FedInvent™ Patents
Patent Details for Tuesday, August 20, 2024
This page was updated on Tuesday, August 20, 2024 at 04:34 PM GMT
Department of Health and Human Services (HHS)
| US 12063914 | Feinstein et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Research Foundation of the City University of New York (New York, New York) |
| ASSIGNEE(S) | Paul Feinstein (New York, New York) |
| INVENTOR(S) | Paul Feinstein (New York, New York); Charlotte D'Hulst (Brooklyn, New York) |
| ABSTRACT | A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA. |
| FILED | Thursday, December 05, 2019 |
| APPL NO | 16/704740 |
| ART UNIT | 1632 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 67/0275 (20130101) Original (OR) Class A01K 2217/20 (20130101) A01K 2217/072 (20130101) A01K 2227/10 (20130101) A01K 2267/02 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/85 (20130101) C12N 15/8509 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064209 | Nazari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Integrated Medical Sensors, Inc. (Irvine, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Meisam Honarvar Nazari (Irvine, California); Muhammad Mujeeb-U-Rahman (Irvine, California); Mehmet Sencan (Culver City, California) |
| ABSTRACT | Monitoring of one or more key indicators can provide powerful insights into the operation and state of different physical systems. For example, continuous monitoring of multiple analytes in a subject allows for detailed insights into personal health as well as allowing for the implementation of preventative health measures. Herein are described design and processing methods for a small wireless multi-analyte sensing platform that can be used to monitor multiple analytes such as glucose, lactate, Urea and other physicochemical quantities. The design techniques and processing methods presented herein can be used for a multitude of other applications and are not limited to those described here. |
| FILED | Tuesday, May 08, 2018 |
| APPL NO | 16/612391 |
| ART UNIT | 3796 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/002 (20130101) A61B 5/0031 (20130101) Original (OR) Class A61B 5/1473 (20130101) A61B 5/7275 (20130101) A61B 5/14532 (20130101) A61B 2560/0219 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064251 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota) |
| ASSIGNEE(S) | REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota) |
| INVENTOR(S) | Bin He (Arden Hills, Minnesota); Zhaoye Zhou (Minneapolis, Minnesota) |
| ABSTRACT | A system and method for non-invasively generating a report of cardiac electrical activities of a subject includes determining, using cardiac electrical activation information, equivalent current densities (ECDs). The ECDs are assembled into time-course ECD information and a spectrum of the time-course ECD information is analyzed to determine peaks for spectral characteristics of atrial fibrillation (AF). The spectral characteristics of AF are correlated with potential electrical sources of the AF and a report is generated indicating the potential electrical sources of the AF spatially registered with the medical imaging data. |
| FILED | Friday, September 04, 2020 |
| APPL NO | 17/013003 |
| ART UNIT | 3797 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0037 (20130101) A61B 5/0044 (20130101) A61B 5/055 (20130101) A61B 5/316 (20210101) Original (OR) Class A61B 5/333 (20210101) A61B 5/361 (20210101) A61B 5/7278 (20130101) A61B 5/7289 (20130101) A61B 6/032 (20130101) A61B 6/507 (20130101) A61B 2576/023 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064287 | O'Reilly et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sunnybrook Research Institute (Toronto, Canada) |
| ASSIGNEE(S) | Sunnybrook Research Institute (Toronto, Canada) |
| INVENTOR(S) | Meaghan Anne O'Reilly (Toronto, Canada); Kullervo Henrik Hynynen (Toronto, Canada) |
| ABSTRACT | A system and method for controlling the delivery of ultrasound energy to a subject is provided. In particular, such a system and method are capable of safely disrupting the blood-brain barrier. Ultrasound energy is delivered to produce cavitation of an ultrasound contrast agent at a selected pressure value. An acoustic signal is acquired following cavitation, from which a signal spectrum is produced. The signal spectrum is analyzed for the presence of harmonics, such as subharmonics or ultraharmonics. When subharmonics or ultraharmonics are present, the pressure value is decreased for subsequent sonications. If a previous sonication resulted in no subharmonics or ultraharmonics being generated, then the pressure value may be increased. In this manner, the blood-brain barrier can be advantageously disrupted while mitigating potentially injurious effects of the sonication. |
| FILED | Tuesday, September 06, 2022 |
| APPL NO | 17/903999 |
| ART UNIT | 3798 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 8/481 (20130101) Original (OR) Class A61B 8/0808 (20130101) A61B 8/4488 (20130101) A61B 2017/00106 (20130101) A61B 2090/374 (20160201) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 7/02 (20130101) A61N 2007/0091 (20130101) A61N 2007/0095 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064350 | Bachus et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Utah Research Foundation (Salt Lake City, Utah); Joseph A. Longo (Paradise Valley, Arizona) |
| ASSIGNEE(S) | Joseph A. Longo (Paradise Valley, Arizona); University of Utah Research Foundation (Salt Lake City, Utah) |
| INVENTOR(S) | Kent N. Bachus (Salt Lake City, Utah); Sujee Jeyapalina (Salt Lake City, Utah); James Peter Beck (Salt Lake City, Utah); Roy Bloebaum (Salt Lake City, Utah); Jayant P. Agarwal (Salt Lake City, Utah); Joseph A. Longo (Paradise Valley, Arizona); Erik Kubiak (Salt Lake City, Utah); Brian Mueller Holt (Topanga, California) |
| ABSTRACT | An implant assembly for a long bone is adapted to support an exo-prosthesis. The assembly includes a stem, a subdermal component and a percutaneous post. The stem has a proximal end that is adapted to be received in a surgically prepared medullary canal of the long bone, and a distal end having a surface that is adapted to promote bone ingrowth. The subdermal component includes a proximal portion that is adapted for attachment to the distal end of the stem, and a fixation surface that is adapted to promote soft tissue fixation. The percutaneous post has a proximal end that is adapted to be attached to the subdermal component. |
| FILED | Monday, April 11, 2022 |
| APPL NO | 17/717545 |
| ART UNIT | 3774 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/78 (20130101) A61F 2/2814 (20130101) Original (OR) Class A61F 2002/0091 (20150401) A61F 2002/7887 (20130101) A61F 2002/30028 (20130101) A61F 2002/30299 (20130101) A61F 2002/30576 (20130101) A61F 2002/30589 (20130101) A61F 2002/30594 (20130101) A61F 2002/30604 (20130101) A61F 2002/30729 (20130101) A61F 2002/30784 (20130101) A61F 2002/30879 (20130101) A61F 2002/30932 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064383 | Kokko et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sizewise Rentals, L.L.C. (Eden Prairie, Minnesota) |
| ASSIGNEE(S) | Sizewise Rentals, L.L.C. (Eden Prairie, Minnesota) |
| INVENTOR(S) | Michael A. Kokko (Lyme, New Hampshire); Spencer C. Brugger (Orford, New Hampshire); Eric L. Yuan (Lebanon, New Hampshire); Amaris G. Ajamil (White River Junction, Vermont); Jeffrey J. Chu (Norwich, Vermont); Richard M. Greenwald (Lebanon, New Hampshire) |
| ABSTRACT | The present invention relates to the reduction of tissue interface pressure. The present invention provides a method to immerse an individual to a desired depth into a support surface. The method of the present invention maintains a desired level of immersion over time independent of the motion of the individual or changes in the position of the support surface or externally applied loads to the support surface, alone or in combination. The method of the present invention is an improvement to using an individual's weight or height or other sensor to determine inputs to an algorithm for immersing the individual to a certain depth into the surface. No pressure measurements or displacement measurements are required in accordance with the present invention, and the height and weight of the individual is not required. |
| FILED | Friday, August 07, 2020 |
| APPL NO | 16/987757 |
| ART UNIT | 3673 — Wells, Earth Boring/Moving/Working, Excavating, Mining, Harvesters, Bridges, Roads, Petroleum, Closures, Connections, and Hardware |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/442 (20130101) A61B 5/447 (20130101) A61B 2562/029 (20130101) Transport, Personal Conveyances, or Accommodation Specially Adapted for Patients or Disabled Persons; Operating Tables or Chairs; Chairs for Dentistry; Funeral Devices A61G 7/018 (20130101) A61G 7/05769 (20130101) Original (OR) Class A61G 7/05776 (20130101) A61G 2203/34 (20130101) A61G 2203/46 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064410 | Gaston et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CASE WESTERN RESERVE UNIVERSITY (Cleveland, Ohio) |
| ASSIGNEE(S) | CASE WESTERN RESERVE UNIVERSITY (Cleveland, Ohio) |
| INVENTOR(S) | Benjamin Gaston (Cleveland, Ohio); Stephen Lewis (Cleveland, Ohio) |
| ABSTRACT | A method of stimulating ventilatory and/or respiratory drive in a subject in need thereof includes administering to the subject a therapeutically effective amount of a composition comprising a cystine ester or a pharmaceutically acceptable salt thereof. Embodiments described herein relate to compositions and methods of stimulating ventilatory and/or respiratory drive in a subject in need thereof, and particularly relates to compositions and methods of treating breathing diseases and/or disorders associated with impaired ventilatory and/or respiratory drive. |
| FILED | Tuesday, January 05, 2021 |
| APPL NO | 17/141999 |
| ART UNIT | 1615 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 31/225 (20130101) Original (OR) Class A61K 45/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064413 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Rong Li (Washington, District of Columbia); Bin Yuan (Hefei, China PRC); Tyler Curiel (San Antonio, Texas) |
| ABSTRACT | The present invention provides methods and compositions for treating or preventing melanoma with S-equol. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule. |
| FILED | Monday, August 15, 2022 |
| APPL NO | 17/819863 |
| ART UNIT | 1643 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/353 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/2818 (20130101) C07K 16/2827 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064425 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE CHILDREN'S MEDICAL CENTER CORPORATION (Boston, Massachusetts) |
| ASSIGNEE(S) | THE CHILDREN'S MEDICAL CENTER CORPORATION (, None) |
| INVENTOR(S) | Bing Chen (Boston, Massachusetts); Gary Frey (Boston, Massachusetts); Tianshu Xiao (Boston, Massachusetts) |
| ABSTRACT | Described herein are compounds that inhibits the membrane proximal external region (MPER) of a viral envelope (Env), as well as and compositions thereof. Further provided herein are methods for treating or preventing a viral infection comprises administering to a subject in need thereof an agent or compound that inhibits the MPER of a viral Env. In certain embodiments, the viral infection is an HIV infection. |
| FILED | Friday, July 26, 2019 |
| APPL NO | 17/262540 |
| ART UNIT | 1625 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/4709 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064448 | Demokritou et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Nanyang Technological University (Singapore, Singapore); President and Fellows of Harvard College (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Nanyang Technological University (Singapore, Singapore); President and Fellows of Harvard College (Cambridge, Massachusetts) |
| INVENTOR(S) | Philip Demokritou (Brookline, Massachusetts); Glen Deloid (Natick, Massachusetts); Kee Woei Ng (Singapore, Singapore); Say Chye Joachim Loo (Singapore, Singapore) |
| ABSTRACT | Methods for reducing at least one of the bioavailability and absorption of at least one of ingested fat, carbohydrates, and unwanted substances from foodstuff in a subject are disclosed. The methods described herein include administering an amount of a nanobiopolymer, or combinations of nanobiopolymers, sufficient to reduce at least one of the bioavailability and absorption of ingested fat, carbohydrates, and unwanted substances to a subject, such as a human subject. |
| FILED | Friday, November 09, 2018 |
| APPL NO | 16/762845 |
| ART UNIT | 1623 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/146 (20130101) A61K 31/717 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064453 | Baker et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | Board of Regents, The University of Texas System (Austin, Texas) |
| INVENTOR(S) | Aaron B. Baker (Austin, Texas); Jason Lee (Austin, Texas) |
| ABSTRACT | A high-throughput screening system is provided for optimizing the conditioning of patient-specific mesenchymal stem cells using a combinatorial set of biochemical factors, pharmacological inhibitors, and biomechanical forces. Also provided are generalized conditions for performing such conditioning. Cells made by these methods are also provided, in addition to cells having a mixed endothelial cell/pericyte phenotype. These cells produce angiogenic growth factors and induce vascularization following implantation. |
| FILED | Wednesday, September 26, 2018 |
| APPL NO | 16/650195 |
| ART UNIT | 1631 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 9/0024 (20130101) A61K 35/28 (20130101) Original (OR) Class A61K 2035/124 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 9/10 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/069 (20130101) C12N 5/0668 (20130101) C12N 2501/999 (20130101) C12N 2527/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064454 | Kaushal |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Maryland, Baltimore (Baltimore, Maryland) |
| ASSIGNEE(S) | UNIVERSITY OF MARYLAND, BALTIMORE (Baltimore, Maryland) |
| INVENTOR(S) | Sunjay Kaushal (Chicago, Illinois) |
| ABSTRACT | Embodiments of the disclosure concern compositions and methods of use related to particular c-kit+ mesenchymal cells, including cardiac stem cells, obtained from a pediatric or neonatal individual. In specific embodiments, the cells, or conditioned medium or partial or total secretomes thereof, are provided in an effective amount to an individual in need thereof. |
| FILED | Friday, September 01, 2023 |
| APPL NO | 18/459692 |
| ART UNIT | 1631 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/34 (20130101) Original (OR) Class A61K 38/19 (20130101) A61K 38/195 (20130101) A61K 38/1833 (20130101) A61K 38/1866 (20130101) A61K 38/1891 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 9/10 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064468 | Jin |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Wayne State University (Detroit, Michigan) |
| ASSIGNEE(S) | Wayne State University (Detroit, Michigan) |
| INVENTOR(S) | Jian-Ping Jin (Chicago, Illinois) |
| ABSTRACT | Methods and compositions for treating a disorder of cardiac muscle and/or skeletal muscle in a subject according to aspects of the present disclosure. Treatment methods include administering a therapeutically effective dose of a C-terminal portion of troponin I capable of reducing sensitivity of cardiac muscle and/or skeletal muscle to Ca2+ without decreasing maximum force production. Assays for identification of compounds capable of reducing sensitivity of cardiac muscle and/or skeletal muscle to Ca2+ without decreasing maximum force production are further provided. |
| FILED | Friday, August 07, 2020 |
| APPL NO | 16/988240 |
| ART UNIT | 1646 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/1719 (20130101) Original (OR) Class Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6887 (20130101) G01N 2333/4712 (20130101) G01N 2800/324 (20130101) G01N 2800/325 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064469 | Laurie et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | TearSolutions, Inc. (Charlottesville, Virginia); University of Virginia Patent Foundation (Charlottesville, Virginia) |
| ASSIGNEE(S) | TearSolutions, Inc. (Charlottesville, Virginia); University of Virginia Patent Foundation (Charlottesville, Virginia) |
| INVENTOR(S) | Gordon W. Laurie (Charlottesville, Virginia); Marc G. Odrich (Crozet, Virginia); Michelle Carpenter (Novato, California); Thomas R. Gadek (Park City, Utah); Paul A. Laskar (Napa, California) |
| ABSTRACT | This application generally relates to stable peptide compositions and kits comprising low levels of buffering and chelating agents, and methods of using the same. |
| FILED | Thursday, November 04, 2021 |
| APPL NO | 17/519489 |
| ART UNIT | 1654 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0014 (20130101) A61K 9/0048 (20130101) A61K 38/18 (20130101) Original (OR) Class A61K 47/02 (20130101) A61K 47/10 (20130101) A61K 47/12 (20130101) A61K 47/14 (20130101) A61K 47/183 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064476 | Du et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York Blood Center, Inc. (New York, New York); Regents of the University of Minnesota (Minneapolis, Minnesota) |
| ASSIGNEE(S) | New York Blood Center, Inc. (New York, New York); Regents of the University of Minnesota (Minneapolis, Minnesota) |
| INVENTOR(S) | Lanying Du (Rego Park, New York); Wanbo Tai (Elmhurst, New York); Fang Li (St. Paul, Minnesota) |
| ABSTRACT | Provided herein are methods of use of subunit immunogenic compositions, in particular for the prevention and treatment of Zika virus infections. |
| FILED | Friday, October 25, 2019 |
| APPL NO | 17/287938 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/12 (20130101) Original (OR) Class A61K 39/39 (20130101) A61K 2039/55 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/14 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 2770/24122 (20130101) C12N 2770/24134 (20130101) C12N 2770/24171 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064480 | Evans et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GLAXOSMITHKLINE BIOLOGICALS SA (Rixensart, Belgium) |
| ASSIGNEE(S) | GLAXOSMITHKLINE BIOLOGICALS SA (Rixensart, Belgium) |
| INVENTOR(S) | Jay T Evans (Hamilton, Montana); Alyson Smith (Hamilton, Montana) |
| ABSTRACT | The invention relates to compounds of formula (I) and their use in eliciting a pro-Thl7 immune response. Further provided are methods of production of said compounds. (Formula I) wherein m is an integer between 4 and 13; n is an integer between 4 and 13; x is an integer between 4 and 13; y is an integer between 4 and 13. |
| FILED | Friday, April 12, 2019 |
| APPL NO | 17/046595 |
| ART UNIT | 1623 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/04 (20130101) A61K 39/39 (20130101) Original (OR) Class A61K 2039/55511 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/06 (20180101) A61P 37/04 (20180101) Sugars; Derivatives Thereof; Nucleosides; Nucleotides; Nucleic Acids C07H 13/04 (20130101) C07H 13/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064488 | Voss et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | John Voss (Woodland, California); Ruiwu Liu (Sacramento, California) |
| ABSTRACT | The present invention provides methods of using nitroxide spin-labeled amyloid beta-binding compounds to image amyloid. The present invention also provides nitroxide spin-labeled amyloid beta-binding compounds. |
| FILED | Friday, July 30, 2021 |
| APPL NO | 17/389674 |
| ART UNIT | 1618 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/05 (20130101) A61K 31/015 (20130101) A61K 31/53 (20130101) A61K 31/353 (20130101) A61K 31/423 (20130101) A61K 31/428 (20130101) A61K 31/4015 (20130101) A61K 31/4178 (20130101) A61K 31/4184 (20130101) A61K 31/4439 (20130101) A61K 31/4709 (20130101) A61K 49/20 (20130101) Original (OR) Class Heterocyclic Compounds C07D 207/14 (20130101) C07D 207/20 (20130101) C07D 207/273 (20130101) C07D 491/052 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064511 | Franz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Annaliese Franz (Davis, California); Angel Cobo (Davis, California); Leah Thompson (Davis, California); David Coppage (Davis, California) |
| ABSTRACT | This disclosure provides silyl lipid molecules in which one or more carbon-to-carbon double bonds in the lipophilic portion is substituted with a silicon atom. Guidance is provided by which the reader may make silyl lipid molecules from molecular building blocks, and then incorporate silyl lipid molecules into lipid nanoparticles (LNPs). The silyl LNPs can be used as carriers of pharmaceutical agents. Flexible steric and substitution patterns of silyl groups in the LNPs give the user a way to fine-tune physicochemical properties, achieving improved stability and clinical efficacy. This technology is useful for immunization or genetic therapy, such as the preparation and administration of RNA vaccines for protection against the virus that causes COVID-19. |
| FILED | Tuesday, January 24, 2023 |
| APPL NO | 18/159010 |
| ART UNIT | 1612 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/127 (20130101) Original (OR) Class A61K 31/7105 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064512 | Franz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Annaliese Franz (Davis, California); Angel Cobo (Davis, California); Leah Thompson (Davis, California); David Coppage (Davis, California) |
| ABSTRACT | This disclosure provides silyl lipid molecules in which one or more carbon-to-carbon double bonds in the lipophilic portion is substituted with a silicon atom. Guidance is provided by which the reader may make silyl lipid molecules from molecular building blocks, and then incorporate silyl lipid molecules into lipid nanoparticles (LNPs). The silyl LNPs can be used as carriers of pharmaceutical agents. Flexible steric and substitution patterns of silyl groups in the LNPs give the user a way to fine-tune physicochemical properties, achieving improved stability and clinical efficacy. This technology is useful for immunization or genetic therapy, such as the preparation and administration of RNA vaccines for protection against the virus that causes COVID-19. |
| FILED | Wednesday, May 10, 2023 |
| APPL NO | 18/315011 |
| ART UNIT | 1612 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/127 (20130101) Original (OR) Class A61K 31/7105 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064514 | Schneider et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Penn State Research Foundation (University Park, Pennsylvania); THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES (Bethesda, Maryland) |
| ASSIGNEE(S) | THE PENN STATE RESEARCH FOUNDATION (University Park, Pennsylvania); THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, OFFICE OF TECHNOLOGY TRANSFER, NATIONAL INSTITUTES OF HEALTH (Bethesda, Maryland) |
| INVENTOR(S) | Joel P. Schneider (Frederick, Maryland); Scott H. Medina (State College, Pennsylvania) |
| ABSTRACT | The present invention is directed to peptisomes, including nanopeptisomes, which have a perfluorocarbon liquid core containing a perfluorocarbon liquid and a cargo, such as a therapeutically active agent, dispersed in the perfluorocarbon. liquid, and a plurality of amphiphilic peptide molecules surrounding the perfluorocarbon liquid core, wherein the amphiphilic peptide is represented by Formula (I) HB-CL-HP wherein HB is a fluorinated hydrophobic block, such as a fluorinated hydrophobic amino acid sequence, CL is a cross-linking motif, and HP is a hydrophilic amino acid sequence. The present invention is also directed to methods of use of the amphiphilic peptides and peptisomes, such as nanopeptisomes, to deliver a cargo, such as a therapeutically active agent, to a cell, Q wherein the cell may be in vitro, ex vivo, or in vivo. |
| FILED | Monday, July 30, 2018 |
| APPL NO | 16/634679 |
| ART UNIT | 1658 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0009 (20130101) A61K 9/1273 (20130101) Original (OR) Class A61K 47/65 (20170801) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Peptides C07K 7/06 (20130101) C07K 2319/01 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064518 | Liu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Velico Medical Inc. (Beverly, Massachusetts) |
| ASSIGNEE(S) | Velico Medical, Inc. (Beverly, Massachusetts) |
| INVENTOR(S) | Qiyong Peter Liu (Newton, Massachusetts); Junqing Cui (West Roxbury, Massachusetts); Rud Karly Lucien (Lynn, Massachusetts); Ryan Carney (Hudson, New Hampshire); Jihae Sohn (Brighton, Massachusetts); Michelle Arya (Medford, Massachusetts); Abdul W. Khan (Lindenhurst, Illinois) |
| ABSTRACT | A method of treatment of plasma with a physiologically compatible spray dry stable acidic substance (SDSAS) prior to or contemporaneously with spray drying of the plasma that results in greater recovery and greater long-term stabilization of the dried plasma proteins as compared to spray dried plasma that has not be subject to the formulation method of the present invention, as well as compostions related to plasma dried by the methods of the present invention. |
| FILED | Friday, October 22, 2021 |
| APPL NO | 17/508904 |
| ART UNIT | 1655 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/16 (20130101) A61K 9/1617 (20130101) A61K 9/1682 (20130101) Original (OR) Class A61K 9/1688 (20130101) A61K 35/16 (20130101) Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 19/06 (20130101) B01J 2219/00177 (20130101) Containers for Storage or Transport of Articles or Materials, e.g Bags, Barrels, Bottles, Boxes, Cans, Cartons, Crates, Drums, Jars, Tanks, Hoppers, Forwarding Containers; Accessories, Closures, or Fittings Therefor; Packaging Elements; Packages B65D 51/30 (20130101) B65D 81/266 (20130101) Drying Solid Materials or Objects by Removing Liquid Therefrom F26B 3/04 (20130101) F26B 3/06 (20130101) F26B 3/12 (20130101) F26B 5/04 (20130101) F26B 5/065 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064534 | Song et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Massachusetts (Boston, Massachusetts) |
| ASSIGNEE(S) | University of Massachusetts (Boston, Massachusetts) |
| INVENTOR(S) | Jie Song (Shrewsbury, Massachusetts); Pingsheng Liu (Worcester, Massachusetts) |
