NEW MARKET, Maryland) |
| ABSTRACT | A ground fault detection circuit can include a band-pass filter that can have a first node and a second node that can be coupled to an earth ground. The first node can be coupled to a local ground of an automatic test equipment (ATE) system for an electrical device that can be coupled via at least one wire to the ATE. The band-pass filter can be configured to pass and amplify a test current signal established at the first node in response to a coupling of one of a conductor of the at least one wire carrying the test current signal to the local ground, and a conductive element of the electrical device carrying the test current signal to the local ground. A fault alert signal can be provided to provide an indication of ground fault based on a comparison of the amplified test current signal. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863308 |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 31/52 (20200101) Original (OR) Class G01R 31/083 (20130101) G01R 31/2834 (20130101) G01R 31/31905 (20130101) G01R 31/31932 (20130101) Emergency Protective Circuit Arrangements H02H 3/16 (20130101) H02H 3/32 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341576 | Marcus et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Eran Marcus (Culver City, California); Joseph Marron (Manhattan Beach, California); Adam Hodge Greenberg (Los Angeles, California) |
| ABSTRACT | A laser detection and ranging system and method for operating thereof. In some embodiments, the method includes: transmitting a plurality of laser pulses, each at a respective one of a plurality of pulse transmission times; detecting a plurality of return pulses, each at a respective one of a plurality of return pulse times; and estimating a range or a range rate of a target based on the pulse transmission times and the return pulse times. Each of the pulse transmission times may be offset from a corresponding nominal pulse transmission time by a respective pulse position modulation offset, the nominal pulse transmission times being uniformly spaced with a period corresponding to a pulse repetition frequency, the pulse repetition frequency being greater than 500 kHz. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863262 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/484 (20130101) Original (OR) Class G01S 7/4861 (20130101) G01S 17/58 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341577 | Greenberg |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California) |
| ABSTRACT | A lidar for generating a cyclically optimal Pulse Position Modulated (PPM) waveform includes: a memory for storing a list of prime numbers; a processor for obtaining a list of prime numbers up to a predetermined maximum code length; selecting a largest prime number p* that is less than or equal to a ratio of a timing system bandwidth to the predetermined pulse repetition frequency (PRF), from the list of the prime numbers; constructing a list of pulse indices, m=0:p*−1 for the cyclically optimal PPM waveform; calculating a list of pulse modulations, dJs=mod(m2, p*)−(p*−1)/2, wherein dJs are modulation values; calculating a list of nominal pulse timings T, as T=m×ceil(TPRI/Δj), where Δj is a predetermined modulation resolution, and TPRI is the reciprocal of the PRF; and generating the cyclically optimal PPM waveform from the pulse timings t0. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863744 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/484 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341578 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California); Eran Marcus (Culver City, California) |
| ABSTRACT | System and method for generating Pulse Position Modulated (PPM) lidar waveforms generating Pulse Position Modulated (PPM) waveforms in a lidar includes: a) creating a modulation pool, based on a maximum nominal pulse repetition frequency (PRF); b) eliminating bad modulation levels from the modulation pool to generate a good modulation pool; c) selecting a modulation level from the good modulation pool to generate a PPM code element; d) repeating steps b and c N times to generate an N-element PPM code, wherein the PPM code is PRF independent; e) selecting a PRF less than the maximum nominal PRF; f) generating a PPM waveform by applying the N-element PPM code to the selected PRF; and g) transmitting the PPM waveform by the lidar toward a target to determine a range to the target. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863792 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/484 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341579 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California); Eran Marcus (Culver City, California) |