| ABSTRACT | The invention provides a novel approach in which zwitterionic networks are used to sequester and deliver ionic biomolecules, such as proteins, without compromising their native conformation and bioactivity. Zwitterionic networks are designed to effectively retain and deliver ionic or polar biomolecules for guided tissue regeneration. The invention represents a conceptual advance and enables a novel strategy for the utilization of zwitterionic motifs as therapeutics delivery vehicles and tissue engineering scaffolds. |
| FILED | Wednesday, March 16, 2022 |
| APPL NO | 17/695964 |
| ART UNIT | 1699 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 38/18 (20130101) A61K 38/30 (20130101) A61K 38/1875 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 27/14 (20130101) A61L 27/18 (20130101) A61L 27/50 (20130101) A61L 27/52 (20130101) A61L 27/54 (20130101) A61L 27/58 (20130101) Original (OR) Class A61L 2300/414 (20130101) A61L 2430/02 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064629 | Danilov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Advanced Neurorehabilitation, LLC (Madison, Wisconsin) |
| ASSIGNEE(S) | Advanced Neurorehabilitation, LLC (Madison, Wisconsin) |
| INVENTOR(S) | Yuri P. Danilov (Middleton, Wisconsin); Mitchell E. Tyler (Madison, Wisconsin); Kurt A. Kaczmarek (Madison, Wisconsin) |
| ABSTRACT | In a patient suffering from neural impairment, stimulation is provided to sensory surfaces of the face and/or neck, or more generally to areas of the body that stimulate the trigeminal nerve, while performing an activity intended to stimulate a brain function to be rehabilitated. The simulation may then be continued after the performance of the activity has ceased. It has been found that the patient's performance of the activity is then improved after stimulation has ceased. Moreover, it tends to improve to a greater extent, and/or for a longer time, when the post-activity stimulation is applied, as compared to when post activity stimulation is not applied. |
| FILED | Friday, March 25, 2022 |
| APPL NO | 17/704051 |
| ART UNIT | 3796 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Physical Therapy Apparatus, e.g Devices for Locating or Stimulating Reflex Points in the Body; Artificial Respiration; Massage; Bathing Devices for Special Therapeutic or Hygienic Purposes or Specific Parts of the Body A61H 21/00 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 1/361 (20130101) A61N 1/0456 (20130101) A61N 1/0476 (20130101) A61N 1/0492 (20130101) A61N 1/0526 (20130101) A61N 1/0548 (20130101) A61N 1/36014 (20130101) A61N 1/36025 (20130101) A61N 1/36067 (20130101) A61N 1/36078 (20130101) A61N 1/36082 (20130101) A61N 1/36092 (20130101) A61N 1/36096 (20130101) A61N 1/36103 (20130101) Original (OR) Class Educational or Demonstration Appliances; Appliances for Teaching, or Communicating With, the Blind, Deaf or Mute; Models; Planetaria; Globes; Maps; Diagrams G09B 19/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064641 | Dong et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Pulsethera, Inc. (Chestnut Hill, Massachusetts) |
| ASSIGNEE(S) | Pulsethera, Inc. (Chestnut Hill, Massachusetts) |
| INVENTOR(S) | Pu-Ting Dong (Boston, Massachusetts); Jie Hui (Boston, Massachusetts); Ji-Xin Cheng (Newton, Massachusetts); Yifan Zhu (Allston, Massachusetts) |
| ABSTRACT | Methods of the present invention comprise photoinactivation of catalase in combination with low-concentration peroxide solutions and/or ROS generating agents to provide antibacterial effects. |
| FILED | Thursday, April 20, 2023 |
| APPL NO | 18/303778 |
| ART UNIT | 1758 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 33/40 (20130101) Methods or Apparatus for Sterilising Materials or Objects in General; Disinfection, Sterilisation, or Deodorisation of Air; Chemical Aspects of Bandages, Dressings, Absorbent Pads, or Surgical Articles; Materials for Bandages, Dressings, Absorbent Pads, or Surgical Articles A61L 2/10 (20130101) A61L 2/208 (20130101) A61L 2101/02 (20200801) A61L 2202/26 (20130101) Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 5/062 (20130101) Original (OR) Class A61N 5/0616 (20130101) A61N 5/0624 (20130101) A61N 2005/0635 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064748 | Lee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Sumin Lee (Berkeley, California); Adam Uliana (Berkeley, California); Jeffrey R. Long (Berkeley, California); Christopher J. Chang (Berkeley, California) |
| ABSTRACT | Ether-thioether functionalized porous aromatic framework (PAF) polymers provide high selectivity for iron(II) and iron(III) adsorption in aqueous samples. |
| FILED | Friday, September 17, 2021 |
| APPL NO | 17/478874 |
| ART UNIT | 1777 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 20/265 (20130101) Original (OR) Class B01J 20/3085 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/285 (20130101) C02F 2101/203 (20130101) C02F 2103/06 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 31/22 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064759 | Yang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NUtech Ventures (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (Farmington, Connecticut) |
| ASSIGNEE(S) | NUTECH VENTURES (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (Farmington, Connecticut) |
| INVENTOR(S) | Ruiguo Yang (Lincoln, Nebraska); Arian Jaberi (Lincoln, Nebraska); Amir Monemian Esfahani (Lincoln, Nebraska); Ali Tamayol (Providence, Rhode Island) |
| ABSTRACT | Microfluidic gradient generators that can create robust platforms that can not only be used for creating co-cultures of cells with various ratios, but also can simultaneously generate gradients of mechanical and chemical stresses. A chip utilizes microchambers embedded within channels to provide space for 3D cell culture and exposes these cells to gradients of mechanical shear stress and a chemical treatment. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245381 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5025 (20130101) Original (OR) Class B01L 2300/087 (20130101) B01L 2300/0877 (20130101) B01L 2300/0883 (20130101) Apparatus for Enzymology or Microbiology; C12M 41/46 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/34 (20130101) C12N 2513/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065402 | Ortlund et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Emory University (Atlanta, Georgia) |
| ASSIGNEE(S) | EMORY UNIVERSITY (Atlanta, Georgia) |
| INVENTOR(S) | Eric Ortlund (Decatur, Georgia); Suzanne Mays (Marietta, Georgia); Nathan Jui (Decatur, Georgia); Autumn Flynn (Decatur, Georgia); Michael Dugan (Atlanta, Georgia) |
| ABSTRACT | This disclosure relates to modulators of liver receptor homologue 1 (LRH-1) and methods of managing disease and conditions related thereto. In certain embodiments, modulators are derivatives of hexahydropentalene. In certain embodiments, this disclosure relates to methods of treating or preventing cancer, diabetes, or cardiovascular disease by administering an effective amount of a hexahydropentalene derivative disclosed herein. |
| FILED | Monday, May 22, 2023 |
| APPL NO | 18/200431 |
| ART UNIT | 1621 — Organic Chemistry |
| CURRENT CPC | Acyclic or Carbocyclic Compounds C07C 35/50 (20130101) C07C 39/23 (20130101) C07C 43/23 (20130101) C07C 49/83 (20130101) C07C 49/683 (20130101) C07C 59/54 (20130101) Original (OR) Class C07C 215/70 (20130101) C07C 255/47 (20130101) C07C 271/34 (20130101) C07C 307/02 (20130101) C07C 309/66 (20130101) C07C 2602/22 (20170501) Heterocyclic Compounds C07D 249/04 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 9/091 (20130101) C07F 9/572 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065408 | Safo et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | VIRGINIA COMMONWEALTH UNIVERSITY (Richmond, Virginia); IIIExcor Holdings, LLC (Henrico, Virginia); KING ABDULAZIZ UNIVERSITY (Jeddah, Saudi Arabia); CHILDREN'S HOSPITAL OF PHILADELPHIA (CHOP) (Philadelphia, Pennsylvania) |
| ASSIGNEE(S) | VIRGINIA COMMONWEALTH UNIVERISTY (Richmond, Virginia); KING ABDULAZIZ UNIVERSITY (Jeddah, Saudi Arabia); CHILDREN'S HOSPITAL OF PHILADELPHIA (CHOP) (Philadelphia, Pennsylvania); ILLEXCOR HOLDINGS, LLC (Henrico, Virginia) |
| INVENTOR(S) | Martin Safo (Richmond, Virginia); Yan Zhang (Glen Allen, Virginia); Andrew Fleischman (Henrico, Virginia); David Light (Henrico, Virginia); Moustafa El-Araby (Jeddah, Saudi Arabia); Abdelsattar Omar (Jeddah, Saudi Arabia); Osheiza Abdulmalik (Philadelphia, Pennsylvania) |
| ABSTRACT | Compounds and methods for preventing and/or treating one or more symptoms of sickle cell diseases (SCD) by administering at least one of the compounds are provided. The compounds are chemically modified to increase bioavailability and activity, e.g., so that the compounds prevent adhesion and sickling of red blood cells (RBCs). |
| FILED | Friday, November 03, 2023 |
| APPL NO | 18/386724 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 7/06 (20180101) Heterocyclic Compounds C07D 213/30 (20130101) Original (OR) Class C07D 239/26 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065412 | Verkman et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Alan S. Verkman (San Francisco, California); Marc H. Levin (San Francisco, California); Onur Cil (San Francisco, California); Sujin Lee (San Francisco, California) |
| ABSTRACT | Provided herein are compounds that activate CFTR and methods for treating constipation, dry eye disorders, and other diseases and disorders. |
| FILED | Thursday, May 11, 2023 |
| APPL NO | 18/316183 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/53 (20130101) A61K 31/55 (20130101) A61K 31/496 (20130101) A61K 31/5377 (20130101) A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 1/10 (20180101) A61P 27/04 (20180101) Heterocyclic Compounds C07D 251/46 (20130101) C07D 251/52 (20130101) Original (OR) Class C07D 403/04 (20130101) C07D 413/12 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065413 | Pomper et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Johns Hopkins University (Baltimore, Maryland) |
| ASSIGNEE(S) | THE JOHNS HOPKINS UNIVERSTY (Baltimore, Maryland) |
| INVENTOR(S) | Martin G. Pomper (Baltimore, Maryland); Ronnie C. Mease (Fairfax, Virginia); Ying Chen (Timonium, Maryland); Sangeeta Ray (Ellicott City, Maryland) |
| ABSTRACT | Compositions and methods for visualizing tissue under illumination with near-infrared radiation, including compounds comprising near-infrared, closed chain, sulfo-cyanine dyes and prostate specific membrane antigen ligands are disclosed. |
| FILED | Wednesday, May 26, 2021 |
| APPL NO | 17/331113 |
| ART UNIT | 1618 — Organic Compounds: Bio-affecting, Body Treating, Drug Delivery, Steroids, Herbicides, Pesticides, Cosmetics, and Drugs |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 49/0032 (20130101) A61K 49/0052 (20130101) A61K 51/044 (20130101) A61K 51/0421 (20130101) A61K 51/0446 (20130101) A61K 51/0453 (20130101) A61K 51/0472 (20130101) Heterocyclic Compounds C07D 209/12 (20130101) C07D 209/14 (20130101) C07D 209/24 (20130101) C07D 213/04 (20130101) C07D 249/04 (20130101) C07D 255/02 (20130101) C07D 257/02 (20130101) Original (OR) Class C07D 311/14 (20130101) C07D 311/20 (20130101) C07D 311/82 (20130101) Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 5/027 (20130101) C07F 13/005 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5091 (20130101) G01N 2800/342 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065433 | Lindsley et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | Craig W. Lindsley (Brentwood, Tennessee); P. Jeffery Conn (Nashville, Tennessee); Darren W. Engers (Brentwood, Tennessee); Aaron M. Bender (Spring Hill, Tennessee) |
| ABSTRACT | Described are positive allosteric modulators of muscarinic acetylcholine receptor M1 (mAChR M1), pharmaceutical compositions including the compounds, and methods of using the compounds and compositions for treating neurological disorders, psychiatric disorders, or a combination thereof. |
| FILED | Thursday, October 24, 2019 |
| APPL NO | 17/287442 |
| ART UNIT | 1626 — Organic Chemistry |
| CURRENT CPC | General Methods of Organic Chemistry; Apparatus Therefor C07B 2200/05 (20130101) Heterocyclic Compounds C07D 405/10 (20130101) C07D 405/14 (20130101) Original (OR) Class C07D 413/10 (20130101) C07D 413/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065456 | Raines et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| ASSIGNEE(S) | NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT (Bethesda, Maryland) |
| INVENTOR(S) | Ronald T. Raines (Cambridge, Massachusetts); Ian William Windsor (Cambridge, Massachusetts); Brian James Graham (Belmont, Massachusetts) |
| ABSTRACT | Provided herein are boron-containing compounds, pharmaceutical compositions comprising such compounds, and methods of using such compounds to treat diseases or disorders. |
| FILED | Friday, May 22, 2020 |
| APPL NO | 16/881272 |
| ART UNIT | 1699 — Organic Chemistry |
| CURRENT CPC | Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 5/025 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065465 | Micalizio |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Trustees of Dartmouth College (Hanover, New Hampshire) |
| ASSIGNEE(S) | Trustees of Dartmouth College (Hanover, New Hampshire) |
| INVENTOR(S) | Glenn C. Micalizio (Norwich, Vermont) |
| ABSTRACT | The present disclosure relates to stereodefined polycyclic (e.g., tetracyclic) compounds that contain quaternary centers at one or multiple ring fusions, synthetic methods for preparing such compounds, and methods of using such compounds to treat a disease, such as a brain tumor and, particularly, a glioma. |
| FILED | Friday, October 28, 2022 |
| APPL NO | 18/050730 |
| ART UNIT | 1628 — Organic Chemistry |
| CURRENT CPC | Steroids C07J 1/0055 (20130101) C07J 75/005 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065467 | Srivastava et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| ASSIGNEE(S) | University of Florida Research Foundation, Incorporated (Gainesville, Florida) |
| INVENTOR(S) | Arun Srivastava (Gainesville, Florida); George Vladimirovich Aslanidi (Gainesville, Florida); Kim M. Van Vliet (Gainesville, Florida); Mavis Agbandje-McKenna (Gainesville, Florida) |
| ABSTRACT | The present invention provides AAV capsid proteins comprising modification of one or a combination of the surface-exposed lysine, serine, threonine and/or tyrosine residues in the VP3 region. Also provided are rAAV virions comprising the AAV capsid proteins of the present invention, as well as nucleic acid molecules and rAAV vectors encoding the AAV capsid proteins of the present invention. Advantageously, the rAAV vectors and virions of the present invention have improved efficiency in transduction of a variety of cells, tissues and organs of interest, when compared to wild-type rAAV vectors and virions. |
| FILED | Tuesday, July 05, 2022 |
| APPL NO | 17/810729 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 14/005 (20130101) Original (OR) Class Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/86 (20130101) C12N 2750/14122 (20130101) C12N 2750/14143 (20130101) C12N 2750/14145 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065468 | Walker et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Graham C. Walker (Cambridge, Massachusetts); Siva Sankari Iyer Mani Sankaran (Quincy, Massachusetts); Vigneshbabu Musuri Periasamy (Quincy, Massachusetts) |
| ABSTRACT | The disclosure provides heme binding peptides and their use for treating disorders that can benefit from sequestering free heme. |
| FILED | Wednesday, October 12, 2022 |
| APPL NO | 18/045914 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 14/21 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065479 | Choe et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California); The Trustees of Columbia University in the City of New York (New York, New York) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (Oakland, California); THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK (New York, New York) |
| INVENTOR(S) | Joseph H. Choe (San Francisco, California); Paul Langridge (New York, New York); Wendell A. Lim (San Francisco, California); Kole T. Roybal (San Francisco, California); Gary Struhl (New York, New York) |
| ABSTRACT | Provided are chimeric polypeptides which modulate various cellular processes following cleavage of a force sensor cleavage domain, including non-Notch force sensor cleavage domains, induced upon binding of a specific binding member of the chimeric polypeptide with its binding partner. Methods of using force sensor cleavage domain-containing chimeric polypeptides to modulate cellular functions, including e.g., modulation (including induction or repression) of gene expression, are also provided. Nucleic acids encoding the subject chimeric polypeptides and associated expression cassettes and vectors as well as cells that contain such nucleic acids and/or expression cassettes and vectors are provided. Also provided, are methods of monitoring cell-cell signaling and method of treating a subject using the described components, as well as kits for practicing the subject methods. |
| FILED | Thursday, November 15, 2018 |
| APPL NO | 16/763524 |
| ART UNIT | 1641 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Peptides C07K 14/59 (20130101) C07K 14/705 (20130101) C07K 14/723 (20130101) C07K 14/755 (20130101) Original (OR) Class C07K 16/28 (20130101) C07K 2317/54 (20130101) C07K 2317/55 (20130101) C07K 2317/622 (20130101) C07K 2317/626 (20130101) C07K 2319/02 (20130101) C07K 2319/03 (20130101) C07K 2319/50 (20130101) C07K 2319/60 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5005 (20130101) G01N 33/6803 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065485 | Nunez et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| ASSIGNEE(S) | THE REGENTS OF THE UNIVERSITY OF MICHIGAN (Ann Arbor, Michigan) |
| INVENTOR(S) | Gabriel Nunez (Ann Arbor, Michigan); Jon Oscherwitz (Ann Arbor, Michigan); Kemp Cease (Ann Arbor, Michigan); Yumi Nakamura (Ann Arbor, Michigan); Tyler Nygaard (Bozeman, Montana) |
| ABSTRACT | Materials and methods are provided for treatment and/or prevention of Staphylococcal diseases and disorders such as infection and dermal inflammation. |
| FILED | Friday, October 22, 2021 |
| APPL NO | 17/508692 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/05 (20130101) A61K 31/18 (20130101) A61K 31/37 (20130101) A61K 31/47 (20130101) A61K 31/192 (20130101) A61K 31/196 (20130101) A61K 31/235 (20130101) A61K 31/277 (20130101) A61K 31/366 (20130101) A61K 31/713 (20130101) A61K 39/40 (20130101) A61K 39/085 (20130101) A61K 45/06 (20130101) A61K 2039/505 (20130101) A61K 2039/575 (20130101) Peptides C07K 16/1271 (20130101) Original (OR) Class C07K 2317/34 (20130101) C07K 2317/76 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/113 (20130101) C12N 2310/11 (20130101) C12N 2310/14 (20130101) C12N 2320/31 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065486 | Shoemaker |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | TRUSTEES OF TUFTS COLLEGE (Medford, Massachusetts) |
| ASSIGNEE(S) | Trustees of Tufts College (Medford, Massachusetts) |
| INVENTOR(S) | Charles B. Shoemaker (Medford, Massachusetts) |
| ABSTRACT | Methods, compositions and kits are provided for treating a subject exposed to or at risk for exposure to a disease agent, methods, compositions and kits having a pharmaceutical composition including at least one recombinant binding protein or a source of expression of the binding protein, wherein the binding protein neutralizes at least one or a plurality of disease agents that are toxins, for example at least one of a Botulinum toxin or an Anthrax toxin. |
| FILED | Friday, April 02, 2021 |
| APPL NO | 17/221177 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 2039/505 (20130101) Peptides C07K 16/1278 (20130101) C07K 16/1282 (20130101) Original (OR) Class C07K 2317/31 (20130101) C07K 2317/76 (20130101) C07K 2317/569 (20130101) Enzymes C12Y 304/24069 (20130101) C12Y 304/24083 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 2333/952 (20130101) G01N 2333/954 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065510 | Altae-Tran et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BROAD INSTITUTE, INC. (Cambridge, Massachusetts); MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| ASSIGNEE(S) | THE BROAD INSTITUTE, INC. (Cambridge, Massachusetts); MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Han Altae-Tran (Cambridge, Massachusetts); Linyi Gao (Cambridge, Massachusetts); Feng Zhang (Cambridge, Massachusetts) |
| ABSTRACT | Novel programmable targeting sequences and applications thereof. The targeting sequences can be engineered for binding to proteins, polypeptides, and other macromolecules. |
| FILED | Thursday, July 23, 2020 |
| APPL NO | 16/937286 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 14/47 (20130101) C07K 14/705 (20130101) C07K 19/00 (20130101) Original (OR) Class C07K 2319/02 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065635 | Rathbone et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | MASSACHUSETTS INSTITUTE OF TECHNOLOGY (Cambridge, Massachusetts) |
| INVENTOR(S) | Daniel Rodion Rathbone (Somerville, Massachusetts); David L. Trumper (Plaistow, New Hampshire) |
| ABSTRACT | Organ-on-chip platforms with reduced fluid volumes include circulating fluid volumes of below 1000 μL, preferably about 500 μL or less. The platforms are adjustable for culturing cells with varied oxygen demand at various seeding densities. The platforms include at least one lane, wherein each lane includes at least one cell culture well, at least one oxygenator for fluid oxygenation, and a pump system containing at least one pump per lane. The oxygenator may include a separate fluid path for oxygenating the fluid, which allows controlling and measuring the oxygen concentration in the fluid, shortening the diffusion length, and passively diffusing oxygen. Provided are also different configurations for the oxygenator, fluid circulation in the platforms, attachment means for securing scaffolds to culture wells, and pneumatic plates. |
| FILED | Tuesday, March 19, 2019 |
| APPL NO | 16/358137 |
| ART UNIT | 1799 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/50273 (20130101) B01L 2300/10 (20130101) B01L 2300/0829 (20130101) B01L 2300/0858 (20130101) Apparatus for Enzymology or Microbiology; C12M 21/08 (20130101) C12M 23/12 (20130101) C12M 23/16 (20130101) C12M 23/44 (20130101) C12M 23/46 (20130101) C12M 25/06 (20130101) C12M 25/14 (20130101) C12M 27/00 (20130101) C12M 27/18 (20130101) C12M 29/24 (20130101) Original (OR) Class C12M 41/34 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0671 (20130101) C12N 5/0697 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5008 (20130101) G01N 33/5088 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065640 | Craighead et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CORNELL UNIVERSITY (Ithaca, New York) |
| ASSIGNEE(S) | CORNELL UNIVERSITY (Ithaca, New York) |
| INVENTOR(S) | Harold G. Craighead (Ithaca, New York); Juraj Topolancik (San Jose, California); Harvey Tian (Fayetteville, Arkansas); Christopher Wallin (Ithaca, New York) |
| ABSTRACT | The present invention relates to a microfluidic device for extracting and isolating DNA from cells. The device includes a support having an inlet port for receiving a sample containing a cell, an outlet port for dispensing DNA isolated from the cell, and a microfluidic channel disposed within the support and extending from the inlet port to the outlet port. The microfluidic channel includes a micropillar array, an inflow channel disposed between the inlet port and the micropillar array, and an outflow channel disposed between the micropillar array and the outlet port. The micropillar array includes micropillars spatially configured to entrap, by size exclusion, the cell, to immobilize DNA released from the cell, and to maintain the immobilized DNA in elongated or non-elongated form when hydrodynamic force is applied to the microfluidic channel. Systems and methods of making and using the device are also provided herein. |
| FILED | Saturday, March 06, 2021 |
| APPL NO | 17/194253 |
| ART UNIT | 1634 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/502761 (20130101) B01L 2200/0663 (20130101) B01L 2400/086 (20130101) B01L 2400/0415 (20130101) B01L 2400/0487 (20130101) Apparatus for Enzymology or Microbiology; C12M 47/10 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1017 (20130101) Original (OR) Class Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6806 (20130101) Technical Subjects Covered by Former US Classification Y10T 29/49826 (20150115) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065648 | Ruvkun et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE GENERAL HOSPITAL CORPORATION (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Gary Ruvkun (Newton, Massachusetts); J. Amaranath Govindan (Boston, Massachusetts) |
| ABSTRACT | Disclosed herein are compositions and methods for attenuating detoxification response and related symptoms thereof induced by translation defect. The compositions and methods herein are useful for attenuating detoxification response and/or treat related symptoms thereof in subjects comprising translation defect. The composition and methods herein are also useful for improving pharmacokinetics of a pharmaceutical compound. |
| FILED | Monday, March 22, 2021 |
| APPL NO | 17/208504 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/702 (20130101) A61K 35/74 (20130101) A61K 45/06 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 39/00 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/111 (20130101) C12N 15/113 (20130101) Original (OR) Class C12N 2310/11 (20130101) C12N 2310/14 (20130101) C12N 2310/16 (20130101) C12N 2310/141 (20130101) C12N 2310/531 (20130101) C12N 2310/3233 (20130101) C12N 2320/30 (20130101) C12N 2320/31 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065649 | Wilson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | John T. Wilson (Nashville, Tennessee); Christian Palmer (Nashville, Tennessee) |
| ABSTRACT | Provided herein are a selective pattern recognition receptor (PRR) agonist and a method of selectively activating a PRR. The selective PRR agonist includes a nucleic acid agonist and a macromolecule conjugated to the nucleic acid agonist. The method includes administering the selective PRR agonist to a subject, and cleaving at least a portion of the macromolecule conjugated to the nucleic acid agonist, the cleaving of at least a portion of the macromolecule permitting the agonist to bind a PRR. |
| FILED | Wednesday, January 09, 2019 |
| APPL NO | 16/961205 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/60 (20170801) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1138 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065667 | Dong et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | OHIO STATE INNOVATION FOUNDATION (Columbus, Ohio) |
| ASSIGNEE(S) | OHIO STATE INNOVATION FOUNDATION (Columbus, Ohio) |
| INVENTOR(S) | Yizhou Dong (Dublin, Ohio); Bin Li (Columbus, Ohio) |
| ABSTRACT | The present disclosure generally relates to systems, methods and compositions for use in Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cpf1 genome editing systems. Disclosed herein are modified Cpf1 mRNAs, modified guide RNAs, and combinations thereof, that confer increased levels of genome editing. |
| FILED | Friday, April 14, 2017 |
| APPL NO | 16/094062 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 15/67 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/907 (20130101) Original (OR) Class C12N 2310/315 (20130101) C12N 2310/321 (20130101) C12N 2310/322 (20130101) C12N 2310/335 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065668 | Joung et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The General Hospital Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | J. Keith Joung (Winchester, Massachusetts); Morgan Maeder (Brookline, Massachusetts) |
| ABSTRACT | Methods and constructs for RNA-guided targeting of heterologous functional domains such as transcriptional activators to specific genomic loci. |
| FILED | Wednesday, October 06, 2021 |
| APPL NO | 17/450135 |
| ART UNIT | 1656 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 14/005 (20130101) C07K 14/195 (20130101) C07K 2319/00 (20130101) C07K 2319/01 (20130101) C07K 2319/80 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/16 (20130101) C12N 9/22 (20130101) C12N 9/0071 (20130101) C12N 9/96 (20130101) C12N 9/1007 (20130101) C12N 15/01 (20130101) C12N 15/11 (20130101) C12N 15/63 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/907 (20130101) Original (OR) Class C12N 15/1031 (20130101) C12N 2310/20 (20170501) C12N 2710/00033 (20130101) C12N 2770/00033 (20130101) C12N 2800/80 (20130101) Enzymes C12Y 114/11 (20130101) C12Y 201/01 (20130101) C12Y 301/00 (20130101) C12Y 301/21004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065671 | Bharti et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland); FUJIFILM Cellular Dynamics, Inc. (Madison, Wisconsin) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary, Department of Health and Human Services (Bethesda, Maryland); FUJIFILM Cellular Dynamics, Inc. (Madison, Wisconsin) |
| INVENTOR(S) | Kapil Bharti (Potomac, Maryland); Lucas Chase (Madison, Wisconsin); Feng Xuezhu (Madison, Wisconsin); Balendu Shekhar Jha (Bethesda, Maryland) |
| ABSTRACT | Provided herein are methods of producing an RPE cell population from a starting cell suspension, such as a single cell suspension, of pluripotent stem cells (PSCs). Such a method may comprise culturing the starting single cell suspension of PSCs in differentiation media to produce human RPE cells. |
| FILED | Thursday, July 16, 2020 |
| APPL NO | 16/931003 |
| ART UNIT | 1631 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 5/0621 (20130101) Original (OR) Class C12N 2500/30 (20130101) C12N 2501/15 (20130101) C12N 2501/16 (20130101) C12N 2501/105 (20130101) C12N 2501/155 (20130101) C12N 2501/415 (20130101) C12N 2506/45 (20130101) C12N 2533/50 (20130101) C12N 2533/52 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065691 | Troll et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Dovetail Genomics, LLC (Scotts Valley, California) |
| ASSIGNEE(S) | DOVETAIL GENOMICS, LLC (Scotts Valley, California) |
| INVENTOR(S) | Christopher John Troll (Santa Cruz, California); Martin P. Powers (San Francisco, California); Nicholas H. Putnam (Waltham, Massachusetts); Marco Blanchette (Santa Cruz, California); Paul Hartley (San Jose, California) |
| ABSTRACT | The disclosure provides methods to isolate genome or chromosome level structural information from preserved samples. In some cases, samples preserved under conditions where long-range nucleic acid information is believed to be irreparably lost, such as FFPE samples, are treated to recover nucleic acid-protein complexes stabilized as part of the sample preservation process. The complexes are processed so as to recover information regarding which nucleic acids are bound to a common complex, and the information is used to recover genomic structural information. |
| FILED | Wednesday, February 03, 2021 |
| APPL NO | 17/166394 |
| ART UNIT | 1634 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6806 (20130101) Original (OR) Class C12Q 1/6806 (20130101) C12Q 1/6816 (20130101) C12Q 2521/501 (20130101) C12Q 2523/101 (20130101) C12Q 2525/161 (20130101) C12Q 2563/179 (20130101) C12Q 2565/514 (20130101) Combinatorial Chemistry; Libraries, e.g Chemical Libraries C40B 40/06 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065692 | Min et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Trustees of Columbia University in the City of New York (New York, New York) |
| ASSIGNEE(S) | The Trustees of Columbia University in the City of New York (New York, New York) |
| INVENTOR(S) | Wei Min (Fort Lee, New Jersey); Fanghao Hu (New York, New York) |
| ABSTRACT | A method for optical super-multiplexing using polyynes to provide enhanced images from stimulated Raman microscopy is disclosed. In some exemplary embodiments, the polyynes are organelle-targeted or spectral barcoded. Imaging can be enhanced by using the polyynes to image whole live cells or specific organelles within live cells. The polyynes can also be used in optical data storage (i.e., encoding) and identification (i.e., decoding) applications. |
| FILED | Friday, August 03, 2018 |
| APPL NO | 16/624682 |
| ART UNIT | 1675 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 15/00 (20130101) B82Y 30/00 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/686 (20130101) C12Q 1/6816 (20130101) Original (OR) Class C12Q 1/6827 (20130101) C12Q 1/6834 (20130101) C12Q 2565/632 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 21/65 (20130101) Selecting H04Q 11/0005 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065703 | Rabinowitz et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Natera, Inc. (San Carlos, California) |
| ASSIGNEE(S) | Natera, Inc. (San Carlos, California) |
| INVENTOR(S) | Matthew Rabinowitz (San Francisco, California); Milena Banjevic (Los Altos Hills, California); Zachary Demko (San Francisco, California); David Johnson (San Francisco, California); Dusan Kijacic (Los Altos Hills, California); Dimitri Petrov (Stanford, California); Joshua Sweetkind-Singer (San Jose, California); Jing Xu (Jersey City, New Jersey) |
| ABSTRACT | Disclosed herein is a system and method for increasing the fidelity of measured genetic data, for making allele calls, and for determining the state of aneuploidy, in one or a small set of cells, or from fragmentary DNA, where a limited quantity of genetic data is available. Poorly or incorrectly measured base pairs, missing alleles and missing regions are reconstructed using expected similarities between the target genome and the genome of genetically related individuals. In accordance with one embodiment, incomplete genetic data from an embryonic cell are reconstructed at a plurality of loci using the more complete genetic data from a larger sample of diploid cells from one or both parents, with or without haploid genetic data from one or both parents. In another embodiment, the chromosome copy number can be determined from the measured genetic data, with or without genetic information from one or both parents. |
| FILED | Monday, March 13, 2023 |
| APPL NO | 18/120873 |
| ART UNIT | 1637 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6806 (20130101) C12Q 1/6827 (20130101) C12Q 1/6855 (20130101) C12Q 1/6869 (20130101) C12Q 1/6876 (20130101) C12Q 1/6883 (20130101) Original (OR) Class C12Q 1/6886 (20130101) C12Q 2537/149 (20130101) C12Q 2545/114 (20130101) C12Q 2600/118 (20130101) C12Q 2600/156 (20130101) C12Q 2600/158 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 20/00 (20190201) G16B 25/00 (20190201) G16B 30/00 (20190201) G16B 40/00 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066362 | Matula et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Washington (Seattle, Washington) |
| ASSIGNEE(S) | University of Washington (Seattle, Washington) |
| INVENTOR(S) | Thomas J. Matula (Kirkland, Washington); Karol Bomsztyk (Mercer Island, Washington); Brian MacConaghy (Kent, Washington); Justin Reed (Seattle, Washington); Adam D. Maxwell (Woodinville, Washington) |
| ABSTRACT | A system for processing biological or other samples includes an array of transducer elements that are positioned to align with sample wells in a microplate. Each transducer element produces ultrasound energy that is focused towards a well of the microplate with sufficient acoustic pressure to cause inertial cavitation. In one embodiment, the transducers are configured to direct ultrasound energy into cylindrical wells. In other embodiments, the transducer elements are configured to direct ultrasound energy into non-cylindrical wells of a microplate. |
| FILED | Friday, April 23, 2021 |
| APPL NO | 17/239387 |
| ART UNIT | 1798 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5085 (20130101) Methods or Apparatus for Generating or Transmitting Mechanical Vibrations of Infrasonic, Sonic, or Ultrasonic Frequency, for Performing Mechanical Work in General B06B 1/0215 (20130101) B06B 1/0629 (20130101) B06B 2201/55 (20130101) B06B 2201/70 (20130101) Apparatus for Enzymology or Microbiology; C12M 47/06 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/286 (20130101) Original (OR) Class Sound-producing Devices; Methods or Devices for Protecting Against, or for Damping, Noise or Other Acoustic Waves in General; Acoustics Not Otherwise Provided for G10K 11/30 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066364 | Rozhok et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NanoCytomics, LLC (Evanston, Illinois); Northwestern University (Evanston, Illinois) |
| ASSIGNEE(S) | NanoCytomics, LLC (Evanston, Illinois); Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Sergey Rozhok (Evanston, Illinois); Justin R. Derbas (Evanston, Illinois); Jarema Czarnecki (Evanston, Illinois); Hariharan Subramanian (Evanston, Illinois) |
| ABSTRACT | Automated cell staining systems and methods are disclosed herein. In particular, the staining systems disclosed herein provide low-volume, automated bench top staining systems for staining biological samples contained on a cytological slide. |
| FILED | Monday, October 03, 2022 |
| APPL NO | 17/958718 |
| ART UNIT | 1796 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Apparatus for Applying Fluent Materials to Surfaces, in General B05C 3/02 (20130101) B05C 3/08 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 1/28 (20130101) G01N 1/30 (20130101) G01N 1/312 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066430 | Bethune et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | California Institute of Technology (Pasadena, California) |
| ASSIGNEE(S) | California Institute of Technology (Pasadena, California) |
| INVENTOR(S) | Michael T. Bethune (South San Francisco, California); Jocelyn T. Kim (Pasadena, California); David Baltimore (Pasadena, California); Guideng Li (Pasadena, California); Stephanie Wong (Pasadena, California) |
| ABSTRACT | Disclosed herein are trogocytosis based TCR ligand discovery platforms and methods of using the same, trogocytosis based TCR discovery platforms and methods of using the same, and trogocytosis based ligand discovery platforms and methods of using the same. Also disclosed herein are isolated cells, nucleotides, sequences, and sequence databases produced using trogocytosis based discovery platforms. |
| FILED | Tuesday, July 24, 2018 |
| APPL NO | 16/633451 |
| ART UNIT | 1647 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/505 (20130101) Original (OR) Class G01N 33/566 (20130101) Electric Digital Data Processing G06F 16/27 (20190101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066444 | Bateman |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Washington University (St. Louis, Missouri) |
| ASSIGNEE(S) | Washington University (St. Louis, Missouri) |
| INVENTOR(S) | Randall Bateman (St. Louis, Missouri) |
| ABSTRACT | The present disclosure provides methods for blood-based examination useful to identify subjects with Aβ amyloidosis and/or to identify subjects who should or should not undergo further testing or treatment for Aβ amyloidosis, as well as methods for treating subjects diagnosed with Aβ amyloidosis by the methods disclosed herein. |
| FILED | Tuesday, May 01, 2018 |
| APPL NO | 16/610428 |
| ART UNIT | 1649 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/6896 (20130101) Original (OR) Class G01N 2333/4709 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066445 | Demirci et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts); BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California); BETH ISRAEL DEACONESS MEDICAL CENTER (Boston, Massachusetts) |
| ASSIGNEE(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts); BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California); BETH ISRAEL DEACONESS MEDICAL CENTER (Boston, Massachusetts) |
| INVENTOR(S) | Utkan Demirci (Stanford, California); Ionita Ghiran (Boston, Massachusetts); Savas Tasoglu (Storrs, Connecticut); Ronald W. Davis (Palo Alto, California); Lars Steinmetz (Palo Alto, California); Naside Gozde Durmus (Palo Alto, California); Huseyin Cumhur Tekin (Palo Alto, California) |
| ABSTRACT | Magnetic cell levitation and cell monitoring systems and methods are disclosed. A method for separating a heterogeneous population of cells is performed by placing a microcapillary channel containing the heterogeneous population of cells in a magnetically-responsive medium in the disclosed levitation system and separating the cells by balancing magnetic and corrected gravitational forces on the individual cells. A levitation system is also disclosed, having a microscope on which the microcapillary channel is placed and a set of two magnets between which the microcapillary channel is placed. Additionally, a method for monitoring cellular processes in real-time using the levitation system is disclosed. |
| FILED | Monday, February 08, 2021 |
| APPL NO | 17/169765 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/502715 (20130101) B01L 3/502761 (20130101) B01L 2200/0647 (20130101) B01L 2300/168 (20130101) B01L 2300/0654 (20130101) B01L 2300/0838 (20130101) Magnetic or Electrostatic Separation of Solid Materials From Solid Materials or Fluids; Separation by High-voltage Electric Fields B03C 1/32 (20130101) B03C 2201/18 (20130101) B03C 2201/26 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 13/00 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/0656 (20130101) G01N 15/1031 (20130101) G01N 27/76 (20130101) G01N 33/80 (20130101) Original (OR) Class G01N 33/487 (20130101) G01N 33/491 (20130101) G01N 33/574 (20130101) G01N 2015/0053 (20130101) G01N 2015/1006 (20130101) G01N 2500/10 (20130101) G01N 2800/26 (20130101) G01N 2800/042 (20130101) G01N 2800/52 (20130101) G01N 2800/7042 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066511 | Davids et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE GENERAL HOSPITAL CORPORATION (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Mathias Davids (Manheim, Germany); Bastien Guerin (Cambridge, Massachusetts); Lawrence L. Wald (Cambridge, Massachusetts) |
| ABSTRACT | Systems and methods for designing and manufacturing electromagnetic coils for use with a magnetic resonance imaging (“MRI”) system are described. More particularly, described here are methods for designing and manufacturing gradient coils for producing magnetic field gradients with greater peripheral nerve stimulation (“PNS”) thresholds relative to conventional gradient coils. The gradient coil design is constrained using an oracle penalty that is computed to account for a PNS requirement for the coil. In other applications, the oracle penalty can be used to optimize driving patterns for an electromagnetic stimulation system, such that a target PNS requirement is achieved. |
| FILED | Thursday, March 26, 2020 |
| APPL NO | 17/442808 |
| ART UNIT | 2852 — Printing/Measuring and Testing |
| CURRENT CPC | Electrotherapy; Magnetotherapy; Radiation Therapy; Ultrasound Therapy A61N 2/02 (20130101) A61N 2/006 (20130101) Measuring Electric Variables; Measuring Magnetic Variables G01R 33/3858 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066512 | Shim et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Emory University (Atlanta, Georgia); University of Miami (Miami, Florida) |
| ASSIGNEE(S) | Emory University (Atlanta, Georgia); University of Miami (Miami, Florida) |
| INVENTOR(S) | Hyunsuk Shim (Atlanta, Georgia); Lee Cooper (Atlanta, Georgia); Saumya Gurbani (Atlanta, Georgia); Andrew Maudsley (Miami, Florida); Sulaiman Sheriff (Miami, Florida) |
| ABSTRACT | Systems and methods provide a parallelized deep learning approach to spectral fitting for magnetic resonance spectroscopy data enabling accurate and rapid spectral fitting and determination of metabolite measurements using a conventional computer. The method may include processing multi-spectra magnetic resonance (MR) spectroscopy data of a region of interest through a series of neural networks. The method may include determining baseline components of each spectrum using a first neural network of the series, generating baseline-corrected components for each spectrum using the baseline components; and determining one or more peak components of each spectrum using a second neural network of the series and the baseline-corrected components. The method may further include determining one or more metabolite measurements of the one or more metabolites in the region of interest using the one or more peak components. |
| FILED | Wednesday, November 20, 2019 |
| APPL NO | 17/295528 |
| ART UNIT | 2852 — Printing/Measuring and Testing |
| CURRENT CPC | Measuring Electric Variables; Measuring Magnetic Variables G01R 33/485 (20130101) Original (OR) Class G01R 33/4625 (20130101) Computer Systems Based on Specific Computational Models G06N 3/045 (20230101) G06N 3/084 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12067712 | Popescu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Gabriel Popescu (Champaign, Illinois); Mikhail Eugene Kandel (Champaign, Illinois); Yuchen He (Urbana, Illinois); Nahil A. Sobh (Urbana, Illinois); Matthew Benjamin Wheeler (Tolono, Illinois); Marcello Rubessa (Middleton, Wisconsin) |
| ABSTRACT | A system generates a context mask based on quantitative image data. The system obtains the quantitative image data which was captured via a quantitative imaging of a sample. The quantitative image data is compared to previous quantitative image data through application of the quantitative image data to a neural network trained using the previous quantitative image data and corresponding constructed context masks. The comparison generates the context mask for the quantitative image data. The context mask provides context for the quantitative parameter values that facilities characterization of the sample. |
| FILED | Thursday, February 18, 2021 |
| APPL NO | 17/178486 |
| ART UNIT | 2665 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 7/0012 (20130101) Original (OR) Class G06T 2207/10056 (20130101) G06T 2207/10072 (20130101) G06T 2207/20081 (20130101) G06T 2207/20084 (20130101) G06T 2207/30024 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068059 | Khurana et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Whitehead Institute for Biomedical Research (Cambridge, Massachusetts); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Whitehead Institute for Biomedical Research (Cambridge, Massachusetts); Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Vikram Khurana (Cambridge, Massachusetts); Chee Yeun Chung (Cambridge, Massachusetts); Susan Lindquist (Brookline, Massachusetts); Bonnie A. Berger (Newtonville, Massachusetts); Ernest Fraenkel (Newton, Massachusetts); Jian Peng (Champaign, Illinois) |
| ABSTRACT | Disclosed are methods, systems, cells and compositions directed to modeling a physiologic or pathologic process in an animal using a set of yeast genes analogous to a set of animal genes and augmenting the physiologic or pathologic process in the animal with predicted gene interactions based on the interactions between the set of yeast genes. Also disclosed are methods of screening for and using therapeutics for neurodegenerative proteinopathies. |
| FILED | Thursday, January 25, 2018 |
| APPL NO | 16/481061 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/025 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/5058 (20130101) G01N 2500/10 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 5/00 (20190201) Original (OR) Class G16B 25/00 (20190201) G16B 30/10 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US RE50080 | El-Khatib et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Trustees of Boston University (Boston, Massachusetts); The General Hospital Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | Trustees of Boston University (Boston, Massachusetts); The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | Firas El-Khatib (Allston, Massachusetts); Edward Damiano (Acton, Massachusetts); Steven J. Russell (Lincoln, Massachusetts) |
| ABSTRACT | Techniques are used for adaptation of drug-administration parameters that control insulin delivery in a blood glucose control system. One technique provides long-term adaptation of a nominal basal infusion rate, adapting to longer-term changes in a patient's needs due to growth, illness, hormonal fluctuations, physical activity, aging, etc. Another technique provides adaptation of priming dose size at mealtimes for overall better glycemic control and also adapting to longer-term changes in a patient's needs. Adaptation calculations use a receding-horizon window of recent values of the adapted parameter. Doses of a counter-regulatory agent (e.g., glucagon) may also be delivered in response to information about estimated accumulation of exogenously infused insulin (subcutaneously, intramuscularly, intraperitoneally, or intravenously) and/or the effect insulin might have on glucose levels (blood glucose concentration or interstitial fluid glucose concentration). |
| FILED | Thursday, January 28, 2021 |
| APPL NO | 17/160506 |
| ART UNIT | 3993 — Central Reexamination Unit (Mechanical) |
| CURRENT CPC | Devices for Introducing Media Into, or Onto, the Body; Devices for Transducing Body Media or for Taking Media From the Body; Devices for Producing or Ending Sleep or Stupor A61M 5/1723 (20130101) Original (OR) Class A61M 5/14244 (20130101) A61M 5/14248 (20130101) A61M 2005/1402 (20130101) A61M 2005/14208 (20130101) A61M 2202/07 (20130101) A61M 2205/52 (20130101) A61M 2230/201 (20130101) Healthcare Informatics, i.e Information and Communication Technology [ICT] Specially Adapted for the Handling or Processing of Medical or Healthcare Data G16H 20/13 (20180101) G16H 20/17 (20180101) G16H 40/63 (20180101) G16H 50/50 (20180101) Information and Communication Technology [ICT] Specially Adapted for Specific Application Fields, Not Otherwise Provided for G16Z 99/00 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Energy (DOE)
| US 12064725 | Jang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | UT-BATTELLE, LLC (Oak Ridge, Tennessee) |
| INVENTOR(S) | Gyoung Gug Jang (Oak Ridge, Tennessee); Radu Custelcean (Oak Ridge, Tennessee); Constantinos Tsouris (Oak Ridge, Tennessee); Abishek Kasturi (Atlanta, Georgia) |
| ABSTRACT | A high-flux direct air capture (DAC) contactor is provided. The contactor includes stainless steel mesh elements interlaced into a structured packing to increase the effective surface area for a suitable solvent. In laboratory testing, the contactor demonstrated significant potential in driving down the cost of solvent absorption-based DAC due to its high specific surface area and CO2 uptake efficiency, resistance to corrosion, optimal wettability, smaller relative size, and low manufacturing cost. As a potential breakthrough strategy, the highly efficient CO2 capture contactor can be employed to significantly reduce capital costs in a compact DAC system. |
| FILED | Monday, September 18, 2023 |
| APPL NO | 18/369290 |
| ART UNIT | 1776 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Separation B01D 53/185 (20130101) B01D 53/1475 (20130101) Original (OR) Class B01D 53/1493 (20130101) B01D 2252/20494 (20130101) B01D 2257/504 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064748 | Lee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Sumin Lee (Berkeley, California); Adam Uliana (Berkeley, California); Jeffrey R. Long (Berkeley, California); Christopher J. Chang (Berkeley, California) |
| ABSTRACT | Ether-thioether functionalized porous aromatic framework (PAF) polymers provide high selectivity for iron(II) and iron(III) adsorption in aqueous samples. |
| FILED | Friday, September 17, 2021 |
| APPL NO | 17/478874 |
| ART UNIT | 1777 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 20/265 (20130101) Original (OR) Class B01J 20/3085 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/285 (20130101) C02F 2101/203 (20130101) C02F 2103/06 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 31/22 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064801 | Ren et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northwestern University (Evanston, Illinois) |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Huaqing Ren (Santa Clara, California); Jiaxi Xie (Evanston, Illinois); Shuheng Liao (Evanston, Illinois); Dohyun Leem (Evanston, Illinois); Jian Cao (Wilmette, Illinois); Kornel F. Ehmann (Evanston, Illinois) |
| ABSTRACT | Novel systems and methods for an incremental forming process to manufacture a product are disclosed herein. The system and method generally involves continuously modifying the toolpath in real-time based upon the forming force of the forming tool compared to a predicted springback error established offline from a series of simplified simulations. The system and method disclosed herein are effective to form products with complex geometries and minimizes the costs and time requirements associated with prior art techniques. |
| FILED | Friday, February 14, 2020 |
| APPL NO | 17/430452 |
| ART UNIT | 3725 — Manufacturing Devices & Processes, Machine Tools & Hand Tools Group Art Units |