| ABSTRACT | A lidar for generating long PPM waveforms includes: receiving an initial PPM code element and a desired maximum sidelobe height; b) generating a two-column lookup table; c) selecting a candidate modulation level from a pool of available elements; d) identifying the differences between the selected candidate modulation value and each of the code values in the initial PPM code and incrementing corresponding values in the lookup table; e) comparing the values of the lookup table against the desired maximum sidelobe height; f) when a value exceeds the desired maximum sidelobe height, discarding the candidate modulation level, decrementing the corresponding values in the lookup table and repeating steps c to g; g) otherwise, appending the candidate modulation level to the end of the initial PPM code to update the initial code, and repeating steps c to e N times to generate a PPM waveform of length N. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863826 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/484 (20130101) Original (OR) Class G01S 17/10 (20130101) Electric Digital Data Processing G06F 16/2228 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341604 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California); Eran Marcus (Culver City, California) |
| ABSTRACT | A transmitter for communication-less bistatic ranging includes a photon emitter configured to emit a plurality of photons at particular times in a pointing direction, and a processor configured to identify a particular sub-code of a plurality of sub-codes based on a dynamic state of the transmitter, each one of the plurality of sub-codes including a portion of a long optimal ranging code, generate a plurality of encoded pulse timings by dithering pulse timings from a nominal repetition frequency based on the particular sub-code, and control the photon emitter to emit the plurality of photons at the plurality of encoded pulse timings. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863055 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/4811 (20130101) G01S 7/4818 (20130101) G01S 17/003 (20130101) Original (OR) Class G01S 17/10 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341606 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California); Eran Marcus (Culver City, California) |
| ABSTRACT | A method for operating a laser detection and ranging system. In some embodiments, the method includes transmitting a plurality of laser pulses, each at a respective one of a plurality of pulse transmission times; detecting a plurality of return pulses, each at a respective one of a plurality of return pulse times; forming a first time difference, the first time difference being the difference between a first return pulse time of the plurality of return pulse times and a first pulse transmission time of the plurality of pulse transmission times; and incrementing a first element of a first array, the first element of the first array having an index based on the first time difference. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863484 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/484 (20130101) G01S 7/487 (20130101) G01S 7/4861 (20130101) G01S 17/10 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 20210341607 | Greenberg et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | RAYTHEON COMPANY (Waltham, Massachusetts) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Adam Hodge Greenberg (Los Angeles, California); Eran Marcus (Culver City, California) |
| ABSTRACT | Lidar and method for generating repeatable PPM waveforms to determine a range to a target include: a processor for a) creating a modulation pool, based on a maximum nominal PRF and a specified final PPM code length of N; b) obtaining a seed code; c) eliminating bad modulation levels from the modulation pool to generate a good modulation pool, d) selecting a modulation level from the good modulation pool; e) concatenating the selected modulation level to the seed code to generate an i-element modulation sequence; f) repeating steps c to e N times to generate an N-element modulation sequence; g) selecting a PRF less than the maximum nominal PRF; and h) generating a repeatable PPM waveform by applying the N-element modulation sequence to the selected PRF. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863858 |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 7/489 (20130101) G01S 7/4811 (20130101) G01S 7/4817 (20130101) G01S 17/10 (20130101) Original (OR) Class G01S 17/89 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
How To Use This Page
THE FEDINVENT PATENT APPLICATION DETAILS PAGE
Each week, FedInvent analyzes newly granted patents and published patent applications whose origins lead back to funding by the US Federal Government. The FedInvent Patent Details page is a companion to the weekly FedInvents Patents Report.
This week's information is published in the FedInvent Patents report for Thursday, November 04, 2021.
The FedInvent Weekly Patent Details Page contains a subset of patent information to provide a deeper dive into the week's taxpayer-funded patents to help the reader better understand where a patent fits in the federal innovation ecosphere.
HOW IS THE INFORMATION ORGANIZED?
Patents are organized by the funding agency. Within each group, the patents are organized in numeric order. A patent funded by more than one agency will appear in the section of each of the agencies that funded the research and development that resulted in the invention. This approach gives the reader a complete view of the department or agency activity for the week.
WHAT INFORMATION WILL I FIND?