| CURRENT CPC | Working or Processing of Sheet Metal or Metal Tubes, Rods or Profiles Without Essentially Removing Material; Punching Metal B21D 31/005 (20130101) Original (OR) Class Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 19/404 (20130101) G05B 2219/45234 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064902 | Rodgers et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | GM GLOBAL TECHNOLOGY OPERATIONS LLC (Detroit, Michigan) |
| ASSIGNEE(S) | GM GLOBAL TECHNOLOGY OPERATIONS LLC (Detroit, Michigan) |
| INVENTOR(S) | William R. Rodgers (Bloomfield Township, Michigan); Terrence Wathen (Sterling Heights, Michigan); Selina Xinyue Zhao (Rochester Hills, Michigan); Venkateshwar R. Aitharaju (Troy, Michigan) |
| ABSTRACT | The present application discloses a method of making a preform for use in manufacturing a component made of a composite material. The method includes stitching fibers onto a film to form a fiber bed in a two-dimensional shape, removing the film from the fiber bed, and adjusting the fiber bed into a three-dimensional shape to form the preform. |
| FILED | Friday, November 19, 2021 |
| APPL NO | 17/531318 |
| ART UNIT | 3732 — Sheet Container Making, Package Making, Receptacles, Shoes, Apparel, and Tool Driving or Impacting |
| CURRENT CPC | Preparation or Pretreatment of the Material to be Shaped; Making Granules or Preforms; Recovery of Plastics or Other Constituents of Waste Material Containing Plastics B29B 11/16 (20130101) Original (OR) Class Shaping or Joining of Plastics; Shaping of Material in a Plastic State, Not Otherwise Provided For; After-treatment of the Shaped Products, e.g Repairing B29C 70/222 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065088 | Verma et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| INVENTOR(S) | Kiren E. Verma (Oak Ridge, Tennessee); Robert A. Bridges (Oak Ridge, Tennessee); Samuel C. Hollifield (Oak Ridge, Tennessee) |
| ABSTRACT | A system for decoding an unknown automotive controller area network (“CAN”) message definitions. CAN data vehicle signal mappings are typically held in secret and varied by automotive model and year. Without knowledge of the mappings, the wealth of real-time vehicle data hidden in the automotive CAN packets is uninterpretable—impeding research, after-market tuning, efficiency and performance monitoring, fault diagnosis, and privacy-related technologies. This system can ascertain the CAN signals' boundaries (start bit and length), endianness (byte ordering), signedness (binary-to-integer encoding) from raw CAN data. This allows conversion of CAN data to time series. Interpreting the translated CAN data's physical meaning and finding a linear mapping to standard units (e.g., knowing the signal is speed and scaling values to represent units of miles per hour) can be achieved for many signals by leveraging diagnostic standards to obtain real-time measurements of in-vehicle systems. The system can be integrated into lightweight hardware enabling an OBD-II plugin for real-time in-vehicle CAN decoding or run on standard computers. The system can output a standard DBC file with the signal definition information. |
| FILED | Tuesday, September 26, 2023 |
| APPL NO | 18/372966 |
| ART UNIT | 3667 — Computerized Vehicle Controls and Navigation, Radio Wave, Optical and Acoustic Wave Communication, Robotics, and Nuclear Systems |
| CURRENT CPC | Vehicles, Vehicle Fittings, or Vehicle Parts, Not Otherwise Provided for B60R 16/0232 (20130101) Original (OR) Class Computer Systems Based on Specific Computational Models G06N 20/00 (20190101) Time or Attendance Registers; Registering or Indicating the Working of Machines; Generating Random Numbers; Voting or Lottery Apparatus; Arrangements, Systems or Apparatus for Checking Not Provided for Elsewhere G07C 5/008 (20130101) G07C 5/10 (20130101) G07C 5/0808 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065126 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Cummins Inc. (Columbus, Indiana) |
| ASSIGNEE(S) | UNITED STATES DEPARTMENT OF ENERGY (Washington, District of Columbia) |
| INVENTOR(S) | Ke Li (Columbus, Indiana); Kenneth M. Follen (Greenwood, Indiana); John P. Kresse, III (Martinsville, Indiana) |
| ABSTRACT | A controls system for a range-extended electric vehicle comprising an overall system control unit, an engine control module configured to control a range extender of the range-extended electric vehicle, power electronics configured to control a generator of the range-extended electric vehicle, and a supervisory control module coupled between the overall system control unit and the engine control module and the power electronics, the supervisory control module configured to receive information from the overall system control unit and provide commands to the engine control module and the power electronics. |
| FILED | Friday, December 18, 2020 |
| APPL NO | 17/127057 |
| ART UNIT | 3664 — Computerized Vehicle Controls and Navigation, Radio Wave, Optical and Acoustic Wave Communication, Robotics, and Nuclear Systems |
| CURRENT CPC | Conjoint Control of Vehicle Sub-units of Different Type or Different Function; Control Systems Specially Adapted for Hybrid Vehicles; Road Vehicle Drive Control Systems for Purposes Not Related to the Control of a Particular Sub-unit B60W 10/06 (20130101) B60W 10/08 (20130101) B60W 20/15 (20160101) Original (OR) Class B60W 40/08 (20130101) B60W 50/0205 (20130101) B60W 2050/0008 (20130101) B60W 2050/0012 (20130101) B60W 2050/0026 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065379 | Benck et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sublime Systems, Inc. (Somerville, Massachusetts) |
| ASSIGNEE(S) | Sublime Systems, Inc. (Somerville, Massachusetts) |
| INVENTOR(S) | Jesse D. Benck (Wakefield, Massachusetts); Yet-Ming Chiang (Weston, Massachusetts); Kyle Dominguez (Boston, Massachusetts); Leah D. Ellis (Somerville, Massachusetts); Khashayar Jafari (Melrose, Massachusetts); Mariya Layurova (Cambridge, Massachusetts); Ada MacLeod (Sherborn, Massachusetts) |
| ABSTRACT | Various embodiments include cementitious compositions with low levels of embodied greenhouse gas emissions, in particular carbon dioxide, as a result of its production and/or use compared to conventional cementitious materials, such as portland cement. Various embodiments include any cementitious material or materials with low embodied carbon, as well as any material produced using this cement. |
| FILED | Tuesday, November 21, 2023 |
| APPL NO | 18/516399 |
| ART UNIT | 1734 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 7/12 (20130101) C04B 28/188 (20130101) Original (OR) Class C04B 2111/00637 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065562 | Jones et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| ASSIGNEE(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico) |
| INVENTOR(S) | Brad Howard Jones (Albuquerque, New Mexico); Samuel Leguizamon (Albuquerque, New Mexico) |
| ABSTRACT | Polymerization-induced phase separation enables fine control over thermoset network morphologies, yielding heterogeneous structures with domain sizes tunable over 1-100 nm. However, the controlled chain-growth polymerization techniques exclusively employed to regulate morphology at these length scales are unsuitable for most thermoset materials typically formed through step-growth mechanisms. By employing binary mixtures in place of the classic constituents of phase-separating thermosets—resin, curing agent, and secondary polymer—facile tunability over morphology can be achieved through a single compositional parameter. Indeed, this method yields morphologies spanning nano-scale to macro-scale, controlled by the relative reactivities and thermodynamic compatibility of the network components. Due to the connection between chain dynamics and microstructure in these materials, the tunable morphology enables exquisite control over glass transition and other physical and mechanical properties. |
| FILED | Monday, January 17, 2022 |
| APPL NO | 17/577111 |
| ART UNIT | 1767 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Compositions of Macromolecular Compounds C08L 63/00 (20130101) Original (OR) Class C08L 2205/035 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065639 | Vermaas et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Willem Vermaas (Tempe, Arizona); Tyson Burch (Superior, Colorado) |
| ABSTRACT | Provided herein are compositions and methods for expression of functional bacterial type I fatty acid synthase in photosynthetic hosts for production of activated acyl-CoAs and for use in biofuel production. |
| FILED | Monday, December 16, 2019 |
| APPL NO | 16/716306 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/20 (20130101) Original (OR) Class C12N 1/205 (20210501) Indexing Scheme Associated With Subclasses C12C - C12Q, Relating to Microorganisms C12R 2001/01 (20210501) Enzymes C12Y 203/01085 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065738 | Mane et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois); BOISE STATE UNIVERSITY (Boise, Idaho) |
| ASSIGNEE(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois); BOISE STATE UNIVERSITY (Boise, Idaho) |
| INVENTOR(S) | Anil U. Mane (Naperville, Illinois); Jeffrey W. Elam (Elmhurst, Illinois); Donghyeon Kang (Chicago, Illinois); Sara Kuraitis (Boise, Idaho); Elton Graugnard (Boise, Idaho) |
| ABSTRACT | A method of making thin films of sodium fluorides and their derivatives by atomic layer deposition (“ALD”). A sodium precursor is exposed to a substrate in an ALD reactor. The sodium precursor is purged, leaving the substrate with a sodium intermediate bound thereon. A fluorine precursor is exposed to the bound sodium intermediate in the ALD reactor. The fluorine precursor is purged and a sodium fluoride film is formed on the substrate. |
| FILED | Friday, October 22, 2021 |
| APPL NO | 17/508802 |
| ART UNIT | 1712 — Coating, Etching, Cleaning, Single Crystal Growth |
| CURRENT CPC | Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 16/52 (20130101) C23C 16/4408 (20130101) C23C 16/45527 (20130101) C23C 16/45553 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065964 | Terwilliger |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Technologies Corporation (Farmington, Connecticut) |
| ASSIGNEE(S) | RTX CORPORATION (Farmington, Connecticut) |
| INVENTOR(S) | Neil J. Terwilliger (Cheshire, Connecticut) |
| ABSTRACT | A turbine engine assembly includes a heat exchanger that is in thermal communication with an exhaust gas flow. A bypass passage is provided that is configured to selectively route at least a portion of the exhaust gas flow around the heat exchanger in response to a predefined engine operating condition. |
| FILED | Tuesday, April 18, 2023 |
| APPL NO | 18/302081 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 3/30 (20130101) F02C 3/34 (20130101) Original (OR) Class F02C 6/20 (20130101) F02C 7/141 (20130101) F02C 7/1435 (20130101) F02C 9/18 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2260/212 (20130101) F05D 2260/213 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065992 | Singh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Caterpillar Inc. (Peoria, Illinois) |
| ASSIGNEE(S) | Caterpillar Inc. (Peoria, Illinois) |
| INVENTOR(S) | Jaswinder Singh (Dunlap, Illinois); Michael Bardell (Vail, Arizona); Yongxian Gu (West Lafayette, Indiana); Eric L. Schroeder (Germantown Hills, Illinois); Patrick J. Seiler (Peoria, Illinois) |
| ABSTRACT | A gaseous fuel engine system includes a hydrogen fuel supply, an engine housing having an intake port extending to a cylinder, and an intake runner. The intake runner includes a valve mount attached to a conduit and having a valve mounting face, and a gaseous fuel admission valve is mounted upon the valve mounting face. A hydrogen fuel passage extends from the valve mount through the conduit and is oriented angularly to at least one of a clamping face of the intake runner or the valve mounting face. Related apparatus and methodology is also disclosed. |
| FILED | Monday, January 23, 2023 |
| APPL NO | 18/100009 |
| ART UNIT | 3799 — Medical Instruments, Diagnostic Equipment, and Treatment Devices |
| CURRENT CPC | Supplying Combustion Engines in General With Combustible Mixtures or Constituents Thereof F02M 21/023 (20130101) F02M 21/0206 (20130101) F02M 21/0278 (20130101) F02M 21/0281 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066002 | Martinez Tossas |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado) |
| ASSIGNEE(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado) |
| INVENTOR(S) | Luis Antonio Martinez Tossas (Boulder, Colorado) |
| ABSTRACT | A design for wind turbine rotor blades, aircraft wings, and/or other aerodynamic applications which may reduce the vorticity downstream and thus improve lift is described. The blade designs may include an increase in the blade chord towards the tip of the blade, a change in the twist angle at least once along the length of the blade, and/or a change in the thickness of the blade at least once along the length of the blade. These changes individually or in combination may allow for the creation of a counter-rotating vortex behind the blade, increasing power generation and/or lift. |
| FILED | Friday, December 08, 2023 |
| APPL NO | 18/533401 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Wind Motors F03D 1/0633 (20130101) Original (OR) Class Indexing Scheme Relating to Wind, Spring, Weight, Inertia or Like Motors, to Machines or Engines for Liquids Covered by Subclasses F03B, F03D and F03G F05B 2240/307 (20200801) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066192 | Moore et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Broan-NuTone LLC (Hartford, Wisconsin) |
| ASSIGNEE(S) | Broan-NuTone LLC (Hartford, Wisconsin) |
| INVENTOR(S) | Mike Moore (Hartford, Wisconsin); Richard R. Sinur (Hartford, Wisconsin); Jason Asmus (Hartford, Wisconsin); Seddik Rougab (Hartford, Wisconsin); Taylor Schroeder (Hartford, Wisconsin); Eric Theriault (Hartford, Wisconsin) |
| ABSTRACT | A venting system in accordance with the present disclosure includes a ventilation fan and one or more sensors coupled to the ventilation fan. The ventilation fan is positioned to vent air from an indoor environment. The sensors are positioned to monitor conditions in the indoor environment and selectively operate the ventilation fan to condition air in the indoor environment. |
| FILED | Wednesday, November 27, 2019 |
| APPL NO | 17/298362 |
| ART UNIT | 3762 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Domestic Stoves or Ranges; Details of Domestic Stoves or Ranges, of General Application F24C 15/20 (20130101) F24C 15/2021 (20130101) Original (OR) Class Air-conditioning; Air-humidification; Ventilation; Use of Air Currents for Screening F24F 7/007 (20130101) F24F 11/0001 (20130101) F24F 2110/10 (20180101) F24F 2110/20 (20180101) F24F 2110/50 (20180101) F24F 2130/00 (20180101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066353 | Thorpe et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Bridger Photonics, Inc. (Bozeman, Montana) |
| ASSIGNEE(S) | Bridger Photonics, Inc. (Bozeman, Montana) |
| INVENTOR(S) | Michael James Thorpe (Bozeman, Montana); Aaron Thomas Kreitinger (Bozeman, Montana) |
| ABSTRACT | Embodiments of the disclosure are drawn to apparatus and methods for determining gas flux measurements. A gas plume may be emitted from a source and may be blown by wind in an environment. A measurement system, such as a light detection and ranging (lidar) system may collect a plurality of gas concentration measurements associated with the gas plume at a plurality of locations in the environment. A gas flux may be determined based on one or more of the gas concentration measurements along with a wind speed at a location associated with the gas plume. In some embodiments, a height of the gas plume may be determined, and the wind speed at the height of the gas plume may be determined and used to determine the gas flux. |
| FILED | Friday, February 01, 2019 |
| APPL NO | 16/966451 |
| ART UNIT | 2863 — Printing/Measuring and Testing |
| CURRENT CPC | Testing Static or Dynamic Balance of Machines or Structures; Testing of Structures or Apparatus, Not Otherwise Provided for G01M 3/16 (20130101) Original (OR) Class Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/0004 (20130101) Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags G01V 9/007 (20130101) Electric Digital Data Processing G06F 17/18 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066425 | Qian et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| ASSIGNEE(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| INVENTOR(S) | Fang Qian (Santa Cruz, California); Chao Huang (San Jose, California); Anna Nikolaevna Ivanovskaya (Mountain View, California); Kris Kulp (Livermore, California); Elizabeth K. Wheeler (Livermore, California) |
| ABSTRACT | A method includes simultaneously measuring electrophysiological responses and contractility responses of a plurality of cells forming a tissue culture using a system comprising a sensor array configured to simultaneously measure the electrophysiological responses and the contractility responses of the plurality of cells forming the tissue culture. Fabrication techniques for making such systems include: forming a sensor array comprising an interpenetrating arrangement of IDEs and electrodes of a MEA in or on a substrate surface; forming a plurality of contacts for interfacing the system with one or more external devices in or on the substrate surface; and forming leads between the plurality of contacts and the sensor array. |
| FILED | Thursday, January 07, 2021 |
| APPL NO | 17/144008 |
| ART UNIT | 1799 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Apparatus for Enzymology or Microbiology; C12M 21/08 (20130101) C12M 35/02 (20130101) C12M 41/46 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/4836 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066515 | Panas |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| ASSIGNEE(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| INVENTOR(S) | Robert M. Panas (Livermore, California) |
| ABSTRACT | An antenna is provided with sub-apertures whose relative locations change and that are not connected via a mechanical link. a Multi-Body Coherent Aperture Synthesis system supports an antenna with sub-aperture devices that collect views, collect (using an optical link) ranging information (that includes timing information) relating to distance between sub-aperture devices, and transmit the collected views and ranging information to a master device. The master device synthesizes the collected views into a synthesized image based on the ranging information. |
| FILED | Monday, August 16, 2021 |
| APPL NO | 17/403130 |
| ART UNIT | 3648 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Radio Direction-finding; Radio Navigation; Determining Distance or Velocity by Use of Radio Waves; Locating or Presence-detecting by Use of the Reflection or Reradiation of Radio Waves; Analogous Arrangements Using Other Waves G01S 13/08 (20130101) Original (OR) Class G01S 17/08 (20130101) Antennas, i.e Radio Aerials H01Q 1/225 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066588 | Walsh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vista Clara Inc. (Mukilteo, Washington) |
| ASSIGNEE(S) | Vista Clara Inc. (Mukilteo, Washington) |
| INVENTOR(S) | David Walsh (Shoreline, Washington); Elliot Grunewald (Seattle, Washington) |
| ABSTRACT | Nuclear Magnetic Resonance (NMR) electronics that employ selective solid-state isolation of circuit elements can include solid-state switches, such as back-to-back Field Effect Transistor (FET) pairs, and isolated gate drive electronics adapted to operate the solid-state switches in order to selectively decouple induction coils from receive electronics. The solid-state switches can be placed in series to achieve higher standoff voltages, and can be configured for low on resistance and short switching times. The gate drive electronics can include electrical isolation components adapted to enhance standoff voltages and reduce electrical noise at the selectively isolated receive electronics. |
| FILED | Thursday, January 13, 2022 |
| APPL NO | 17/647876 |
| ART UNIT | 2858 — Printing/Measuring and Testing |
| CURRENT CPC | Geophysics; Gravitational Measurements; Detecting Masses or Objects; Tags G01V 3/14 (20130101) Original (OR) Class G01V 3/38 (20130101) Pulse Technique H03K 17/6874 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066617 | Wiederrecht et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| ASSIGNEE(S) | UCHICAGO ARGONNE, LLC (Chicago, Illinois) |
| INVENTOR(S) | Gary P. Wiederrecht (Elmhurst, Illinois); Stephen K. Gray (Wheaton, Illinois); Xiewen Wen (Willowbrook, Illinois); Sushovit Adhikari (Westmont, Illinois); Cristian Leonardo Cortes (Chicago, Illinois); David J. Gosztola (Naperville, Illinois) |
| ABSTRACT | A system and methods for ghost imaging second harmonic generation microscopy. Imaging data is collected in parallel, providing faster imagine reconstruction and enabling reconstruction in scattering environments. Ghost imaging, split light beam interacting with a target and a second light beam unimpeded and not required to pass through the same background. A second harmonic generation image is reconstructed from the detected photons. |
| FILED | Friday, April 09, 2021 |
| APPL NO | 17/226734 |
| ART UNIT | 2425 — Cable and Television |
| CURRENT CPC | Measurement of Intensity, Velocity, Spectral Content, Polarisation, Phase or Pulse Characteristics of Infra-Red, Visible or Ultra-violet Light; Colorimetry; Radiation Pyrometry G01J 3/2823 (20130101) Optical Elements, Systems, or Apparatus G02B 21/18 (20130101) Original (OR) Class Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 1/37 (20130101) Image Data Processing or Generation, in General G06T 5/50 (20130101) G06T 2207/10056 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066965 | Seyedzadehdelcheh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ADVANCED MICRO DEVICES, INC. (Santa Clara, California) |
| ASSIGNEE(S) | Advanced Micro Devices, Inc. (Santa Clara, California) |
| INVENTOR(S) | SeyedMohammad Seyedzadehdelcheh (Bellevue, Washington); Steven Raasch (Austin, Texas); Sergey Blagodurov (Bellevue, Washington) |
| ABSTRACT | Data are serially communicated over an interconnect between an encoder and a decoder. The encoder includes a first training unit to count a frequency of symbol values in symbol blocks of a set of N number of symbol blocks in an epoch. A circular shift unit of the encoder stores a set of most-recently-used (MRU) amplitude values. An XOR unit is coupled to the first training unit and the first circular shift unit as inputs and to the interconnect as output. A transmitter is coupled to the encoder XOR unit and the interconnect and thereby contemporaneously sends symbols and trains on the symbols. In a system, a device includes a receiver and decoder that receive, from the encoder, symbols over the interconnect. The decoder includes its own training unit for decoding the transmitted symbols. |
| FILED | Thursday, April 30, 2020 |
| APPL NO | 16/863149 |
| ART UNIT | 2184 — Computer Architecture and I/O |
| CURRENT CPC | Electric Digital Data Processing G06F 13/4027 (20130101) Original (OR) Class G06F 13/4282 (20130101) Coding; Decoding; Code Conversion in General H03M 7/30 (20130101) H03M 9/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068085 | Yurke |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Boise State University (Boise, Idaho) |
| ASSIGNEE(S) | Boise State University (Boise, Idaho) |
| INVENTOR(S) | Bernard Yurke (Boise, Idaho) |
| ABSTRACT | A system is described that exhibits the functionality of a beam-splitter, typically an optical device that splits a beam of light in two. In this case, the beams are acoustic pulses and can lead to the creation of a Wannier-Mott exciton: a bound state of an electron and an electron hole whose attraction to each other is maintained by the electrostatic Coulomb force. This exciton beam-splitter is lossy (i.e., involves the dissipation of electrical or electromagnetic energy). Half of the time the exciton is radiated away. Nevertheless, if the exciton is not lost, the exciton is now in a superposition of two states that can be well separated in position. Four such beam-splitters can be used to make an exciton interferometer that uses the interference patterns from the interacting acoustic pulses to extract information. |
| FILED | Thursday, September 16, 2021 |
| APPL NO | 17/447839 |
| ART UNIT | 2881 — Optics |
| CURRENT CPC | Techniques for Handling Particles or Ionising Radiation Not Otherwise Provided For; Irradiation Devices; Gamma Ray or X-ray Microscopes G21K 1/00 (20130101) Original (OR) Class Transmission H04B 10/70 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068104 | Hatch et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri) |
| ASSIGNEE(S) | Honeywell Federal Manufacturing and Technologies, LLC (Kansas City, Missouri) |
| INVENTOR(S) | Jonathan Douglas Hatch (Cleveland, Missouri); Bob Dearth (Kansas City, Missouri); Ida Sanchez (Leawood, Kansas); Francisco Garcia-Moreno (Spring, Texas) |
| ABSTRACT | Systems and methods for forming a magnetically-enabled part via additive manufacturing. The method includes depositing a layer of additive manufacturing material on a build plate, melting or sintering the layer of additive manufacturing material, depositing additional layers of additive manufacturing material on previous layers of additive manufacturing material, the additive manufacturing material of at least some of the additional layers being magnetically permeable, and melting or sintering the additional layers of additive manufacturing material such that the magnetically-enabled part has a transition region including at least some of the magnetically permeable additive manufacturing material. |
| FILED | Thursday, May 11, 2023 |
| APPL NO | 18/196020 |
| ART UNIT | 1734 — Metallurgy, Metal Working, Inorganic Chemistry, Catalyst, Electrophotography, Photolithography |
| CURRENT CPC | Working Metallic Powder; Manufacture of Articles From Metallic Powder; Making Metallic Powder B22F 10/00 (20210101) B22F 10/10 (20210101) B22F 10/25 (20210101) B22F 10/64 (20210101) B22F 10/80 (20210101) B22F 12/10 (20210101) B22F 12/22 (20210101) B22F 12/58 (20210101) B22F 12/58 (20210101) B22F 2999/00 (20130101) Soldering or Unsoldering; Welding; Cladding or Plating by Soldering or Welding; Cutting by Applying Heat Locally, e.g Flame Cutting; Working by Laser Beam B23K 26/342 (20151001) B23K 2101/36 (20180801) B23K 2103/04 (20180801) Additive Manufacturing, i.e Manufacturing of Three-dimensional [3-D] Objects by Additive Deposition, Additive Agglomeration or Additive Layering, e.g by 3-d Printing, Stereolithography or Selective Laser Sintering B33Y 10/00 (20141201) B33Y 30/00 (20141201) B33Y 40/20 (20200101) Alloys C22C 33/02 (20130101) C22C 2202/02 (20130101) Magnets; Inductances; Transformers; Selection of Materials for Their Magnetic Properties H01F 41/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068161 | Shealy et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | POWER INTEGRATIONS, INC. (San Jose, California) |
| ASSIGNEE(S) | POWER INTEGRATIONS, INC. (San Jose, California) |
| INVENTOR(S) | James R. Shealy (Ithaca, New York); Richard J. Brown (Ithaca, New York) |
| ABSTRACT | In an example, the present invention provides a method of forming a semiconductor device on a gallium and nitrogen containing material. The method includes providing a substrate member comprising a surface region, the substrate member comprising a gallium and nitrogen bearing material. The method includes causing an implanted species to electrically activate the implant profile while removing one or more crystalline damage from the epitaxial material to change the amorphous state to a single crystalline state, and thereby creating a substantially electrically activated crystalline material. |
| FILED | Friday, October 07, 2022 |
| APPL NO | 18/045071 |
| ART UNIT | 2812 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 21/26553 (20130101) Original (OR) Class H01L 29/04 (20130101) H01L 29/66204 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068215 | Roberts et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ADVANCED MICRO DEVICES, INC. (Santa Clara, California) |
| ASSIGNEE(S) | ADVANCED MICRO DEVICES, INC. (Santa Clara, California) |
| INVENTOR(S) | David A. Roberts (Boxborough, Massachusetts); Greg Sadowski (Boxborough, Massachusetts); Steven Raasch (Boxborough, Massachusetts) |
| ABSTRACT | Exemplary embodiments provide thermal wear spreading among a plurality of thermal die regions in an integrated circuit or among dies by using die region wear-out data that represents a cumulative amount of time each of a number of thermal die regions in one or more dies has spent at a particular temperature level. In one example, die region wear-out data is stored in persistent memory and is accrued over a life of each respective thermal region so that a long term monitoring of temperature levels in the various die regions is used to spread thermal wear among the thermal die regions. In one example, spreading thermal wear is done by controlling task execution such as thread execution among one or more processing cores, dies and/or data access operations for a memory. |
| FILED | Monday, January 09, 2023 |
| APPL NO | 18/152022 |
| ART UNIT | 2191 — Interprocess Communication and Software Development |
| CURRENT CPC | Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 15/02 (20130101) Electric Digital Data Processing G06F 1/20 (20130101) Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/34 (20130101) Original (OR) Class H01L 25/0657 (20130101) H01L 2225/06589 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068216 | Reza |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico); Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | National Technology and Engineering Solutions of Sandia, LLC (Albuquerque, New Mexico); Raytheon Company (Waltham, Massachusetts) |
| INVENTOR(S) | Shahed Reza (Albuquerque, New Mexico) |
| ABSTRACT | A multichannel transistor is provided. In the transistor, a plurality of gate fingers overlie a substrate and extend laterally across the substrate from a gate manifold. The gate manifold has a curved edge, and each of the gate fingers projects radially from the curved manifold edge. |
| FILED | Thursday, March 10, 2022 |
| APPL NO | 17/691970 |
| ART UNIT | 2818 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/367 (20130101) Original (OR) Class H01L 29/2003 (20130101) H01L 29/7786 (20130101) H01L 29/42316 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068379 | Häberlen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Infineon Technologies Austria AG (Villach, Austria) |
| ASSIGNEE(S) | Infineon Technologies Austria AG (Villach, Austria) |
| INVENTOR(S) | Oliver Häberlen (Villach, Austria); Eric G. Persson (Minnetonka, Minnesota); Reenu Garg (Redondo Beach, California) |
| ABSTRACT | In an embodiment, a semiconductor device is provided that includes a lateral transistor device having a source, a drain and a gate, and a monolithically integrated capacitor coupled between the gate and the drain. |
| FILED | Wednesday, May 31, 2023 |
| APPL NO | 18/326416 |
| ART UNIT | 2812 — Semiconductors/Memory |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 23/642 (20130101) H01L 29/41758 (20130101) Original (OR) Class H01L 29/42316 (20130101) H01L 29/66446 (20130101) Pulse Technique H03K 17/6871 (20130101) H03K 2217/0081 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068425 | Steiner et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado); Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Alliance for Sustainable Energy, LLC (Golden, Colorado); Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | Myles Aaron Steiner (Denver, Colorado); Daniel Joseph Friedman (Lakewood, Colorado); Ryan Matthew France (Golden, Colorado); Asegun Henry (Boston, Massachusetts) |
| ABSTRACT | The present disclosure relates to a photovoltaic (PV) device that includes a first junction constructed with a first alloy and having a bandgap between about 1.0 eV and about 1.5 eV, and a second junction constructed with a second alloy and having a bandgap between about 0.9 eV and about 1.3 eV, where the first alloy includes III-V elements, the second alloy includes III-V elements, and the PV device is configured to operate in a thermophotovoltaic system having an operating temperature between about 1500° C. and about 3000° C. |
| FILED | Wednesday, August 23, 2023 |
| APPL NO | 18/454171 |
| ART UNIT | 1721 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Semiconductor Devices; Electric Solid State Devices Not Otherwise Provided for H01L 31/0725 (20130101) H01L 31/0735 (20130101) Original (OR) Class H01L 31/1892 (20130101) Generation of Electric Power by Conversion of Infra-red Radiation, Visible Light or Ultraviolet Light, e.g Using Photovoltaic [PV] Modules H02S 10/30 (20141201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068445 | Bazzarella et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | 24M Technologies, Inc. (Cambridge, Massachusetts) |
| ASSIGNEE(S) | 24M Technologies, Inc. (Cambridge, Massachusetts) |
| INVENTOR(S) | Ricardo Bazzarella (Woburn, Massachusetts); Alexander H. Slocum (Bow, New Hampshire); Tristan Doherty (Somerville, Massachusetts); James C. Cross, III (Carlisle, Massachusetts) |
| ABSTRACT | Electrochemical cells and methods of making electrochemical cells are described herein. In some embodiments, an apparatus includes a multi-layer sheet for encasing an electrode material for an electrochemical cell. The multi-layer sheet including an outer layer, an intermediate layer that includes a conductive substrate, and an inner layer disposed on a portion of the conductive substrate. The intermediate layer is disposed between the outer layer and the inner layer. The inner layer defines an opening through which a conductive region of the intermediate layer is exposed such that the electrode material can be electrically connected to the conductive region. Thus, the intermediate layer can serve as a current collector for the electrochemical cell. |
| FILED | Tuesday, March 28, 2023 |
| APPL NO | 18/127439 |
| ART UNIT | 1752 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/0404 (20130101) Original (OR) Class H01M 10/0413 (20130101) H01M 10/0436 (20130101) H01M 10/0525 (20130101) H01M 50/105 (20210101) H01M 50/124 (20210101) H01M 50/545 (20210101) H01M 50/553 (20210101) H01M 2220/30 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068472 | Belharouak et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | UT-BATTELLE, LLC (Oak Ridge, Tennessee) |
| INVENTOR(S) | Ilias Belharouak (Oak Ridge, Tennessee); Yaocai Bai (Oak Ridge, Tennessee); Rachid Essehli (Oak Ridge, Tennessee); Jianlin Li (Oak Ridge, Tennessee) |
| ABSTRACT | A method for the regeneration of cathode material from spent lithium-ion batteries is provided. The method includes dissolving a lithium precursor in a polyhydric alcohol to form a solution. Degraded cathode material containing lithium metal oxides are dispersed into the solution under mechanical stirring, forming a mixture. The mixture is heat treated within a reactor vessel or microwave oven. During this heat treatment, lithium is intercalated into the degraded cathode material. The relithiated electrode material is collected by filtration, washing with solvents, and drying. The relithiated electrode material is then ground with a lithium precursor and thermally treated at a relatively low temperature for a predetermined time period to obtain regenerated cathode material. |
| FILED | Wednesday, June 30, 2021 |
| APPL NO | 17/363272 |
| ART UNIT | 1725 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/049 (20130101) Original (OR) Class H01M 4/0471 (20130101) H01M 4/505 (20130101) H01M 4/525 (20130101) H01M 10/54 (20130101) H01M 10/0525 (20130101) Climate Change Mitigation Technologies Related to Wastewater Treatment or Waste Management Y02W 30/84 (20150501) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068474 | Yushin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Sila Nanotechnologies Inc. (Alameda, California) |
| ASSIGNEE(S) | SILA NANOTECHNOLOGIES, INC. (Alameda, California) |
| INVENTOR(S) | Gleb Yushin (Atlanta, Georgia); Bogdan Zdyrko (Atlanta, Georgia); Eugene Berdichevsky (Alameda, California); Alexander Jacobs (Atlanta, Georgia); Alper Nese (Alameda, California); Adam Kajdos (Stockton, California); Justin Yen (Alameda, California); Justin Doane (Alameda, California) |
| ABSTRACT | A battery electrode composition is provided that comprises composite particles. Each of the composite particles in the composition (which may represent all or a portion of a larger composition) may comprise a porous electrode particle and a filler material. The porous electrode particle may comprise active material provided to store and release ions during battery operation. The filler material may occupy at least a portion of the pores of the electrode particle. The filler material may be liquid and not substantially conductive with respect to electron transport. |
| FILED | Friday, October 15, 2021 |
| APPL NO | 17/451022 |
| ART UNIT | 1727 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/38 (20130101) H01M 4/364 (20130101) Original (OR) Class H01M 4/386 (20130101) H01M 4/387 (20130101) H01M 4/463 (20130101) H01M 4/582 (20130101) H01M 4/628 (20130101) H01M 4/5815 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068519 | Schneider et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Lawrence Livermore National Security, LLC (Livermore, California) |
| ASSIGNEE(S) | LAWRENCE LIVERMORE NATIONAL SECURITY, LLC (Livermore, California) |
| INVENTOR(S) | Joseph Devin Schneider (Danville, California); Alexander Adrian Baker (Livermore, California); Jinkyu Han (San Ramon, California); Lars F. Voss (Livermore, California) |
| ABSTRACT | Disclosed are non-linear transmission lines using ferromagnetic materials to generate ferromagnetic resonance oscillations. In one aspect, a non-linear transmission line apparatus is disclosed. The apparatus includes an outer conductor having a first side and a second internally facing side, and an inner conductor positioned internal to the non-linear transmission line apparatus. The apparatus further includes a ferromagnetic material surrounding the inner conductor, wherein the ferromagnetic material comprises nanoparticles of an ε-polymorph of iron oxide expressed as ε-Fe2O3. The apparatus also includes a first dielectric material positioned between the outer conductor and the inner conductor, the dielectric material in contact with both the ferromagnetic material and with the second internally facing side of the outer conductor, wherein the outer conductor, the inner conductor, the dielectric material and the ferromagnetic material form the nonlinear transmission line. |
| FILED | Monday, December 20, 2021 |
| APPL NO | 17/556575 |
| ART UNIT | 2843 — Electrical Circuits and Systems |
| CURRENT CPC | Waveguides; Resonators, Lines, or Other Devices of the Waveguide Type H01P 3/06 (20130101) Original (OR) Class H01P 5/085 (20130101) H01P 7/08 (20130101) H01P 11/005 (20130101) Pulse Technique H03K 3/01 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12069168 | Qi et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| ASSIGNEE(S) | UT-Battelle, LLC (Oak Ridge, Tennessee) |
| INVENTOR(S) | Bing Qi (Knoxville, Tennessee); Philip G. Evans (Knoxville, Tennessee); Warren P. Grice (Oak Ridge, Tennessee) |
| ABSTRACT | A passive continuous variable quantum key distribution scheme, where Alice splits the output of a thermal source into two beams, measures one locally and transmits the other mode to Bob after applying attenuation. A secure key can be established based on measurements of the two beams without the use of a random number generator or an optical modulator. |
| FILED | Monday, February 21, 2022 |
| APPL NO | 17/676484 |
| ART UNIT | 2434 — Cryptography and Security |
| CURRENT CPC | Transmission H04B 10/70 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 9/0852 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Defense (DOD)
| US 12064350 | Bachus et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Utah Research Foundation (Salt Lake City, Utah); Joseph A. Longo (Paradise Valley, Arizona) |
| ASSIGNEE(S) | Joseph A. Longo (Paradise Valley, Arizona); University of Utah Research Foundation (Salt Lake City, Utah) |
| INVENTOR(S) | Kent N. Bachus (Salt Lake City, Utah); Sujee Jeyapalina (Salt Lake City, Utah); James Peter Beck (Salt Lake City, Utah); Roy Bloebaum (Salt Lake City, Utah); Jayant P. Agarwal (Salt Lake City, Utah); Joseph A. Longo (Paradise Valley, Arizona); Erik Kubiak (Salt Lake City, Utah); Brian Mueller Holt (Topanga, California) |
| ABSTRACT | An implant assembly for a long bone is adapted to support an exo-prosthesis. The assembly includes a stem, a subdermal component and a percutaneous post. The stem has a proximal end that is adapted to be received in a surgically prepared medullary canal of the long bone, and a distal end having a surface that is adapted to promote bone ingrowth. The subdermal component includes a proximal portion that is adapted for attachment to the distal end of the stem, and a fixation surface that is adapted to promote soft tissue fixation. The percutaneous post has a proximal end that is adapted to be attached to the subdermal component. |
| FILED | Monday, April 11, 2022 |
| APPL NO | 17/717545 |
| ART UNIT | 3774 — Medical & Surgical Instruments, Treatment Devices, Surgery and Surgical Supplies |
| CURRENT CPC | Filters Implantable into Blood Vessels; Prostheses; Devices Providing Patency To, or Preventing Collapsing Of, Tubular Structures of the Body, e.g Stents; Orthopaedic, Nursing or Contraceptive Devices; Fomentation; Treatment or Protection of Eyes or Ears; Bandages, Dressings or Absorbent Pads; First-aid Kits A61F 2/78 (20130101) A61F 2/2814 (20130101) Original (OR) Class A61F 2002/0091 (20150401) A61F 2002/7887 (20130101) A61F 2002/30028 (20130101) A61F 2002/30299 (20130101) A61F 2002/30576 (20130101) A61F 2002/30589 (20130101) A61F 2002/30594 (20130101) A61F 2002/30604 (20130101) A61F 2002/30729 (20130101) A61F 2002/30784 (20130101) A61F 2002/30879 (20130101) A61F 2002/30932 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064514 | Schneider et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Penn State Research Foundation (University Park, Pennsylvania); THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES (Bethesda, Maryland) |
| ASSIGNEE(S) | THE PENN STATE RESEARCH FOUNDATION (University Park, Pennsylvania); THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, OFFICE OF TECHNOLOGY TRANSFER, NATIONAL INSTITUTES OF HEALTH (Bethesda, Maryland) |
| INVENTOR(S) | Joel P. Schneider (Frederick, Maryland); Scott H. Medina (State College, Pennsylvania) |
| ABSTRACT | The present invention is directed to peptisomes, including nanopeptisomes, which have a perfluorocarbon liquid core containing a perfluorocarbon liquid and a cargo, such as a therapeutically active agent, dispersed in the perfluorocarbon. liquid, and a plurality of amphiphilic peptide molecules surrounding the perfluorocarbon liquid core, wherein the amphiphilic peptide is represented by Formula (I) HB-CL-HP wherein HB is a fluorinated hydrophobic block, such as a fluorinated hydrophobic amino acid sequence, CL is a cross-linking motif, and HP is a hydrophilic amino acid sequence. The present invention is also directed to methods of use of the amphiphilic peptides and peptisomes, such as nanopeptisomes, to deliver a cargo, such as a therapeutically active agent, to a cell, Q wherein the cell may be in vitro, ex vivo, or in vivo. |
| FILED | Monday, July 30, 2018 |
| APPL NO | 16/634679 |
| ART UNIT | 1658 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0009 (20130101) A61K 9/1273 (20130101) Original (OR) Class A61K 47/65 (20170801) Specific Uses or Applications of Nanostructures; Measurement or Analysis of Nanostructures; Manufacture or Treatment of Nanostructures B82Y 5/00 (20130101) Peptides C07K 7/06 (20130101) C07K 2319/01 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064753 | Jones et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Research Foundation for The State University of New York (Binghamton, New York); LEIDOS, Inc. (Reston, Virginia) |
| ASSIGNEE(S) | The Research Foundation for The State University of New York (Binghamton, New York) |
| INVENTOR(S) | Wayne E. Jones (Vestal, New York); Jian Liu (Beijing, China PRC); William E. Bernier (Endwell, New York); Julia B. Tollin (Bellmore, New York); Danielle McCarthy (Johnson City, New York); Emilly Obuya (Troy, New York); Jared DeCoste (Bel Air, Maryland) |
| ABSTRACT | Mixed-phase TiO2 nanofibers prepared via a sol-gel technique followed by electrospinning and calcination are provided as photocatalysts. The calcination temperature is adjusted to control the rutile phase fraction in TiO2 nanofibers relative to the anatase phase. Post-calcined TiO2 nanofibers composed of 38 wt % rutile and 62 wt % anatase exhibited the highest initial rate constant of UV photocatalysis. This can be attributed to the combined influences of the fibers' specific surface areas and their phase compositions. |
| FILED | Tuesday, May 26, 2020 |
| APPL NO | 16/883425 |
| ART UNIT | 1774 — Chemical Apparatus, Separation and Purification, Liquid and Gas Contact Apparatus |
| CURRENT CPC | Chemical or Physical Processes, e.g Catalysis or Colloid Chemistry; Their Relevant Apparatus B01J 21/063 (20130101) B01J 23/06 (20130101) B01J 23/42 (20130101) B01J 31/38 (20130101) Original (OR) Class B01J 31/1691 (20130101) B01J 35/23 (20240101) B01J 35/39 (20240101) B01J 35/58 (20240101) B01J 35/613 (20240101) B01J 35/615 (20240101) B01J 37/036 (20130101) B01J 37/082 (20130101) B01J 37/086 (20130101) Treatment of Water, Waste Water, Sewage, or Sludge C02F 1/32 (20130101) C02F 1/725 (20130101) C02F 2305/08 (20130101) C02F 2305/10 (20130101) Lime, Magnesia; Slag; Cements; Compositions Thereof, e.g Mortars, Concrete or Like Building Materials; Artificial Stone; Ceramics; Refractories; Treatment of Natural Stone C04B 35/624 (20130101) C04B 35/62259 (20130101) C04B 35/62675 (20130101) C04B 35/62844 (20130101) C04B 2235/85 (20130101) C04B 2235/5264 (20130101) C04B 2235/5409 (20130101) Mechanical Methods or Apparatus in the Manufacture of Artificial Filaments, Threads, Fibres, Bristles or Ribbons D01D 5/003 (20130101) Climate Change Mitigation Technologies Related to Wastewater Treatment or Waste Management Y02W 10/37 (20150501) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064801 | Ren et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Northwestern University (Evanston, Illinois) |
| ASSIGNEE(S) | Northwestern University (Evanston, Illinois) |
| INVENTOR(S) | Huaqing Ren (Santa Clara, California); Jiaxi Xie (Evanston, Illinois); Shuheng Liao (Evanston, Illinois); Dohyun Leem (Evanston, Illinois); Jian Cao (Wilmette, Illinois); Kornel F. Ehmann (Evanston, Illinois) |
| ABSTRACT | Novel systems and methods for an incremental forming process to manufacture a product are disclosed herein. The system and method generally involves continuously modifying the toolpath in real-time based upon the forming force of the forming tool compared to a predicted springback error established offline from a series of simplified simulations. The system and method disclosed herein are effective to form products with complex geometries and minimizes the costs and time requirements associated with prior art techniques. |
| FILED | Friday, February 14, 2020 |
| APPL NO | 17/430452 |
| ART UNIT | 3725 — Manufacturing Devices & Processes, Machine Tools & Hand Tools Group Art Units |
| CURRENT CPC | Working or Processing of Sheet Metal or Metal Tubes, Rods or Profiles Without Essentially Removing Material; Punching Metal B21D 31/005 (20130101) Original (OR) Class Control or Regulating Systems in General; Functional Elements of Such Systems; Monitoring or Testing Arrangements for Such Systems or Elements G05B 19/404 (20130101) G05B 2219/45234 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065258 | Heeter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| ASSIGNEE(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| INVENTOR(S) | Robert W. Heeter (Indianapolis, Indiana); Daniel E. Molnar, Jr. (Indianapolis, Indiana); Kathryn A. Sontag (Indianapolis, Indiana); Michael G. Meyer (Indianapolis, Indiana) |
| ABSTRACT | An aircraft includes a duct system configured to receive a flow of air therethrough and a gas turbine engine. The duct system includes a main duct and inlet ducts arranged fluidly upstream of the main duct so as to conduct the flow of air from the inlet ducts into the main duct. The gas turbine engine in downstream fluid communication with the main duct. |
| FILED | Wednesday, January 25, 2023 |
| APPL NO | 18/101567 |
| ART UNIT | 3644 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Equipment for Fitting in or to Aircraft; Flying Suits; Parachutes; Arrangements or Mounting of Power Plants or Propulsion Transmissions in Aircraft B64D 33/02 (20130101) Original (OR) Class B64D 2033/0226 (20130101) B64D 2033/0286 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065270 | Allison |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Government of the United States as represented by the Secretary of the Air Force (Rome, New York) |
| ASSIGNEE(S) | United States of America as represented by the Secretary of the Air Force (Rome, New York) |
| INVENTOR(S) | Jonathan Allison (Albuquerque, New Mexico) |
| ABSTRACT | A system for managing propellant and pressurant for in-space propulsion of a spacecraft is provided. The system includes a conformal fuel tank having an ullage operatively connected for pressurization and a propellant management device (PMD) to wick propellant to a liquid port of the conformal fuel tank. The system further includes a pneumatic circuit including a tank pressurant vent valve for adjustment of operating pressure prior to refueling operations; a vent to release excess pressurant; a pressurant metering vent valve to provide control and safety relief for the pressurant; a check valve to prevent backflow; a pressurant cat bed for decomposing propellant into pressurant; a repressurizing valve to release pressurant once cooled; a burst disk to provide overpressure safety relief; a series of propellant extraction valves to intake a predetermined quantity of propellant for decomposition; and a pressure regulator that delivers proper pressure to a series of thrusters. |
| FILED | Friday, November 03, 2023 |
| APPL NO | 18/501983 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Cosmonautics; Vehicles or Equipment Therefor B64G 1/401 (20130101) B64G 1/402 (20130101) B64G 1/4021 (20230801) Original (OR) Class B64G 1/4024 (20230801) Jet-propulsion Plants F02K 9/42 (20130101) F02K 9/44 (20130101) F02K 9/48 (20130101) F02K 9/50 (20130101) F02K 9/56 (20130101) F02K 9/58 (20130101) F02K 9/566 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065409 | Koide et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Pittsburgh Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | University of Pittsburgh Of the Commonwealth System of Higher Education (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Kazunori Koide (Pittsburgh, Pennsylvania); Kiflai Bein (Mars, Pennsylvania); George D. Leikauf (Gibsonia, Pennsylvania); Robert Kruger Bressin (West Homestead, Pennsylvania); James Proviano Burrows (West Homestead, Pennsylvania); Adriana Gambino (Pittsburgh, Pennsylvania); Dianne Pham (Pittsburgh, Pennsylvania) |
| ABSTRACT | Provided herein are compounds useful in treating exposure to an organophosphorus compound, such as a nerve agent, pesticide, or, generally, an acetylcholinesterase inhibitor, such as sarin. Compositions, e.g. pharmaceutical compositions or dosage forms, comprising the compounds also are provided herein. Methods of treating a patient exposed to a nerve agent, pesticide, or, generally, an acetylcholinesterase inhibitor, e.g., an organophosphorus compound, such as sarin, also are provided. |
| FILED | Thursday, May 30, 2019 |
| APPL NO | 17/058429 |
| ART UNIT | 1621 — Organic Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 9/0019 (20130101) A61K 45/06 (20130101) Heterocyclic Compounds C07D 213/53 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065490 | Cooper et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| ASSIGNEE(S) | BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM (Austin, Texas) |
| INVENTOR(S) | Laurence J. N. Cooper (Houston, Texas); Ana Beatriz Korngold (Houston, Texas); Brian A. Rabinovich (Houston, Texas); Harjeet Singh (Houston, Texas); Simon Olivares (Houston, Texas) |
| ABSTRACT | Provided are methods of generating chimeric antigen receptors (CAR). In some embodiments, library screening of CAR is performed by generating a vector encoding the CAR from random attachment of vectors from libraries of vectors encoding antigen-binding domains (e.g., scFv regions), hinge regions, and endodomains. In some embodiments, the vectors contain a transposon. |
| FILED | Friday, February 26, 2021 |