THE PANEL
There is a panel for each patent that contains the patent number and the title of the patent. When you click the panel, it opens to reveal the following information:
FUNDED BY
The agencies that funded the grants, contracts, or other research agreements that resulted in the patent. FedInvent includes as much information on the source of the funding as possible. The information is presented in a hierarchy going from the Federal Department down to the agencies, subagencies, and offices that funded the work. Here are two examples:
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Army Research Office (ARO)
We do our best to provide detailed information about the funding. In some cases, the patent only reports limited information on the origins of the funding. FedInvents presents what it can confirm. We add the patents without the information required by the Bayh-Dole Act to our list of patents worthy of further investigation.
APPLICANT(S) and ASSIGNEES
FedInvent includes both the Applicants and the Assignees because having both provides more information about where the inventive work was done and by what organizations. Many organizations — universities, corporations, and federal agencies — standardize the Assignee/Owner information by the time a patent is granted. In the case of federal patents, many of the patents use the agency headquarters information for patent assignment.
Showing just the headquarters address would make Washington, DC the epicenter of all taxpayer-funded research and development. Providing both the applicant information and the assignee information provides a more accurate picture of where important taxpayer-funded innovation is happening in America. Here are two examples from two different patents:
APPLICANT: U.S. Army Research Laboratory, Adelphi, MD
ASSIGNEE: The United States of America as represented by the Secretary of the Army Washington, DC
APPLICANT: Optech Ventures, LLC (Torrance, California)
ASSIGNEE(S): The Regents of the University of California (Oakland, California); Optech Ventures, LLC (Torrance, California)
INVENTOR(S)
The inventors appear in the same order as they appear on the patent. FedInvents presents the names in first name/last name order because they are easier to read than the last name/first name order of the names on the USPTO patent documents.
ABSTRACT
The abstract is presented as it appears on the patent.
FILED
The date the patent application including the day of the week.
APPL NO
This is the patent application serial number. If you’d like to learn more about how application serial numbers work you can go to the Lists Page.
ART UNIT
Patent data includes the Art Unit where a patent was examined. (The Art Unit isn’t available for published patent applications.) The Art Unit provides insight into what group of patent examiners prosecuted the patent application and the subject matter that the examiners work on. For example:
3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices
You can learn more about ART UNITS on the FedInvent Patents Weekly panel called About Tech Center or you can find information on the FedInvent Lists Page.
CURRENT CPC
Current CPC provides a list of the Cooperative Patent Classification symbols assigned to the patent. These are the CPC symbols assigned at the time the patent was granted.
The FedInvent Project is a patent classification maximalist endeavor or put another way, we believe that the more you understand about patent classification the more you'll learn about the nature of the invention and the types of work that the federal government is funding.
The symbol presented in BOLD is the symbol identified as the "first" classification which is the most relevant classification on the patent. The date that follows the symbol is the date of the most recent revision to the art classed there.
- A61B 1/149 (20130101)
- A61B 1/71 (20130101)
- A61B 1/105 (20130101)
The CPC symbols match the classifications found on the PDF version of the patent. Over time, the classifications on the full text version of the patent change to reflect how USPTO organizes patent art to support its examiners. The two sets of CPCs don’t always match.
VIEW PATENT
As of June 2021, we include two ways to view a patent at USPTO. FedInvent provides a link to the Full-Text Version of the patent and a link to the PDF version of the patent.
HOW DO I FIND A SPECIFIC PATENT ON A PAGE?
You can use the Command F or Control F to find a specific patent you are interested in.
HOW DO I GET HERE?
You navigate to the details of a patent by clicking the information icon that follows a patent on the FedInvent Patents Weekly Report.
You can also reach this page using the weekly page link that looks like this:
https://wayfinder.digital/fedinvent/patents-2021/details-patents-20210427.html
Just update the date portion of the URL. Tuesdays for patents. Thursdays for pre-grant publication of patent applications.
Download a copy of the How To Use This Page