| APPL NO | 17/187074 |
| ART UNIT | 1643 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 35/17 (20130101) A61K 2035/124 (20130101) Peptides C07K 14/4746 (20130101) C07K 14/4748 (20130101) C07K 14/7051 (20130101) C07K 14/70517 (20130101) C07K 14/70521 (20130101) C07K 14/70578 (20130101) C07K 16/2803 (20130101) Original (OR) Class C07K 2317/622 (20130101) C07K 2319/00 (20130101) C07K 2319/02 (20130101) C07K 2319/03 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/1241 (20130101) C12N 15/85 (20130101) Enzymes C12Y 207/07 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065634 | Ingber et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | PRESIDENT AND FELLOWS OF HARVARD COLLEGE (Cambridge, Massachusetts) |
| ASSIGNEE(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| INVENTOR(S) | Donald E. Ingber (Boston, Massachusetts); Daniel Levner (Boston, Massachusetts); Guy Thompson, II (Watertown, Massachusetts); Jose Fernandez-Alcon (Cambridge, Massachusetts); Christopher David Hinojosa (Cambridge, Massachusetts) |
| ABSTRACT | Systems and methods interconnect cell culture devices and/or fluidic devices by transferring discrete volumes of fluid between devices. A liquid-handling system collects a volume of fluid from at least one source device and deposits the fluid into at least one destination device. In some embodiments, a liquid-handling robot actuates the movement and operation of a fluid collection device in an automated manner to transfer the fluid between the at least one source device and the at least one destination device. In some cases, the at least one source device and the at least one destination device are cell culture devices. The at least one source device and the at least one destination device may be microfluidic or non-microfluidic devices. In some cases, the cell culture devices may be microfluidic cell culture devices. In further cases, the microfluidic cell culture devices may include organ-chips. |
| FILED | Friday, July 22, 2022 |
| APPL NO | 17/871054 |
| ART UNIT | 1796 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/0293 (20130101) B01L 3/502715 (20130101) B01L 2200/027 (20130101) B01L 2300/0816 (20130101) Apparatus for Enzymology or Microbiology; C12M 21/08 (20130101) C12M 23/16 (20130101) C12M 23/38 (20130101) C12M 23/58 (20130101) C12M 29/00 (20130101) C12M 29/10 (20130101) Original (OR) Class C12M 29/20 (20130101) C12M 37/04 (20130101) C12M 41/48 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065649 | Wilson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | John T. Wilson (Nashville, Tennessee); Christian Palmer (Nashville, Tennessee) |
| ABSTRACT | Provided herein are a selective pattern recognition receptor (PRR) agonist and a method of selectively activating a PRR. The selective PRR agonist includes a nucleic acid agonist and a macromolecule conjugated to the nucleic acid agonist. The method includes administering the selective PRR agonist to a subject, and cleaving at least a portion of the macromolecule conjugated to the nucleic acid agonist, the cleaving of at least a portion of the macromolecule permitting the agonist to bind a PRR. |
| FILED | Wednesday, January 09, 2019 |
| APPL NO | 16/961205 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/60 (20170801) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1138 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065660 | Lewis et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Utah State University (North Logan, Utah) |
| ASSIGNEE(S) | UTAH STATE UNIVERSITY (North Logan, Utah) |
| INVENTOR(S) | Randolph V. Lewis (Nibley, Utah); Justin A. Jones (Nibley, Utah); Xiaoli Zhang (Nibley, Utah) |
| ABSTRACT | Transgenic silkworms stably expressing hagfish thread keratin genes or composite silkworm/hagfish thread keratin genes are disclosed. The exogenous hagfish thread keratin genes are stably integrated into a defined site of the fibroin heavy chain intron or a fibroin light chain intron of silkworms. Synthetic hagfish thread keratin proteins and composite hagfish thread keratin-silkworm genes and proteins are provided. The expression of exogenous hagfish thread keratin genes is driven by the endogenous fibroin heavy chain promoter, improving the genetic stability of transgenic silkworms. The composite silkworm/hagfish thread keratin fibers exhibit exceptional mechanical performance, compared to normal silkworm silk fibers and other transgenic silkworm fibers. |
| FILED | Monday, August 17, 2020 |
| APPL NO | 16/995372 |
| ART UNIT | 1632 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Animal Husbandry; Care of Birds, Fishes, Insects; Fishing; Rearing or Breeding Animals, Not Otherwise Provided For; New Breeds of Animals A01K 2217/07 (20130101) A01K 2227/706 (20130101) Peptides C07K 14/78 (20130101) C07K 14/461 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8509 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065668 | Joung et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The General Hospital Corporation (Boston, Massachusetts) |
| ASSIGNEE(S) | The General Hospital Corporation (Boston, Massachusetts) |
| INVENTOR(S) | J. Keith Joung (Winchester, Massachusetts); Morgan Maeder (Brookline, Massachusetts) |
| ABSTRACT | Methods and constructs for RNA-guided targeting of heterologous functional domains such as transcriptional activators to specific genomic loci. |
| FILED | Wednesday, October 06, 2021 |
| APPL NO | 17/450135 |
| ART UNIT | 1656 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 14/005 (20130101) C07K 14/195 (20130101) C07K 2319/00 (20130101) C07K 2319/01 (20130101) C07K 2319/80 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/16 (20130101) C12N 9/22 (20130101) C12N 9/0071 (20130101) C12N 9/96 (20130101) C12N 9/1007 (20130101) C12N 15/01 (20130101) C12N 15/11 (20130101) C12N 15/63 (20130101) C12N 15/85 (20130101) C12N 15/102 (20130101) C12N 15/907 (20130101) Original (OR) Class C12N 15/1031 (20130101) C12N 2310/20 (20170501) C12N 2710/00033 (20130101) C12N 2770/00033 (20130101) C12N 2800/80 (20130101) Enzymes C12Y 114/11 (20130101) C12Y 201/01 (20130101) C12Y 301/00 (20130101) C12Y 301/21004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065696 | Ricke et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Darrell Orlyn Ricke (Winchester, Massachusetts); James Harper (Jamaica Plain, Massachusetts); Brian S. Helfer (Brookline, Massachusetts); Joseph Isaacson (Latham, New York); Adam M. Michaleas (Hudson, New Hampshire); Martha S. Petrovick (Barre, Massachusetts); Eric Schwoebel (Woburn, Massachusetts); Anna Shcherbina (East Palo Alto, California); Philip Fremont-Smith (Newmarket, New Hampshire); James G. Watkins (Sutton, Massachusetts); Edward C. Wack (Waltham, Massachusetts) |
| ABSTRACT | The disclosure provides various systems and methods for identifying individuals from one or more samples. In particular, improved systems and methods of analysis are provided for handling multiple contributors, as well as systems and methods that model not only individual error rates per locus but factor in amplification of errors induced through PCR cycles. In some embodiments, modeling of error rates can be applied in multi-contributor settings to more accurately establish real alleles from artifacts. Other aspects involve application of sequencing in error modeling. Further, methods are provided for determining the presence of common individual DNA profiles in one or more complex DNA mixtures and for deconvolution of multiple complex DNA mixtures into shared individual components. The methods of the disclosure do not require any prior knowledge of individual DNA profiles or contributors to the complex DNA mixtures. Moreover, the methods of the disclosure may use any SNP panel, including those panels already existing and those panels specifically designed to maximize performance characteristics of the methods described herein. |
| FILED | Wednesday, February 01, 2023 |
| APPL NO | 18/104727 |
| ART UNIT | 2166 — Data Bases & File Management |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/6858 (20130101) Original (OR) Class C12Q 1/6869 (20130101) C12Q 1/6886 (20130101) C12Q 2600/156 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 20/00 (20190201) G16B 40/10 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065960 | Buchanan |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | William Gregory Buchanan (King George, Virginia) |
| ASSIGNEE(S) | United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| INVENTOR(S) | William Gregory Buchanan (King George, Virginia) |
| ABSTRACT | A rotary pump is provided for fluid transfer. The pump includes a planar housing, an elongated rotor, a pair of double-concave blades, fore and aft cover plates, and a gear box. The housing has a circular center cavity, and a pair of circular lateral cavities overlapping the center cavity and disposed along a longitudinal axis. The rotor is disposed on a rotor shaft along a rotation axis perpendicular to the longitudinal axis within the center cavity. The blades flank the rotor and are disposed within their corresponding lateral cavity and turn on corresponding blade shafts parallel to the rotor shaft. The fore and aft cover plates flank the housing along the rotation axis to cover the center and lateral cavities. The blades turn opposite from the rotor. |
| FILED | Monday, May 15, 2023 |
| APPL NO | 18/197215 |
| ART UNIT | 3746 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Rotary-piston or Oscillating-piston Machines or Engines F01C 1/22 (20130101) Cyclically Operating Valves for Machines or Engines F01L 1/18 (20130101) Internal-combustion Piston Engines; Combustion Engines in General F02B 53/00 (20130101) F02B 53/06 (20130101) F02B 53/12 (20130101) Original (OR) Class F02B 55/00 (20130101) F02B 55/02 (20130101) F02B 55/08 (20130101) F02B 55/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065967 | Bryan |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ROLLS-ROYCE NORTH AMERICAN TECHNOLOGIES INC. (Indianapolis, Indiana) |
| ASSIGNEE(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana) |
| INVENTOR(S) | William Barry Bryan (Indianapolis, Indiana) |
| ABSTRACT | A turbofan engine has a fan portion in fluid communication with a core stream and a bypass stream of air separated by splitters disposed both upstream and downstream of the fan portion. A blade splitter (shroud) on the fan partially spans the fan blade thus separating the core and bypass streams downstream while leaving a gap upstream for communication between the flows. The communication gap expands the operational range of the fan over fans without the communication gap. |
| FILED | Thursday, December 29, 2022 |
| APPL NO | 18/148059 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Non-positive Displacement Machines or Engines, e.g Steam Turbines F01D 11/02 (20130101) F01D 17/162 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 7/04 (20130101) Original (OR) Class Jet-propulsion Plants F02K 3/06 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2240/14 (20130101) F05D 2240/55 (20130101) F05D 2240/122 (20130101) F05D 2240/301 (20130101) F05D 2240/304 (20130101) F05D 2260/606 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065979 | Heeter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| ASSIGNEE(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| INVENTOR(S) | Robert W. Heeter (Indianapolis, Indiana); Daniel E. Molnar, Jr. (Indianapolis, Indiana); Kathryn A. Sontag (Indianapolis, Indiana); Michael G. Meyer (Indianapolis, Indiana) |
| ABSTRACT | A gas turbine engine comprises a primary fan and an engine core. The primary fan is mounted for rotation about an axis of the gas turbine engine to provide thrust. The engine core is coupled to the primary fan and configured to drive the primary fan about the axis to cause the fan to push air to provide thrust for the gas turbine engine. |
| FILED | Tuesday, December 27, 2022 |
| APPL NO | 18/088974 |
| ART UNIT | 3741 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Equipment for Fitting in or to Aircraft; Flying Suits; Parachutes; Arrangements or Mounting of Power Plants or Propulsion Transmissions in Aircraft B64D 31/06 (20130101) Gas-turbine Plants; Air Intakes for Jet-propulsion Plants; Controlling Fuel Supply in Air-breathing Jet-propulsion Plants F02C 3/06 (20130101) F02C 9/20 (20130101) Original (OR) Class Jet-propulsion Plants F02K 3/04 (20130101) Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/32 (20130101) F05D 2260/60 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066035 | Heeter et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| ASSIGNEE(S) | Rolls-Royce North American Technologies Inc. (Indianapolis, Indiana); Rolls-Royce Corporation (Indianapolis, Indiana) |
| INVENTOR(S) | Robert W. Heeter (Indianapolis, Indiana); Daniel E. Molnar, Jr. (Indianapolis, Indiana); Michael S. Krautheim (Indianapolis, Indiana) |
| ABSTRACT | A fan case assembly adapted for use with a gas turbine engine includes a case at extends circumferentially at least partway about an axis of the gas turbine engine and a plurality of vanes. The case is formed to define a channel that that extends circumferentially at least partway about the axis. The plurality of vanes are arranged in the channel and spaced apart circumferentially about the axis. |
| FILED | Wednesday, August 16, 2023 |
| APPL NO | 18/234663 |
| ART UNIT | 3745 — Thermal & Combustion Technology, Motive & Fluid Power Systems |
| CURRENT CPC | Jet-propulsion Plants F02K 3/06 (20130101) Non-positive-displacement Pumps F04D 29/68 (20130101) F04D 29/526 (20130101) F04D 29/542 (20130101) F04D 29/563 (20130101) Original (OR) Class Indexing Scheme for Aspects Relating to Non-positive-displacement Machines or Engines, Gas-turbines or Jet-propulsion Plants F05D 2220/36 (20130101) F05D 2240/12 (20130101) F05D 2240/14 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066197 | Narayanan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Vinod Narayanan (Davis, California); Erfan Rasouli (Davis, California) |
| ABSTRACT | The disclosed embodiments relate to a system that provides a polymer heat exchanger with internal microscale flow passages. The system includes a set of plates comprised of a polymer that includes internal microscale flow passages, which are configured to carry a liquid. The set of plates is organized into a stack, wherein consecutive plates in the stack are separated by fins to form intervening air passages. The system includes a liquid flow pathway, which flows from a liquid inlet, through the internal microscale flow passages in the stack of plates, to a liquid outlet. It also includes an airflow pathway, which flows from an airflow inlet, through the intervening air passages between the consecutive plates in the stack of plates, to an airflow outlet. The liquid flow pathway flows in a direction opposite to a direction of the airflow pathway to provide a counterflow design that optimizes heat transfer between the liquid flow pathway and the airflow pathway. |
| FILED | Wednesday, January 13, 2021 |
| APPL NO | 17/148359 |
| ART UNIT | 3763 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Air-conditioning; Air-humidification; Ventilation; Use of Air Currents for Screening F24F 1/0067 (20190201) Original (OR) Class F24F 1/00077 (20190201) Refrigeration Machines, Plants or Systems; Combined Heating and Refrigeration Systems; Heat-pump Systems F25B 9/002 (20130101) F25B 30/02 (20130101) Details of Heat-exchange and Heat-transfer Apparatus, of General Application F28F 3/022 (20130101) F28F 3/048 (20130101) F28F 2250/106 (20130101) F28F 2255/143 (20130101) F28F 2260/02 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066254 | Maxwell et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of the Navy (Arlington, Virginia) |
| INVENTOR(S) | Jesse R. Maxwell (Silver Spring, Maryland); Robert W. Baldauff (Mechanicsville, Maryland); Triem T. Hoang (Clifton, Virginia) |
| ABSTRACT | A method of thermally protecting a leading edge of a hypersonic system includes saturating an annular primary wick in contact with an evaporator and having a first pore size with a phase change material by means of an annularly-inward secondary wick having a second pore size and being coupled to a liquid line, the second pore size being larger than the first, where a first end of the secondary wick extends into a reservoir and a second end of the secondary wick extends into the evaporator, the second end of the secondary wick having a terminal end. The method includes terminating the liquid line inside of the evaporator, transferring thermal energy from the leading edge into the phase change material, raising the temperature of the phase change material to a phase-change temperature, changing phase of the phase change material, and carrying away heat from the leading edge. |
| FILED | Monday, June 04, 2018 |
| APPL NO | 15/997465 |
| ART UNIT | 3763 — Refrigeration, Vaporization, Ventilation, and Combustion |
| CURRENT CPC | Heat-exchange Apparatus, Not Provided for in Another Subclass, in Which the Heat-exchange Media Do Not Come into Direct Contact F28D 15/04 (20130101) F28D 15/025 (20130101) F28D 15/0266 (20130101) F28D 15/0275 (20130101) Original (OR) Class F28D 2021/0021 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066276 | Bugge et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Raytheon Company (Waltham, Massachusetts) |
| ASSIGNEE(S) | Raytheon Company (Tewksbury, Massachusetts) |
| INVENTOR(S) | John F. Bugge (Hertford, North Carolina); Byron Terence Edgar (Tucson, Arizona) |
| ABSTRACT | A sabot including a first casing petal having at least one coupling feature and at least one disengagement feature; a second casing petal having at least one coupling feature and at least one disengagement feature; and a cap insertable within a forward receiver formed by coupling the first casing petal with the second casing petal, wherein the first casing petal and the second casing petal and the cap are configured to cooperatively attach to a forward assembly of a missile and cooperatively detach from the forward assembly of the missile responsive to a missile launch. |
| FILED | Thursday, May 05, 2022 |
| APPL NO | 17/737428 |
| ART UNIT | 3641 — Aeronautics, Agriculture, Fishing, Trapping, Vermin Destroying, Plant and Animal Husbandry, Weaponry, Nuclear Systems, and License and Review |
| CURRENT CPC | Explosive Charges, e.g for Blasting, Fireworks, Ammunition F42B 14/06 (20130101) F42B 14/064 (20130101) Original (OR) Class F42B 14/067 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066404 | Beardslee et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | Luke Armitage Beardslee (Atlanta, Georgia); Oliver Brand (Atlanta, Georgia); Kemal Safak Demirci (Atlanta, Georgia); Jae Hyeong Seo (Atlanta, Georgia); Steven Andrew Schwartz (Atlanta, Georgia) |
| ABSTRACT | Disclosed herein is a chemical sensing system, comprising: a sensor configured to adsorb an analyte; an electronic circuit to operate the sensor; and a microcontroller in communication with the sensor and the electronic circuit. The microcontroller can also be configured to provide a real-time signal indicative of a concentration of the analyte. The sensor can comprise a microelectromechanical system (MEMS) resonator and a sensing film configured to adsorb the analyte, the sensing film coating at least a portion of the sensor. The MEMS resonator can comprise a second sensor, such as an impedimetric sensor to measure at least a second property of the sensing film. The electronic circuit can process signals stemming from at least two properties of the same sensing film, such as the changes in mass and dielectric constant of the same sensing film due to adsorption of analyte. |
| FILED | Monday, June 05, 2023 |
| APPL NO | 18/205912 |
| ART UNIT | 2863 — Printing/Measuring and Testing |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 27/221 (20130101) G01N 27/227 (20130101) G01N 29/022 (20130101) Original (OR) Class G01N 29/036 (20130101) G01N 2291/022 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066419 | Beshay |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intelligent Optical Systems, Inc. (Torrance, California) |
| ASSIGNEE(S) | Intelligent Optical Systems, Inc. (Torrence, California) |
| INVENTOR(S) | Manal Beshay (Rancho Palos Verdes, California) |
| ABSTRACT | A sensor and method for the rapid detection of fluoride containing gaseous species specifically the chemical warfare agents Sarin and Soman nerve gas, in which a chemically sensitive composition containing dye indicator molecules complexed with a heavy metal salt is exposed to an environment under surveillance for toxic gasses. In one embodiment the sensing composition is introduced into a polymer-based substrate. The detection composition reacts with hydrogen fluoride which is a decomposition by-product of Sarin and Soman gas so as to change the color of the dye indicator, in one embodiment being pentamethoxy red, that is to change the color of the polymer-based substrate from colorless to a dark purple color. The complex of pentamethoxy red with the exemplary heavy metal salt, zirconyl chloride, is specific for Sarin and Soman nerve gas; it does not react to certain other toxic gases. In various embodiments a hydrolyzing agent is introduced in the polymer-based substrate to improve the detection reaction sensitivity and to increase the reaction rate and decrease the detection time for sensor chemistry. |
| FILED | Monday, August 05, 2019 |
| APPL NO | 16/531613 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/0052 (20130101) G01N 33/0057 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066679 | Augst et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| ASSIGNEE(S) | Massachusetts Institute of Technology (Cambridge, Massachusetts) |
| INVENTOR(S) | Steven J. Augst (Acton, Massachusetts); Peter O'Brien (Derry, New Hampshire); Jonathan Wilson (Hampstead, New Hampshire) |
| ABSTRACT | High-power light absorbers (HPLAs) can exhibit low back-scattered light, mitigate stray light, and withstand high optical power. The absorbers can be used with or without baffling as beam dumps for high-power lasers. An HPLA may include a substrate made of high thermally conductive material with an anti-reflection (AR) coating formed on the substrate. A thin layer of highly absorbing material may be located between the AR coating and substrate. The substrate can be cooled with a fluid, such as water or air. |
| FILED | Tuesday, December 22, 2020 |
| APPL NO | 17/130598 |
| ART UNIT | 2872 — Optics |
| CURRENT CPC | Optical Elements, Systems, or Apparatus G02B 1/11 (20130101) G02B 5/003 (20130101) G02B 5/284 (20130101) G02B 7/008 (20130101) Original (OR) Class Devices Using the Process of Light Amplification by Stimulated Emission of Radiation [LASER] to Amplify or Generate Light; Devices Using Stimulated Emission of Electromagnetic Radiation in Wave Ranges Other Than Optical H01S 3/04 (20130101) H01S 5/024 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12067091 | Cron et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | SYNOPSYS, INC. (Sunnyvale, California) |
| ASSIGNEE(S) | SYNOPSYS, INC. (Sunnyvale, California) |
| INVENTOR(S) | Adam David Cron (Hilton Head Island, South Carolina); Andrew Elias (Ottawa, Canada); Bandi Chandra Sekhar Reddy (Union City, California); Michael Borza (Ottawa, Canada) |
| ABSTRACT | Some aspects of this disclosure are directed to implementing hardware-based obfuscation of digital data. For example, some aspects of this disclosure relate to a method, including performing a capture operation that loads a plurality of primary input (PI) bits into corresponding shift registers of a plurality of test data registers (TDRs) disposed on one or more digital semiconductor devices and configured to store a plurality of secret information bits. The method further includes performing a sequence of shift operations on the plurality of TDRs to obtain a plurality of output bits. The method further includes applying, by an authenticating processor, a derivation function on the plurality of output bits to extract the plurality of secret information bits thereby authenticating the one or more digital semiconductor devices. |
| FILED | Tuesday, December 21, 2021 |
| APPL NO | 17/558389 |
| ART UNIT | 2433 — Cryptography and Security |
| CURRENT CPC | Electric Digital Data Processing G06F 21/14 (20130101) Original (OR) Class G06F 21/73 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12067434 | Church |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| ASSIGNEE(S) | President and Fellows of Harvard College (Cambridge, Massachusetts) |
| INVENTOR(S) | George M. Church (Brookline, Massachusetts) |
| ABSTRACT | The present invention relates to methods of synthesizing de novo a polynucleotide storing data using a programmable template independent polymerase. |
| FILED | Tuesday, October 18, 2022 |
| APPL NO | 18/047328 |
| ART UNIT | 2876 — Optics |
| CURRENT CPC | Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/68 (20130101) Recognition of Data; Presentation of Data; Record Carriers; Handling Record Carriers G06K 19/00 (20130101) G06K 19/022 (20130101) Original (OR) Class Computer Systems Based on Specific Computational Models G06N 3/123 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 30/00 (20190201) G16B 30/20 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12067766 | Zhao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Intelligent Fusion Technology, Inc. (Germantown, Maryland) |
| ASSIGNEE(S) | Intelligent Fusion Technology, Inc. (Germantown, Maryland) |
| INVENTOR(S) | Qi Zhao (Germantown, Maryland); Huong Ngoc Dang (Germantown, Maryland); Yi Li (Germantown, Maryland); Xin Tian (Germantown, Maryland); Nichole Sullivan (Germantown, Maryland); Genshe Chen (Germantown, Maryland); Khanh Pham (Kirtland AFB, New Mexico) |
| ABSTRACT | A system includes: a named data networking (NDN) based Spark distributed computing network including a Spark distributed computing network including a master computer node and a plurality of slave computer nodes, and a named data networking (NDN) protocol installed on the Spark distributed computing network, and a coded distributed computing (CDC) target recognition model deployed on the NDN-based Spark distributed computing network. The NDN-based Spark distributed computing network is configured to: receive one or more batches of input images; generate a parity image from each batch of the input images; predict a label for each image of the batch of the input images; process the generated parity image; upon a label prediction of one image of the batch of the input images being unavailable, reconstruct the unavailable label prediction; and classify labels for the input images. |
| FILED | Wednesday, December 15, 2021 |
| APPL NO | 17/551436 |
| ART UNIT | 2666 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image or Video Recognition or Understanding G06V 10/82 (20220101) G06V 10/95 (20220101) Original (OR) Class G06V 10/96 (20220101) G06V 10/764 (20220101) G06V 10/7715 (20220101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068462 | Treger et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CAMX Power LLC (Lexington, Massachusetts) |
| ASSIGNEE(S) | CAMX Power LLC (Lexington, Massachusetts) |
| INVENTOR(S) | Jack Treger (Quincy, Massachusetts); Kacy Tully (Lexington, Massachusetts) |
| ABSTRACT | A low voltage electrochemical cell is provided that includes a metallic anode including an anode metal, a metallic cathode including a cathode metal, the metallic cathode further including a surface layer including an alloy of the anode metal and the cathode metal, an electrolyte disposed between the metallic anode and the metallic cathode, and a separator within the electrolyte or embedded with electrolyte. The electrochemical cell further includes a voltage stabilization electron current between said anode and said cathode, where the voltage stabilization electron current has an amperage capable of maintaining an open load circuit voltage of the electrochemical cell that varies by less than 10 percent over 10 hours or greater, optionally a month or greater, optionally over the cell lifetime, or a non-equilibrium anode metal/cathode metal ratio in the surface layer for 10 hours or greater, optionally a month or greater, optionally over the cell lifetime. |
| FILED | Friday, May 07, 2021 |
| APPL NO | 17/314375 |
| ART UNIT | 1725 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 4/134 (20130101) H01M 10/4257 (20130101) Original (OR) Class H01M 2004/027 (20130101) H01M 2004/028 (20130101) H01M 2010/4271 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068516 | Haralson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rockwell Collins, Inc. (Cedar Rapids, Iowa) |
| ASSIGNEE(S) | Rockwell Collins, Inc. (Cedar Rapids, Iowa) |
| INVENTOR(S) | Zachary Haralson (Iowa City, Indiana); Jonathan A. Lovseth (Marion, Iowa); Michael C. Meholensky (Marion, Iowa) |
| ABSTRACT | A radio frequency (RF) transmission line is described. The RF transmission line includes a first ground line, a second ground line, and a signal line disposed on a substrate and forming a coplanar waveguide. A plasma limiter feature is integrated into an internal surface of one or more of the first ground line, the second ground line, and the signal line. The plasma limiter decreases a gap distance between the signal line and the associated ground line. The gap distance is selected, together with a gas pressure, to control a voltage at which the gas within the gap breaks down, targeted at a breakdown power of 1 W across a wide bandwidth. The plasma limiter thus limits a power transmitted by way of the RF transmission line for protecting a sensitive integrated circuit. |
| FILED | Friday, March 25, 2022 |
| APPL NO | 17/704173 |
| ART UNIT | 2842 — Electrical Circuits and Systems |
| CURRENT CPC | Waveguides; Resonators, Lines, or Other Devices of the Waveguide Type H01P 1/14 (20130101) Original (OR) Class Control of Amplification H03G 11/004 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068749 | Dani et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Reach Power, Inc. (Redwood City, California) |
| ASSIGNEE(S) | Reach Power, Inc. (Redwood City, California) |
| INVENTOR(S) | Asmita Dani (Redwood City, California); Christopher Joseph Davlantes (Redwood City, California) |
| ABSTRACT | A bidirectional RF circuit, preferably including a plurality of terminals, a switch, a transistor, a coupler, and a feedback network. The circuit can optionally include a drain matching network, an input matching network, and/or one or more tuning inputs. In some variations, the circuit can optionally include one or more impedance networks, such as an impedance network used in place of the feedback network; in some such variations, the circuit may not include a coupler, switch, and/or input matching network. A method for circuit operation, preferably including operating in an amplifier mode, operating in a rectifier mode, and/or transitioning between operation modes. |
| FILED | Wednesday, May 31, 2023 |
| APPL NO | 18/203810 |
| ART UNIT | 2842 — Electrical Circuits and Systems |
| CURRENT CPC | Apparatus for Conversion Between AC and AC, Between AC and DC, or Between DC and DC, and for Use With Mains or Similar Power Supply Systems; Conversion of DC or AC Input Power into Surge Output Power; Control or Regulation Thereof H02M 7/217 (20130101) Amplifiers H03F 3/19 (20130101) H03F 2200/451 (20130101) Control of Amplification H03G 3/3036 (20130101) H03G 2201/103 (20130101) H03G 2201/307 (20130101) Pulse Technique H03K 3/012 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068773 | Stubbs et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Naval Information Warfare Center Pacific (San Diego, California) |
| ASSIGNEE(S) | United States of America as represented by the Secretary of the Navy (Washington, District of Columbia) |
| INVENTOR(S) | Andrew Lee Stubbs (Charleston, South Carolina); Laura Catherine Tolliver (Charleston, South Carolina); Kevin Paul Votapka (Charleston, South Carolina); Wilmot S Gilland, IV (Goose Creek, South Carolina); Tyler Austin Brant (Summerville, South Carolina); Ian McLean Christine (Raleigh, North Carolina); Hunter J Smith (Charleston, South Carolina) |
| ABSTRACT | A backpackable electronic warfare system includes a backplane, one or more radioheads, one or more systems on a chip, a single board computer, a position, navigation, and timing module, a power management device, a thermal management device, and one or more batteries. |
| FILED | Thursday, May 26, 2022 |
| APPL NO | 17/825356 |
| ART UNIT | 2648 — Telecommunications: Analog Radio Telephone; Satellite and Power Control; Transceivers, Measuring and Testing; Bluetooth; Receivers and Transmitters; Equipment Details |
| CURRENT CPC | Transmission H04B 1/385 (20130101) Original (OR) Class H04B 1/3883 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12069010 | Elson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Joel Elson (Elkhorn, Nebraska); Doug Derrick (Papillion, Nebraska); Erin Kearns (Omaha, Nebraska); Jack Rygg (Omaha, Nebraska); Sam Schneider (Omaha, Nebraska); Bradley Corwin (Omaha, Nebraska); Aiden Barger (Omaha, Nebraska) |
| ABSTRACT | A system for reporting and investigating threats includes one or more computer processors configured to: present a chatbot via a user interface device; request response data associated with a threat inquiry via the chatbot by requesting freeform response data associated with the threat inquiry via the chatbot and transitioning to intelligent question-path selection to collect additional response data associated with the threat inquiry, wherein the intelligent question-path selection is prompted by the freeform response data; record user input response data; and identify suspicious activity based on the user input response data by performing natural language analysis and searching the user input response data for threat related words or phrases. |
| FILED | Friday, October 06, 2023 |
| APPL NO | 18/482189 |
| ART UNIT | 2459 — Computer Networks |
| CURRENT CPC | Electric Digital Data Processing G06F 40/20 (20200101) Image Data Processing or Generation, in General G06T 19/006 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 51/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Science Foundation (NSF)
| US 12064209 | Nazari et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Integrated Medical Sensors, Inc. (Irvine, California) |
| ASSIGNEE(S) | |
| INVENTOR(S) | Meisam Honarvar Nazari (Irvine, California); Muhammad Mujeeb-U-Rahman (Irvine, California); Mehmet Sencan (Culver City, California) |
| ABSTRACT | Monitoring of one or more key indicators can provide powerful insights into the operation and state of different physical systems. For example, continuous monitoring of multiple analytes in a subject allows for detailed insights into personal health as well as allowing for the implementation of preventative health measures. Herein are described design and processing methods for a small wireless multi-analyte sensing platform that can be used to monitor multiple analytes such as glucose, lactate, Urea and other physicochemical quantities. The design techniques and processing methods presented herein can be used for a multitude of other applications and are not limited to those described here. |
| FILED | Tuesday, May 08, 2018 |
| APPL NO | 16/612391 |
| ART UNIT | 3796 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/002 (20130101) A61B 5/0031 (20130101) Original (OR) Class A61B 5/1473 (20130101) A61B 5/7275 (20130101) A61B 5/14532 (20130101) A61B 2560/0219 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064251 | He et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota) |
| ASSIGNEE(S) | REGENTS OF THE UNIVERSITY OF MINNESOTA (Minneapolis, Minnesota) |
| INVENTOR(S) | Bin He (Arden Hills, Minnesota); Zhaoye Zhou (Minneapolis, Minnesota) |
| ABSTRACT | A system and method for non-invasively generating a report of cardiac electrical activities of a subject includes determining, using cardiac electrical activation information, equivalent current densities (ECDs). The ECDs are assembled into time-course ECD information and a spectrum of the time-course ECD information is analyzed to determine peaks for spectral characteristics of atrial fibrillation (AF). The spectral characteristics of AF are correlated with potential electrical sources of the AF and a report is generated indicating the potential electrical sources of the AF spatially registered with the medical imaging data. |
| FILED | Friday, September 04, 2020 |
| APPL NO | 17/013003 |
| ART UNIT | 3797 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Diagnosis; Surgery; Identification A61B 5/0037 (20130101) A61B 5/0044 (20130101) A61B 5/055 (20130101) A61B 5/316 (20210101) Original (OR) Class A61B 5/333 (20210101) A61B 5/361 (20210101) A61B 5/7278 (20130101) A61B 5/7289 (20130101) A61B 6/032 (20130101) A61B 6/507 (20130101) A61B 2576/023 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064262 | Ganesan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Massachusetts (Boston, Massachusetts) |
| ASSIGNEE(S) | University of Massachusetts (Boston, Massachusetts) |
| INVENTOR(S) | Deepak Ganesan (Amherst, Massachusetts); Trisha L. Andrew (Hadley, Massachusetts); Ali Kiaghadi (Amherst, Massachusetts); Seyedeh Zohreh Homayounfar (Amherst, Massachusetts); Jeremy Gummeson (Belchertown, Massachusetts) |
| ABSTRACT | A garment system comprises a garment substrate formed from one or more textile-based sheets, a distributed array of a plurality of resistive pressure sensors coupled to the garment substrate at a set of first specified locations. Each of the plurality of resistive sensors comprises a pair of first textile-based outer layers each having an electrical resistance of no more than 100 ohms and a textile-based inner layer sandwiched between the pair of first textile-based outer layers having an electrical resistance of at least 1 mega-ohm. The system also includes electronics configured to process signals from the distributed array of resistive pressure sensors to determine one or more physiological properties of a wearer of the garment substrate. |
| FILED | Monday, August 08, 2022 |
| APPL NO | 17/818158 |
| ART UNIT | 1786 — Miscellaneous Articles, Stock Material |
| CURRENT CPC | Outerwear; Protective Garments; Accessories A41D 1/005 (20130101) A41D 31/04 (20190201) Diagnosis; Surgery; Identification A61B 5/1102 (20130101) A61B 5/1116 (20130101) A61B 5/6804 (20130101) Original (OR) Class A61B 5/6823 (20130101) A61B 2562/0247 (20130101) Layered Products, i.e Products Built-up of Strata of Flat or Non-flat, e.g Cellular or Honeycomb, Form B32B 3/08 (20130101) B32B 5/024 (20130101) B32B 5/26 (20130101) B32B 7/025 (20190101) B32B 2250/20 (20130101) B32B 2255/02 (20130101) B32B 2255/26 (20130101) B32B 2255/205 (20130101) B32B 2262/062 (20130101) B32B 2262/0261 (20130101) B32B 2307/73 (20130101) B32B 2307/202 (20130101) B32B 2307/204 (20130101) B32B 2307/206 (20130101) B32B 2437/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064759 | Yang et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | NUtech Ventures (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (Farmington, Connecticut) |
| ASSIGNEE(S) | NUTECH VENTURES (Lincoln, Nebraska); UNIVERSITY OF CONNECTICUT (Farmington, Connecticut) |
| INVENTOR(S) | Ruiguo Yang (Lincoln, Nebraska); Arian Jaberi (Lincoln, Nebraska); Amir Monemian Esfahani (Lincoln, Nebraska); Ali Tamayol (Providence, Rhode Island) |
| ABSTRACT | Microfluidic gradient generators that can create robust platforms that can not only be used for creating co-cultures of cells with various ratios, but also can simultaneously generate gradients of mechanical and chemical stresses. A chip utilizes microchambers embedded within channels to provide space for 3D cell culture and exposes these cells to gradients of mechanical shear stress and a chemical treatment. |
| FILED | Friday, April 30, 2021 |
| APPL NO | 17/245381 |
| ART UNIT | 1797 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/5025 (20130101) Original (OR) Class B01L 2300/087 (20130101) B01L 2300/0877 (20130101) B01L 2300/0883 (20130101) Apparatus for Enzymology or Microbiology; C12M 41/46 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/34 (20130101) C12N 2513/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065507 | Zhan et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Kentucky Research Foundation (Lexington, Kentucky) |
| ASSIGNEE(S) | University of Kentucky Research Foundation (Lexington, Kentucky) |
| INVENTOR(S) | Chang-Guo Zhan (Lexington, Kentucky); Fang Zheng (Lexington, Kentucky); Chunhui Zhang (Lexington, Kentucky) |
| ABSTRACT | Compositions and methods are provided for use in binding opioids, such as 6-MAM, morphine, heroin, hydrocodone, oxycodone, meperidine, and fentanyl, while avoiding binding to OUD treatment agents, such as naloxone and naltrexone. Methods are also provided for use in a systematic structure-based virtual screening and design approach for identification of such antibodies. Methods are also provided for use in treating OUD. Methods are also provided for use in detecting an opioid in a sample. |
| FILED | Tuesday, June 01, 2021 |
| APPL NO | 17/336165 |
| ART UNIT | 1654 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 16/44 (20130101) Original (OR) Class C07K 2317/24 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 33/9486 (20130101) Bioinformatics, i.e Information and Communication Technology [ICT] Specially Adapted for Genetic or Protein-related Data Processing in Computational Molecular Biology G16B 15/30 (20190201) G16B 30/10 (20190201) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065519 | Matyjaszewski et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | CARNEGIE MELLON UNIVERSITY (Pittsburgh, Pennsylvania) |
| ASSIGNEE(S) | CARNEGIE MELLON UNIVERSITY (Pittsburgh, Pennsylvania) |
| INVENTOR(S) | Krzysztof Matyjaszewski (Pittsburgh, Pennsylvania); Guojun Xie (Newark, Delaware); Michael R. Martinez (Millbrae, California); Thomas G. Ribelli (State College, Pennsylvania) |
| ABSTRACT | A method of carrying out an atom transfer radical polymerization wherein intermolecular crosslinking can occur includes controlling an amount of crosslinking by carrying out the reaction under conditions wherein catalytic radical termination is favored over radical termination. |
| FILED | Saturday, June 01, 2019 |
| APPL NO | 17/059806 |
| ART UNIT | 1763 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Macromolecular Compounds Obtained by Reactions Only Involving Carbon-to-carbon Unsaturated Bonds C08F 2/48 (20130101) Original (OR) Class C08F 220/1804 (20200201) C08F 265/06 (20130101) C08F 293/005 (20130101) C08F 2438/01 (20130101) C08F 2810/20 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065546 | Sumerlin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | University of Florida Research Foundation, Inc. (Gainesville, Florida) |
| ASSIGNEE(S) | University of Floridia Research Foundation, INC. (Gainesville, Florida) |
| INVENTOR(S) | Brent S. Sumerlin (Gainesville, Florida); William L. A. Brooks (Jacksonville, Florida); Christopher Deng (Goleta, California) |
| ABSTRACT | Boronic acid monomers, methods of making boronic acid monomer, and the like, are provided. Embodiments of the present disclosure are advantageous in that the boronic acid monomers are water soluble at a neutral pH, which is uncommon for boronic acids. As a result, the boronic acid monomers can be used in aqueous polymerization reactions with other hydrophilic monomers to yield polymers including boronic acids and esters. |
| FILED | Wednesday, March 24, 2021 |
| APPL NO | 17/211255 |
| ART UNIT | 1765 — Organic Chemistry, Polymers, Compositions |
| CURRENT CPC | Acyclic, Carbocyclic or Heterocyclic Compounds Containing Elements Other Than Carbon, Hydrogen, Halogen, Oxygen, Nitrogen, Sulfur, Selenium or Tellurium C07F 5/025 (20130101) Macromolecular Compounds Obtained Otherwise Than by Reactions Only Involving Unsaturated Carbon-to-carbon Bonds C08G 79/08 (20130101) Original (OR) Class Compositions of Macromolecular Compounds C08L 85/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065649 | Wilson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Vanderbilt University (Nashville, Tennessee) |
| ASSIGNEE(S) | Vanderbilt University (Nashville, Tennessee) |
| INVENTOR(S) | John T. Wilson (Nashville, Tennessee); Christian Palmer (Nashville, Tennessee) |
| ABSTRACT | Provided herein are a selective pattern recognition receptor (PRR) agonist and a method of selectively activating a PRR. The selective PRR agonist includes a nucleic acid agonist and a macromolecule conjugated to the nucleic acid agonist. The method includes administering the selective PRR agonist to a subject, and cleaving at least a portion of the macromolecule conjugated to the nucleic acid agonist, the cleaving of at least a portion of the macromolecule permitting the agonist to bind a PRR. |
| FILED | Wednesday, January 09, 2019 |
| APPL NO | 16/961205 |
| ART UNIT | 1635 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 47/60 (20170801) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/1138 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065658 | Zhao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UWM Research Foundation, Inc. (Milwaukee, Wisconsin); United States of America, As Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | UWM Research Foundation, Inc. (Milwaukee, Wisconsin); United States of America, As Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| INVENTOR(S) | Dazhong Zhao (Whitefish Bay, Wisconsin); Zhanguo Xin (Lubbock, Texas) |
| ABSTRACT | Disclosed herein are nuclear male sterile sorghum mutants, three-component genetic constructs, and methods of using said mutants and genetic constructs, such as in a two-line male sterility system for hybrid breeding. |
| FILED | Thursday, January 03, 2019 |
| APPL NO | 16/959928 |
| ART UNIT | 1662 — Plants |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8289 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065676 | Redding et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Kevin Redding (Tempe, Arizona); Andrey Kanygin (Phoenix, Arizona) |
| ASSIGNEE(S) | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY (Scottsdale, Arizona) |
| INVENTOR(S) | Kevin Redding (Tempe, Arizona); Andrey Kanygin (Phoenix, Arizona) |
| ABSTRACT | Provided herein, in some embodiments, are engineered cells and use of the same for increased hydrogen production. In particular, provided herein are genetically engineered cells comprising a polynucleotide encoding a fusion protein comprising a photosystem I (PSI) protein and an algal hydrogenase, as well as methods for producing such genetically engineered cells. Also provided herein are methods for increasing hydrogen (H2) production in cells. |
| FILED | Thursday, December 30, 2021 |
| APPL NO | 17/565684 |
| ART UNIT | 1652 — Fermentation, Microbiology, Isolated and Recombinant Proteins/Enzymes |
| CURRENT CPC | Peptides C07K 14/405 (20130101) C07K 2319/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 1/12 (20130101) C12N 9/0077 (20130101) Original (OR) Class C12N 15/62 (20130101) Fermentation or Enzyme-using Processes to Synthesise a Desired Chemical Compound or Composition or to Separate Optical Isomers From a Racemic Mixture C12P 3/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065745 | Dayeh et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Regents of the University of California (Oakland, California) |
| ASSIGNEE(S) | The Regents of the University of California (Oakland, California) |
| INVENTOR(S) | Shadi A. Dayeh (San Diego, California); Mehran Ganji (San Diego, California) |
| ABSTRACT | A method for fabricating a Pt nanorod electrode array sensor device includes forming planar metal electrodes on a flexible film, co-depositing Pt alloy on the planar metal electrodes via physical vapor deposition, and dealloying the Pt alloy to etch Pt nanorods from the deposited Pt alloy. A Pt nanorod electrode sensor device includes a plurality of porous Pt nanorods on a planar metal electrode forming a sensor electrode. The planar metal electrode is on a flexible substrate. An electrode lead on the flexible substrate extends away from the planar metal electrode. Insulation is around porous Pt nanorods an upon the electrode lead. |
| FILED | Thursday, November 07, 2019 |
| APPL NO | 17/291236 |
| ART UNIT | 2813 — Semiconductors/Memory |
| CURRENT CPC | Alloys C22C 5/04 (20130101) Coating Metallic Material; Coating Material With Metallic Material; Surface Treatment of Metallic Material by Diffusion into the Surface, by Chemical Conversion or Substitution; Coating by Vacuum Evaporation, by Sputtering, by Ion Implantation or by Chemical Vapour Deposition, in General C23C 14/16 (20130101) C23C 14/5873 (20130101) Non-mechanical Removal of Metallic Material From Surface; Inhibiting Corrosion of Metallic Material or Incrustation in General; Multi-step Processes for Surface Treatment of Metallic Material Involving at Least One Process Provided for in Class C23 and at Least One Process Covered by Subclass C21D or C22F or Class C25 C23F 1/02 (20130101) Original (OR) Class Electric Digital Data Processing G06F 3/015 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065749 | Pham et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | ELECTRASTEEL, INC. (Boulder, Colorado) |
| ASSIGNEE(S) | ELECTRASTEEL, INC. (Boulder, Colorado) |
| INVENTOR(S) | Ai Quoc Pham (Boulder, Colorado); Sandeep Nijhawan (Boulder, Colorado); Adolfredo Alvarez (Boulder, Colorado); Colleen Wallace (Boulder, Colorado); Steven Fatur (Boulder, Colorado) |
| ABSTRACT | Methods and systems for producing are disclosed. A method for producing iron, for example, comprises: providing an iron-containing ore to a dissolution subsystem comprising a first electrochemical cell; wherein the first anolyte has a different composition than the first catholyte; dissolving at least a portion of the iron-containing ore using an acid to form an acidic iron-salt solution having dissolved first Fe3+ ions; providing at least a portion of the acidic iron-salt solution to the first cathodic chamber; first electrochemically reducing said first Fe3+ ions in the first catholyte to form Fe2+ ions; transferring the formed Fe2+ ions from the dissolution subsystem to an iron-plating subsystem having a second electrochemical cell; second electrochemically reducing a first portion of the transferred formed Fe2+ ions to Fe metal at a second cathode of the second electrochemical cell; and removing the Fe metal. |
| FILED | Wednesday, July 26, 2023 |
| APPL NO | 18/226626 |
| ART UNIT | 1794 — Food, Analytical Chemistry, Sterilization, Biochemistry, Electrochemistry |
| CURRENT CPC | Production and Refining of Metals; Pretreatment of Raw Materials C22B 3/06 (20130101) C22B 5/00 (20130101) Processes for the Electrolytic Production, Recovery or Refining of Metals; Apparatus Therefor C25C 1/06 (20130101) Original (OR) Class C25C 7/02 (20130101) C25C 7/04 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12066445 | Demirci et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts); BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California); BETH ISRAEL DEACONESS MEDICAL CENTER (Boston, Massachusetts) |
| ASSIGNEE(S) | THE BRIGHAM AND WOMEN'S HOSPITAL, INC. (Boston, Massachusetts); BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY (Stanford, California); BETH ISRAEL DEACONESS MEDICAL CENTER (Boston, Massachusetts) |
| INVENTOR(S) | Utkan Demirci (Stanford, California); Ionita Ghiran (Boston, Massachusetts); Savas Tasoglu (Storrs, Connecticut); Ronald W. Davis (Palo Alto, California); Lars Steinmetz (Palo Alto, California); Naside Gozde Durmus (Palo Alto, California); Huseyin Cumhur Tekin (Palo Alto, California) |
| ABSTRACT | Magnetic cell levitation and cell monitoring systems and methods are disclosed. A method for separating a heterogeneous population of cells is performed by placing a microcapillary channel containing the heterogeneous population of cells in a magnetically-responsive medium in the disclosed levitation system and separating the cells by balancing magnetic and corrected gravitational forces on the individual cells. A levitation system is also disclosed, having a microscope on which the microcapillary channel is placed and a set of two magnets between which the microcapillary channel is placed. Additionally, a method for monitoring cellular processes in real-time using the levitation system is disclosed. |
| FILED | Monday, February 08, 2021 |
| APPL NO | 17/169765 |
| ART UNIT | 1633 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Chemical or Physical Laboratory Apparatus for General Use B01L 3/502715 (20130101) B01L 3/502761 (20130101) B01L 2200/0647 (20130101) B01L 2300/168 (20130101) B01L 2300/0654 (20130101) B01L 2300/0838 (20130101) Magnetic or Electrostatic Separation of Solid Materials From Solid Materials or Fluids; Separation by High-voltage Electric Fields B03C 1/32 (20130101) B03C 2201/18 (20130101) B03C 2201/26 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 13/00 (20130101) Measuring or Testing Processes Involving Enzymes, Nucleic Acids or Microorganisms; Compositions or Test Papers Therefor; Processes of Preparing Such Compositions; Condition-responsive Control in Microbiological or Enzymological Processes C12Q 1/18 (20130101) Investigating or Analysing Materials by Determining Their Chemical or Physical Properties G01N 15/0656 (20130101) G01N 15/1031 (20130101) G01N 27/76 (20130101) G01N 33/80 (20130101) Original (OR) Class G01N 33/487 (20130101) G01N 33/491 (20130101) G01N 33/574 (20130101) G01N 2015/0053 (20130101) G01N 2015/1006 (20130101) G01N 2500/10 (20130101) G01N 2800/26 (20130101) G01N 2800/042 (20130101) G01N 2800/52 (20130101) G01N 2800/7042 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12067712 | Popescu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| ASSIGNEE(S) | The Board of Trustees of the University of Illinois (Urbana, Illinois) |
| INVENTOR(S) | Gabriel Popescu (Champaign, Illinois); Mikhail Eugene Kandel (Champaign, Illinois); Yuchen He (Urbana, Illinois); Nahil A. Sobh (Urbana, Illinois); Matthew Benjamin Wheeler (Tolono, Illinois); Marcello Rubessa (Middleton, Wisconsin) |
| ABSTRACT | A system generates a context mask based on quantitative image data. The system obtains the quantitative image data which was captured via a quantitative imaging of a sample. The quantitative image data is compared to previous quantitative image data through application of the quantitative image data to a neural network trained using the previous quantitative image data and corresponding constructed context masks. The comparison generates the context mask for the quantitative image data. The context mask provides context for the quantitative parameter values that facilities characterization of the sample. |
| FILED | Thursday, February 18, 2021 |
| APPL NO | 17/178486 |
| ART UNIT | 2665 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 7/0012 (20130101) Original (OR) Class G06T 2207/10056 (20130101) G06T 2207/10072 (20130101) G06T 2207/20081 (20130101) G06T 2207/20084 (20130101) G06T 2207/30024 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12068464 | Chen et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| ASSIGNEE(S) | Georgia Tech Research Corporation (Atlanta, Georgia) |
| INVENTOR(S) | Hailong Chen (Atlanta, Georgia); Xuetian Ma (Atlanta, Georgia); Yuanzhi Tang (Atlanta, Georgia); Shan Xiong (Atlanta, Georgia) |
| ABSTRACT | Disclosed herein are systems and methods that can present low-temperature recycling of rare metals from spent electrodes. An exemplary method of recycling a battery comprises: mixing, in a solution, at least an electrode material and a first solvent; reducing the electrode material in the solution to create a metallic material; and extracting the metallic material from the solution. |
| FILED | Friday, April 19, 2019 |
| APPL NO | 17/048981 |
| ART UNIT | 1738 — Fuel Cells, Battery, Flammable Gas, Solar Cells, Liquid Crystal Compositions |
| CURRENT CPC | Compounds of Alkali Metals, i.e Lithium, Sodium, Potassium, Rubidium, Caesium, or Francium C01D 15/08 (20130101) Production and Refining of Metals; Pretreatment of Raw Materials C22B 7/006 (20130101) C22B 23/0453 (20130101) C22B 26/12 (20130101) Processes or Means, e.g Batteries, for the Direct Conversion of Chemical Energy into Electrical Energy H01M 10/54 (20130101) Original (OR) Class Climate Change Mitigation Technologies Related to Wastewater Treatment or Waste Management Y02W 30/84 (20150501) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12069453 | LiKamWa et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Arizona Board of Regents on Behalf of Arizona State University (Scottsdale, Arizona) |
| ASSIGNEE(S) | Arizona Board of Regents on behalf of Arizona State University (Scottsdale, Arizona) |
| INVENTOR(S) | Robert LiKamWa (Tempe, Arizona); Frank Wencheng Liu (Tempe, Arizona) |
| ABSTRACT | A system to output a cross-talk cancelled spatial audio signal to two speakers, including a user tracking module to provide a location and orientation of a head of a user, and a time-domain dynamic crosstalk cancellation module to receive a spatial audio signal, the location and orientation of the head of the user from the user tracking module, a location for each of the two speakers, and generate the time-domain crosstalk cancelled spatial audio signal based thereon. |
| FILED | Tuesday, February 25, 2020 |
| APPL NO | 17/433797 |
| ART UNIT | 2693 — Selective Visual Display Systems |
| CURRENT CPC | Electric Digital Data Processing G06F 3/165 (20130101) Loudspeakers, Microphones, Gramophone Pick-ups or Like Acoustic Electromechanical Transducers; Deaf-aid Sets; Public Address Systems H04R 3/14 (20130101) Original (OR) Class H04R 5/02 (20130101) H04R 5/04 (20130101) Stereophonic Systems H04S 1/007 (20130101) H04S 7/303 (20130101) H04S 2400/11 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Agriculture (USDA)
| US 12063889 | Lu et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of Agriculture (Washington, District of Columbia); Board of Trustees of Michigan State University (East Lansing, Michigan) |
| ASSIGNEE(S) | The United States of America, as represented by the Secretary of Agriculture (Washington, District of Columbia); Board of Trustees of Michigan State University (East Lansing, Michigan) |
| INVENTOR(S) | Renfu Lu (Okemos, Michigan); Zhaojian Li (Ann Arbor, Michigan); Kyle Lammers (Grand Rapids, Michigan) |
| ABSTRACT | A three-dimensional stereo vision camera communicates the location of a targeted fruit (preferably an apple) to a controller. The controller directs a vacuum selection tube to the location of the targeted apple. The selection tube has a gripping orifice that has a smaller diameter than the apple so that the vacuum suction from the selection tube grips the apple. The selected fruit is then rotated and pulled away from the tree canopy by the selection tube until the apple detaches from the canopy. The detached apple is then gently placed in a collection bin for later sorting and processing. |
| FILED | Monday, March 01, 2021 |
| APPL NO | 17/188177 |
| ART UNIT | 3671 — Wells, Earth Boring/Moving/Working, Excavating, Mining, Harvesters, Bridges, Roads, Petroleum, Closures, Connections, and Hardware |
| CURRENT CPC | Harvesting; Mowing A01D 46/24 (20130101) A01D 46/30 (20130101) Original (OR) Class Manipulators; Chambers Provided With Manipulation Devices B25J 9/1697 (20130101) B25J 15/0616 (20130101) Image or Video Recognition or Understanding G06V 20/188 (20220101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12064472 | Perez De Leon et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The United States of America, as represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | The United States of America, as Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| INVENTOR(S) | Adalberto A. Perez De Leon (Wake Forest, North Carolina); Robert Miller (McAllen, Texas); Robert E. Briggs (Boone, Iowa); Fred M. Tatum (Nevada, Iowa); Felicito Guerrero (Kerrville, Texas) |
| ABSTRACT | This invention relates to novel fusion peptides and immunogenic compositions containing the fusion peptides useful in the control and prevention of tick infestations. The invention also relates to compositions comprising said fusion peptides, methods of vaccination against tick infestation using said fusion peptides and compositions, and kits for use with such compositions and methods. |
| FILED | Wednesday, May 17, 2023 |
| APPL NO | 18/318909 |
| ART UNIT | 1645 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/0003 (20130101) Original (OR) Class A61K 39/08 (20130101) A61K 2039/53 (20130101) A61K 2039/523 (20130101) A61K 2039/552 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 33/14 (20180101) Peptides C07K 14/33 (20130101) C07K 14/43527 (20130101) C07K 2319/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12065658 | Zhao et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | UWM Research Foundation, Inc. (Milwaukee, Wisconsin); United States of America, As Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| ASSIGNEE(S) | UWM Research Foundation, Inc. (Milwaukee, Wisconsin); United States of America, As Represented by the Secretary of Agriculture (Washington, District of Columbia) |
| INVENTOR(S) | Dazhong Zhao (Whitefish Bay, Wisconsin); Zhanguo Xin (Lubbock, Texas) |
| ABSTRACT | Disclosed herein are nuclear male sterile sorghum mutants, three-component genetic constructs, and methods of using said mutants and genetic constructs, such as in a two-line male sterility system for hybrid breeding. |
| FILED | Thursday, January 03, 2019 |
| APPL NO | 16/959928 |
| ART UNIT | 1662 — Plants |
| CURRENT CPC | Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 15/8289 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Homeland Security (DHS)
| US 12067750 | Vemury et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| ASSIGNEE(S) | The Government of the United States of America, as represented by the Secretary of Homeland Security (Washington, District of Columbia) |
| INVENTOR(S) | Arun Vemury (North Bethesda, Maryland); Yevgeniy Sirotin (Severna Park, Maryland); John Howard (Bethesda, Maryland); Jerry Tipton (Severn, Maryland) |
| ABSTRACT | Systems and methods for measuring skin tone. A camera and computer may measure skin tone health of a face dataset and color quality of a single face image. The computer and camera may measure skin tone across wide sample of volunteers, express skin tone in CIELCH coordinates; and identify the range of observed lightness, chromaticity, and hue values in the population to determine a sample set. The computer and camera may be configured to match the image to a coordinate system of lightness, chromaticity, and hue in the sample set. If a match is not possible, the computer may be configured to select a coordinate closest to the measured lightness, chromaticity, and hue. |
| FILED | Thursday, October 19, 2023 |
| APPL NO | 18/381840 |
| ART UNIT | 2663 — Image Analysis; Applications; Pattern Recognition; Color and compression; Enhancement and Transformation |
| CURRENT CPC | Image Data Processing or Generation, in General G06T 7/80 (20170101) G06T 7/90 (20170101) Original (OR) Class G06T 2207/10024 (20130101) G06T 2207/30201 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
| US 12069010 | Elson et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| ASSIGNEE(S) | Board of Regents of the University of Nebraska (Lincoln, Nebraska) |
| INVENTOR(S) | Joel Elson (Elkhorn, Nebraska); Doug Derrick (Papillion, Nebraska); Erin Kearns (Omaha, Nebraska); Jack Rygg (Omaha, Nebraska); Sam Schneider (Omaha, Nebraska); Bradley Corwin (Omaha, Nebraska); Aiden Barger (Omaha, Nebraska) |
| ABSTRACT | A system for reporting and investigating threats includes one or more computer processors configured to: present a chatbot via a user interface device; request response data associated with a threat inquiry via the chatbot by requesting freeform response data associated with the threat inquiry via the chatbot and transitioning to intelligent question-path selection to collect additional response data associated with the threat inquiry, wherein the intelligent question-path selection is prompted by the freeform response data; record user input response data; and identify suspicious activity based on the user input response data by performing natural language analysis and searching the user input response data for threat related words or phrases. |
| FILED | Friday, October 06, 2023 |
| APPL NO | 18/482189 |
| ART UNIT | 2459 — Computer Networks |
| CURRENT CPC | Electric Digital Data Processing G06F 40/20 (20200101) Image Data Processing or Generation, in General G06T 19/006 (20130101) Transmission of Digital Information, e.g Telegraphic Communication H04L 51/02 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of Commerce (DOC)
| US 12066741 | Klimov et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Government of the United States of America, as represented by the Secretary of Commerce (Gaithersburg, Maryland) |
| ASSIGNEE(S) | GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY OF COMMERCE (Gaithersburg, Maryland) |
| INVENTOR(S) | Nikolai Nikolaevich Klimov (Ellicott City, Maryland); Joseph Arthur Schneemeyer Hagmann (Falls Church, Virginia); Stefan Cular (Gaithersburg, Maryland); Thomas Eller Lipe, Jr. (Richfield, North Carolina) |
| ABSTRACT | A photonic AC-DC voltage and current equivalence converter includes: a photonic chip; a weak thermal link; an isothermal region; a resistive electrode; an isothermal region photonic nanoresonator; an isothermal region waveguide; a chip photonic nanoresonator; and a chip waveguide, such that an ac voltage is determined from matching a temperature rise of the isothermal region due to a primary elevated temperature of the isothermal region when ac voltage is received by the resistive electrode. |
| FILED | Monday, September 27, 2021 |
| APPL NO | 17/486852 |
| ART UNIT | 2845 — Electrical Circuits and Systems |
| CURRENT CPC | Devices or Arrangements, the Optical Operation of Which Is Modified by Changing the Optical Properties of the Medium of the Devices or Arrangements for the Control of the Intensity, Colour, Phase, Polarisation or Direction of Light, e.g Switching, Gating, Modulating or Demodulating; Techniques or Procedures for the Operation Thereof; Frequency-changing; Non-linear Optics; Optical Logic Elements; Optical Analogue/digital Converters G02F 7/00 (20130101) Original (OR) Class Apparatus for Conversion Between AC and AC, Between AC and DC, or Between DC and DC, and for Use With Mains or Similar Power Supply Systems; Conversion of DC or AC Input Power into Surge Output Power; Control or Regulation Thereof H02M 11/00 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Department of State (DOS)
| US 12065666 | Jin et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Rutgers, the State University (New Brunswick, New Jersey) |
| ASSIGNEE(S) | RUTGERS, THE STATE UNIVERSITY OF NEW JERSEY (New Brunswick, New Jersey) |
| INVENTOR(S) | Shengkan Jin (Belle Mead, New Jersey); Juan-Carlos Collantes (Princeton, New Jersey) |
| ABSTRACT | The present invention discloses systems for targeted gene editing and related uses. |
| FILED | Thursday, January 04, 2018 |
| APPL NO | 16/475412 |
| ART UNIT | 1636 — Molecular Biology, Bioinformatics, Nucleic Acids, Recombinant DNA and RNA, Gene Regulation, Nucleic Acid Amplification, Animals and Plants, Combinatorial/ Computational Chemistry |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/7088 (20130101) A61K 38/50 (20130101) A61K 38/465 (20130101) A61K 48/00 (20130101) Peptides C07K 2319/00 (20130101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 9/22 (20130101) C12N 9/78 (20130101) C12N 15/62 (20130101) C12N 15/90 (20130101) Original (OR) Class C12N 15/113 (20130101) C12N 2310/20 (20170501) C12N 2310/3519 (20130101) C12N 2800/80 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Aeronautics and Space Administration (NASA)
| US 12066074 | Williams et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| ASSIGNEE(S) | United States of America as represented by the Administrator of NASA (Washington, District of Columbia) |
| INVENTOR(S) | Rebecca L. Williams (Huntsville, Alabama); Robert E. Berry (Madison, Alabama); Frederick Scott Gant (Huntsville, Alabama); Jeffrey L. Lindner (Huntsville, Alabama); John S. Townsend (Union Grove, Alabama) |
| ABSTRACT | A system and method for modifying motion of a liquid is provided. Containers are disposed within a liquid contained within a tank. Each container has an open end. Each container is disposed in the liquid such that a portion of the liquid fills a portion of each container to seal its open end. A remainder of each container is filled with a gas. At least one gas pressurization source is in fluid communication with the remainder or gas-containing portion of at least one of the containers for pressurizing the gas therein. Pressure is applied to the gas in each container. For each container, the portion of the liquid contained therein and the pressure applied to the gas therein cooperate to modify movement of the liquid in the tank. |
| FILED | Tuesday, September 27, 2022 |
| APPL NO | 17/935834 |
| ART UNIT | 3657 — Material and Article Handling |
| CURRENT CPC | Ships or Other Waterborne Vessels; Equipment for Shipping B63B 25/14 (20130101) B63B 25/24 (20130101) Containers for Storage or Transport of Articles or Materials, e.g Bags, Barrels, Bottles, Boxes, Cans, Cartons, Crates, Drums, Jars, Tanks, Hoppers, Forwarding Containers; Accessories, Closures, or Fittings Therefor; Packaging Elements; Packages B65D 90/52 (20130101) Springs; Shock-absorbers; Means for Damping Vibration F16F 7/1034 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
National Security Agency (NSA)
| US 12067397 | Lesartre et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | Hewlett Packard Enterprise Development LP (Spring, Texas) |
| ASSIGNEE(S) | Hewlett Packard Enterprise Development LP (Spring, Texas) |
| INVENTOR(S) | Gregg Bernard Lesartre (Fort Collins, Colorado); Anthony M. Ford (Bristol, United Kingdom) |
| ABSTRACT | A packet-processing method includes looking up a first match-action table on a network interface card (NIC) for a received packet; in response to finding a matching entry indicating an action, queuing the received packet in a first queue and storing the action data in an instruction memory; and responsive to not finding a matching entry, queuing the received packet in the first queue and a second queue. The method includes selecting a first packet from the first queue for processing, which comprises performing a corresponding action stored in the instruction memory; selecting a second packet from the second queue for processing, which comprises forwarding a portion of the second packet to a processor, which looks up a second match-action table; and receiving, from the processor, a lookup result, thereby allowing a third packet in the first queue corresponding to the second packet to be processed based on the lookup result. |
| FILED | Tuesday, January 03, 2023 |
| APPL NO | 18/092837 |
| ART UNIT | 2183 — Computer Architecture and I/O |
| CURRENT CPC | Electric Digital Data Processing G06F 9/3824 (20130101) Original (OR) Class |
| VIEW PATENT | @ USPTO: Full Text PDF |
Non-Profit Organization (NPO)
| US 12064476 | Du et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | New York Blood Center, Inc. (New York, New York); Regents of the University of Minnesota (Minneapolis, Minnesota) |
| ASSIGNEE(S) | New York Blood Center, Inc. (New York, New York); Regents of the University of Minnesota (Minneapolis, Minnesota) |
| INVENTOR(S) | Lanying Du (Rego Park, New York); Wanbo Tai (Elmhurst, New York); Fang Li (St. Paul, Minnesota) |
| ABSTRACT | Provided herein are methods of use of subunit immunogenic compositions, in particular for the prevention and treatment of Zika virus infections. |
| FILED | Friday, October 25, 2019 |
| APPL NO | 17/287938 |
| ART UNIT | 1648 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 39/12 (20130101) Original (OR) Class A61K 39/39 (20130101) A61K 2039/55 (20130101) Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 31/14 (20180101) Microorganisms or Enzymes; Compositions Thereof; Propagating, Preserving, or Maintaining Microorganisms; Mutation or Genetic Engineering; Culture Media C12N 7/00 (20130101) C12N 2770/24122 (20130101) C12N 2770/24134 (20130101) C12N 2770/24171 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
U.S. State Government
| US 12064413 | Li et al. |
|---|---|
| FUNDED BY |
|
| APPLICANT(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| ASSIGNEE(S) | The Board of Regents of the University of Texas System (Austin, Texas) |
| INVENTOR(S) | Rong Li (Washington, District of Columbia); Bin Yuan (Hefei, China PRC); Tyler Curiel (San Antonio, Texas) |
| ABSTRACT | The present invention provides methods and compositions for treating or preventing melanoma with S-equol. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule. |
| FILED | Monday, August 15, 2022 |
| APPL NO | 17/819863 |
| ART UNIT | 1643 — Immunology, Receptor/Ligands, Cytokines Recombinant Hormones, and Molecular Biology |
| CURRENT CPC | Preparations for Medical, Dental, or Toilet Purposes A61K 31/353 (20130101) Original (OR) Class Specific Therapeutic Activity of Chemical Compounds or Medicinal Preparations A61P 35/00 (20180101) Peptides C07K 16/2818 (20130101) C07K 16/2827 (20130101) |
| VIEW PATENT | @ USPTO: Full Text PDF |
Government Rights Acknowledged
How To Use This Page
THE FEDINVENT PATENT DETAILS PAGE
Each week, FedInvent analyzes newly granted patents and published patent applications whose origins lead back to funding by the US Federal Government. The FedInvent Patent Details page is a companion to the weekly FedInvents Patents Report.
This week's information is published in the FedInvent Patents report for Tuesday, August 20, 2024.
The FedInvent Weekly Patent Details Page contains a subset of patent information to provide a deeper dive into the week’s taxpayer-funded patents to help the reader better understand where a patent fits in the federal innovation ecosphere.
HOW IS THE INFORMATION ORGANIZED?
Patents are organized by the funding agency. Within each group, the patents are organized in numeric order. A patent funded by more than one agency will appear in the section of each of the agencies that funded the research and development that resulted in the invention. This approach gives the reader a complete view of the department or agency activity for the week.
WHAT INFORMATION WILL I FIND?
THE PANEL
There is a panel for each patent that contains the patent number and the title of the patent. When you click the panel, it opens to reveal the following information:
FUNDED BY
The agencies that funded the grants, contracts, or other research agreements that resulted in the patent. FedInvent includes as much information on the source of the funding as possible. The information is presented in a hierarchy going from the Federal Department down to the agencies, subagencies, and offices that funded the work. Here are two examples:
Department of Health and Human Services (HHS)
National Institutes of Health (NIH)
National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK)
Department of Defense (DOD)
Defense Advanced Research Projects Agency (DARPA)
Army Research Office (ARO)
We do our best to provide detailed information about the funding. In some cases, the patent only reports limited information on the origins of the funding. FedInvents presents what it can confirm. We add the patents without the information required by the Bayh-Dole Act to our list of patents worthy of further investigation.
APPLICANT(S) and ASSIGNEES
FedInvent includes both the Applicants and the Assignees because having both provides more information about where the inventive work was done and by what organizations. Many organizations — universities, corporations, and federal agencies — standardize the Assignee/Owner information by the time a patent is granted. In the case of federal patents, many of the patents use the agency headquarters information for patent assignment.
Showing just the headquarters address would make Washington, DC the epicenter of all taxpayer-funded research and development. Providing both the applicant information and the assignee information provides a more accurate picture of where important taxpayer funded innovation is happening in America. Here are two examples from two different patents:
APPLICANT: U.S. Army Research Laboratory, Adelphi, MD
ASSIGNEE: The United States of America as represented by the Secretary of the Army Washington, DC
APPLICANT: Optech Ventures, LLC (Torrance, California)
ASSIGNEE(S): The Regents of the University of California (Oakland, California); Optech Ventures, LLC (Torrance, California)
INVENTOR(S)
The inventors appear in the same order as they appear on the patent. FedInvents presents the names in first name/last name order because they are easier to read than the last name/first name order of the names on the USPTO patent documents.
ABSTRACT
The abstract as it appears on the patent.
FILED
The date of the patent application including the day of the week.
APPL NO
This is the patent application serial number. If you’d like to learn more about how application serial numbers work you can go to the Lists Page.
ART UNIT
Patent data includes the Art Unit where a patent was examined. (The Art Unit isn’t available for published patent applications.) The Art Unit provides insight into what group of patent examiners prosecuted the patent application and the subject matter that the examiners work on. For example:
3793 — Medical Instruments, Diagnostic Equipment, and Treatment Devices
You can learn more about ART UNITS on the FedInvent Patents Weekly panel called About Tech Center or you can find information on the FedInvent Lists Page.
CURRENT CPC
Current CPC provides a list of the Cooperative Patent Classification symbols assigned to the patent. These are the CPC symbols assigned at the time the patent was granted.
The FedInvent Project is a patent classification maximalist endeavor or put another way, we believe that more you understand about patent classification the more you'll learn about the nature of the invention and the types of work that the federal government is funding.
The symbol presented in BOLD is the symbol identified as the "first" classification which is the most relevant classification on the patent. The date that follows the symbol is the date of the most recent revision to the art classed there.
- A61B 1/149 (20130101)
- A61B 1/71 (20130101)
- A61B 1/105 (20130101)
The CPC symbols match the classifications found on the PDF version of the patent. Over time, the classifications on the full-text version of the patent change to reflect how USPTO organizes patent art to support its examiners. The two sets of CPCs don’t always match.
VIEW PATENT
As of June 2021, we include two ways to view a patent at USPTO. FedInvent provides a link to the Full-Text Version of the patent and a link to the PDF version of the patent.
HOW DO I FIND A SPECIFIC PATENT ON A PAGE?
You can use the Command F or Control F to find a specific patent you are interested in.
HOW DO I GET HERE?
You navigate to the details of a patent by clicking the information icon that follows a patent on the FedInvent Patents Weekly Report.
You can also reach this page using the weekly page link that looks like this:
https://wayfinder.digital/fedinvent/patents-2022/fedinvent-patents-20240820.html
Just update the date portion of the URL. Tuesdays for patents. Thursdays for pre-grant publication of patent applications.
Download a copy of the How To Use This Page